ID: 1137586238

View in Genome Browser
Species Human (GRCh38)
Location 16:49665402-49665424
Sequence GTTTGCTAGGAGAAGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137586232_1137586238 9 Left 1137586232 16:49665370-49665392 CCTAGGTGGAGGGACAACATTTG 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1137586228_1137586238 25 Left 1137586228 16:49665354-49665376 CCTGTGGAGCTCGCAGCCTAGGT 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137586238 Original CRISPR GTTTGCTAGGAGAAGTGTGT GGG Intronic
900092749 1:927531-927553 GCTTCCTAGGGGAAGGGTGTGGG - Intronic
900575105 1:3379129-3379151 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575125 1:3379185-3379207 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575130 1:3379199-3379221 GTGTGCTGGGAGAGGTGTGCTGG - Intronic
900575140 1:3379241-3379263 GTGTGCTGGGAGGACTGTGTTGG - Intronic
900575153 1:3379283-3379305 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575163 1:3379311-3379333 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575176 1:3379353-3379375 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575186 1:3379381-3379403 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575201 1:3379423-3379445 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575231 1:3379521-3379543 GTGTGCTGGGAGGACTGTGTTGG - Intronic
900575239 1:3379549-3379571 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575249 1:3379577-3379599 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575284 1:3379689-3379711 GTGTGCTGGGAGGACTGTGTTGG - Intronic
900575296 1:3379731-3379753 GTGTGCTGGGAGGACTGTGTTGG - Intronic
900575309 1:3379773-3379795 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575343 1:3379871-3379893 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575353 1:3379899-3379921 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
905872423 1:41412772-41412794 GTTGGCTAGGAGGGGTGAGTTGG + Intergenic
909003359 1:70245540-70245562 GATTACTAGGAGAAGAGTGATGG + Intronic
909771934 1:79434727-79434749 GTTTAATATGAGAAGTGTTTGGG - Intergenic
910083286 1:83369086-83369108 TTTTGCAAAGAGAGGTGTGTAGG + Intergenic
911062545 1:93760734-93760756 GTTTGCTGGGAGATGAGTCTGGG - Intronic
911159695 1:94672060-94672082 GTTGGCCAAAAGAAGTGTGTGGG + Intergenic
912230919 1:107791318-107791340 GTTTTCTAGGAGAACTGTGCTGG + Intronic
913441409 1:118901944-118901966 GTTTGGTAGTGGAATTGTGTGGG + Intronic
917613567 1:176714740-176714762 GTTTTCTAGGAGAAGGTAGTTGG - Intronic
918713681 1:187763261-187763283 GTTTGCCAGGAGAAGTGAGAGGG + Intergenic
919044511 1:192434147-192434169 GGTTGCTAGGAGTTGAGTGTTGG - Intergenic
919315908 1:195970184-195970206 TTATGCTGGGAGAAGAGTGTGGG + Intergenic
920530620 1:206699442-206699464 GTTTCTAAGGAGAAGTGTGAGGG + Intronic
920926412 1:210345589-210345611 GTTTACTATTAGAAGTGTTTTGG + Intronic
921177200 1:212605958-212605980 GTTTGCATGGAGAAGAGTTTTGG + Intronic
922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG + Intergenic
923459770 1:234198266-234198288 ATTTCCTAGGAAAAGTGTGCTGG + Intronic
1065288551 10:24208226-24208248 GTTTAAAAGGAGAAGTATGTTGG + Intronic
1065873888 10:29980466-29980488 GTTTACTATTAGAAGTGTTTTGG + Intergenic
1066157544 10:32694288-32694310 GTTTACTATTAGAAGTGTTTTGG + Intronic
1067323405 10:45243960-45243982 GTTTGCAAGCAGAGGTGGGTTGG - Intergenic
1070010870 10:72473141-72473163 GTTTACTATTAGAAGTGTTTTGG - Intronic
1075405121 10:122189903-122189925 TTTAGCTGGGATAAGTGTGTTGG + Intronic
1076241728 10:128913726-128913748 AATTGCTAGGAGAAGTGTATAGG + Intergenic
1078455133 11:11469026-11469048 GTTTGGTAGGGACAGTGTGTTGG + Intronic
1079745789 11:24127936-24127958 GTTTAGTAGGAGAAGAGTGATGG - Intergenic
1082109052 11:48253007-48253029 GTTTGATAGGAGTAGTGTTGAGG + Intergenic
1082205838 11:49433311-49433333 GTCTGCTATGACAAGAGTGTTGG - Intergenic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083193688 11:61070218-61070240 GTTTGCAAAGAAAAGTGTCTAGG + Intergenic
1086649258 11:89267195-89267217 GTCTGCTATGACAAGAGTGTTGG + Intronic
1090486954 11:127121672-127121694 GTTTACTATTAGAAGTGTTTTGG + Intergenic
1095374085 12:41505509-41505531 GTTTGCTAGGGAAAATGTGTAGG + Intronic
1096933661 12:55243493-55243515 GTTTGTTAGGAGAGGTGAGATGG - Intergenic
1097146315 12:56941863-56941885 GTTTGCTATGGAGAGTGTGTGGG - Intergenic
1099317161 12:81098360-81098382 GTTTACTATTAGAAGTGTTTTGG + Intronic
1099380693 12:81948956-81948978 GTTTACTATTAGAAGTGTTTGGG - Intergenic
1099510874 12:83535563-83535585 TTTTACTAGGAGAAGTATGATGG - Intergenic
1100007014 12:89906817-89906839 GTTTCCTAGGGGCAGTGTGAGGG + Intergenic
1100892430 12:99140820-99140842 GTTTACTAGGAGAATGGAGTAGG - Intronic
1101608629 12:106269874-106269896 GTTTACTATGAGAAGTGTTTTGG - Intronic
1106042527 13:26107107-26107129 GTTTGCTTTGACAAGAGTGTGGG - Intergenic
1106941798 13:34788211-34788233 ATTTCCTAGGAAAAATGTGTGGG - Intergenic
1107728660 13:43326133-43326155 ATTTGCTAGGGAAAGTGTCTTGG + Intronic
1108055624 13:46482092-46482114 GTTGCCTAGGAGAAGGGTATGGG - Intergenic
1109989186 13:70031249-70031271 GTTTGCAAGGTGATGTGTATAGG - Intronic
1110418722 13:75280433-75280455 GTTTGATATTAGAAGTGTTTGGG - Intergenic
1112260340 13:97872421-97872443 GTTGAATAGGTGAAGTGTGTGGG + Intergenic
1113897030 13:113771132-113771154 GGGTGCTAAGAGAAGGGTGTGGG - Intronic
1115536505 14:34378224-34378246 CTTCTCTAGGAGGAGTGTGTGGG - Intronic
1116544503 14:46147584-46147606 GGCTGCTAGGAAAAGTGTATGGG - Intergenic
1119152543 14:72375514-72375536 GCTTGCCAGGAGCAGTCTGTGGG - Intronic
1119888245 14:78162421-78162443 GGTTCCTAGGAGAAGAATGTGGG + Intergenic
1120286820 14:82513430-82513452 GTTTCCTAGGAAAAGTGAGGAGG + Intergenic
1121290358 14:92769467-92769489 GCTTGCTAGGACAAGTGGGATGG + Intergenic
1121945856 14:98121203-98121225 ATTTGATAGGAAAACTGTGTTGG + Intergenic
1122388183 14:101362964-101362986 GTGGGCTGGGAGAAGTGGGTAGG - Intergenic
1124465392 15:29934808-29934830 CTTTGCTATGAGTAGTGTGAAGG + Intronic
1127743457 15:61938187-61938209 GGTTGGTATGAGAAGTGGGTTGG - Intronic
1128397235 15:67240573-67240595 GTTTGCTACTAGAACTGGGTTGG - Intronic
1128645146 15:69372757-69372779 GCTTACTAGGAGAAGTGATTGGG - Intronic
1130857668 15:87855447-87855469 GTTGGCTAAGGGAAGAGTGTTGG - Intergenic
1134252732 16:12585897-12585919 GTGTGGGTGGAGAAGTGTGTTGG - Intergenic
1135689285 16:24523216-24523238 GTTCAATAGGAGAAGTGTGTTGG + Intergenic
1137463156 16:48684133-48684155 GTTTGCTAGGCCAGGTGTGGTGG - Intergenic
1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG + Intronic
1138296005 16:55885675-55885697 GTTAGCTAGGAGCAGCCTGTGGG + Intronic
1141364146 16:83426756-83426778 GTTTGGTAGGACAAGTGGGAGGG - Intronic
1142299713 16:89249211-89249233 GTTATCTGGGAGAAGTTTGTCGG + Intergenic
1143261201 17:5599631-5599653 GTCGGCAAGGAGAGGTGTGTGGG - Intronic
1143839203 17:9718117-9718139 GTTTAATAGTAGAAGTGTTTGGG + Intronic
1148823210 17:50373009-50373031 GGATGCGAGGGGAAGTGTGTGGG - Intronic
1149447707 17:56726338-56726360 GTGTGTTGGGAGAAGTGTTTTGG - Intergenic
1150229997 17:63544559-63544581 GTTTGCTAGGGGAAGTCATTGGG - Intronic
1155350266 18:24899410-24899432 GTTTGCTAAGAGGAGAGTGAGGG - Intergenic
1156485436 18:37462630-37462652 GTTTGCTGGGAGAGGGGAGTAGG + Intronic
1158575117 18:58630527-58630549 TTTTGCTAGGAGATGAATGTTGG - Intergenic
1161753328 19:6113529-6113551 GCTTGGTGGGAGAAGTGGGTGGG + Intronic
1165231154 19:34387812-34387834 GCTTGTTAGGTGAAGTGGGTGGG + Intronic
925068005 2:944109-944131 CTTTGGAAGGAGATGTGTGTTGG + Intergenic
926665446 2:15517041-15517063 GTTTCCTTGGAGCAGTTTGTGGG - Intronic
928691129 2:33799918-33799940 GTTTGATAGCATGAGTGTGTGGG - Intergenic
931810573 2:65850631-65850653 GTTTACTACTAGAAGTGTTTTGG + Intergenic
932960921 2:76411490-76411512 GGTTATTAGGTGAAGTGTGTGGG + Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
937195143 2:120147732-120147754 GTTTGCCAGGAGAAGGGTAATGG + Intronic
938979835 2:136515744-136515766 GTTTAATATGAGAAGTGTTTTGG + Intergenic
940225810 2:151400011-151400033 ATTTGCTAAGAACAGTGTGTGGG - Intergenic
940265267 2:151829187-151829209 GGTAGTTAGGAGAAGTGAGTTGG - Intergenic
940630344 2:156230159-156230181 GTTGGCTAGGATAAGTATTTAGG - Intergenic
940862982 2:158789365-158789387 GTTTTCTAGGTGGGGTGTGTTGG - Intergenic
942536068 2:176965720-176965742 CTTTGCTGGGGGAAGAGTGTTGG + Intergenic
1172732999 20:37104188-37104210 GTTTGGGAGCAGAAGTGTTTTGG + Intronic
1173037686 20:39428302-39428324 GTTTCCAAGGACAAGTGTGTAGG - Intergenic
1175089470 20:56489922-56489944 GTTTGCCTGTAGAAATGTGTGGG + Intronic
1180984157 22:19894587-19894609 GTTGCCTAGGAGGAGTGTGGTGG - Intronic
1183822905 22:40361280-40361302 GTTTGCCAGGAGGCGTATGTCGG - Exonic
951194811 3:19812361-19812383 TTTTGCTTTGAGAAGTCTGTAGG - Intergenic
952218646 3:31302432-31302454 GTTAGGCTGGAGAAGTGTGTGGG - Intergenic
953161322 3:40422843-40422865 TTTTGGTAGGAGAATTCTGTAGG - Exonic
953649591 3:44789886-44789908 GTTTAATATTAGAAGTGTGTTGG - Intronic
954419624 3:50411905-50411927 CTTTGCTAGGAGCAGGGTCTGGG - Intronic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
957194673 3:77052099-77052121 GGTTGCTAGGAGAAGTGCACTGG + Intronic
959104880 3:102054284-102054306 GTTTGATATTAGAAGTGTTTTGG - Intergenic
959560771 3:107778181-107778203 GTTTACTAAGAAAACTGTGTTGG + Intronic
960573531 3:119207642-119207664 GGTTGGTTGGAGAAGTGTATGGG - Intergenic
961703101 3:128762388-128762410 GTTTGCTTGGTTAACTGTGTTGG - Intronic
962265163 3:133939517-133939539 GTTTGCTAGCAGAACTGTGATGG - Intronic
965751093 3:171975766-171975788 GTGTGATAGGAGAAAAGTGTAGG + Intergenic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
969258420 4:6018871-6018893 GTTTGCTAGGGGAAGAGGATGGG + Intergenic
973123391 4:46552635-46552657 GTTTGATATTAGAAGTGTTTGGG - Intergenic
975325605 4:73055350-73055372 GTTTTCTAGGAGCAGTGATTTGG - Intergenic
981142212 4:141282180-141282202 CTTAGCTAGGAAAATTGTGTAGG + Intergenic
981771543 4:148315586-148315608 GTTTGTCAGAAGAAGTGTTTTGG - Intronic
984495439 4:180491409-180491431 GATTGTTAGGAGCAGTGGGTTGG - Intergenic
984636303 4:182113681-182113703 GTGTGGTGGGAGAAGTGTGGGGG + Intergenic
985718621 5:1476741-1476763 GGTTGCAAGGACAAGTGTGGGGG + Intronic
992285440 5:75230330-75230352 GTTTACTATCAGAAGTGTTTTGG + Intronic
992850987 5:80807354-80807376 GTTTAATATTAGAAGTGTGTTGG - Intronic
992955360 5:81902513-81902535 GTTTTCATGGAGAACTGTGTTGG - Intergenic
995194967 5:109356522-109356544 GTTTGGTACCAGAAGTGTTTGGG - Intronic
996466041 5:123803703-123803725 GCTTGCTAGGAGAGATGTCTGGG + Intergenic
996721616 5:126636027-126636049 CTTAGCAAGCAGAAGTGTGTGGG + Exonic
997375708 5:133395739-133395761 GTTTGCTAGGTTGAGAGTGTGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997717124 5:136050629-136050651 GTTTGAGAGGAAAAGTGTGGTGG - Intronic
997762569 5:136463718-136463740 GTTTGCTGGGAGAGGTGGGGTGG - Intergenic
997865587 5:137459922-137459944 GTATGCTAGGAGAAGGGGCTTGG + Intronic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1004340367 6:14803074-14803096 GTTTGCTAGCACAGGTGTGCAGG - Intergenic
1005150527 6:22743747-22743769 GTTTGCCAAGGGAAATGTGTTGG + Intergenic
1005912766 6:30325939-30325961 GTATGCTGGGAGAGGTGTGAGGG - Intergenic
1008682355 6:53886312-53886334 GTTTGATACTAGAAGTGTTTTGG - Intronic
1010375219 6:75160901-75160923 GTTTCTTATGAGAAGTGTTTTGG - Intronic
1010642720 6:78349563-78349585 GCTGGCTAGGACAAGTGTGATGG + Intergenic
1013837088 6:114345359-114345381 TTCTGCTAGGTGAAGTGTGGAGG + Intergenic
1013850057 6:114503357-114503379 TTTTCCTAGGAGGAATGTGTAGG + Intergenic
1014356170 6:120412947-120412969 ATTGGATAGGAGAGGTGTGTGGG - Intergenic
1015319156 6:131852375-131852397 GTTTGGTATGAGAACTGTTTTGG + Intronic
1016577303 6:145583998-145584020 GTTTGCTAGCAGGAGTGGGTGGG + Intronic
1018366518 6:163125795-163125817 GTTTCCTAGGAGTAGAGTTTAGG - Intronic
1019049788 6:169174088-169174110 GTTAGTTGAGAGAAGTGTGTGGG - Intergenic
1022642652 7:32203001-32203023 GTTTGCTAGGAGCTGGGTGTGGG - Intronic
1023603270 7:41902007-41902029 GTTTGCTATTAGAAGTGTTTGGG - Intergenic
1024318476 7:48043081-48043103 CTATGCTAGGAGAACGGTGTGGG + Intronic
1026202247 7:68224391-68224413 GGTTGCTAGGAGAAGTGCTTGGG - Intergenic
1026272268 7:68846862-68846884 GTTTGCTTGGTGAAGAGTGCAGG - Intergenic
1027300118 7:76825229-76825251 TTTTGCAAAGAGAGGTGTGTAGG + Intergenic
1028655427 7:93200482-93200504 GTTTGATATTAGAAGTGTTTGGG - Intronic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1029884453 7:103852152-103852174 GTTTCTTGGGAGAAGTGTTTTGG + Intronic
1030617851 7:111757023-111757045 GTTTGCCAGGAGGAGAGTGGGGG + Intronic
1032669258 7:134068408-134068430 GTAGGCAAGGAGAAATGTGTGGG - Intergenic
1033614697 7:143003014-143003036 ATTAGCTAGGAGCAGTCTGTGGG - Intergenic
1034135317 7:148762605-148762627 GTTTCATAAGAGAAGTGTTTAGG - Intronic
1034294954 7:149964056-149964078 TTTTGCTAGAAGAAAAGTGTGGG + Intergenic
1034811107 7:154132890-154132912 TTTTGCTAGAAGAAAAGTGTGGG - Intronic
1041720438 8:60970455-60970477 GTTTCCTAAGAAAAGCGTGTGGG + Intergenic
1042029963 8:64465030-64465052 GTTTGCTAGGAGAGGGGTGTGGG - Intergenic
1043212708 8:77544600-77544622 ATCTGCTATGATAAGTGTGTTGG + Intergenic
1046454863 8:114445193-114445215 GTTTGATAGGACTAGTGTTTTGG - Intergenic
1048132446 8:131712644-131712666 GTTTTCTAGCAGTACTGTGTAGG - Intergenic
1050328153 9:4517625-4517647 GTTTGCTTGCAGAGGTATGTGGG + Intronic
1050401960 9:5265999-5266021 GTTAACTAGGAGAAGCATGTGGG + Intergenic
1050597391 9:7217146-7217168 TTTAGCTTGGAGAAGTTTGTTGG - Intergenic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1052266529 9:26579824-26579846 GTTTGCTAGTAGAAGATTATTGG - Intergenic
1053168745 9:35863257-35863279 GATTGCTAGGAGAAGGGCTTTGG + Intergenic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1055764562 9:79648440-79648462 GATTGCTTGGAGAAGGCTGTAGG + Intronic
1059989614 9:119852979-119853001 ATTTGCTGGGAGAGGGGTGTAGG + Intergenic
1062082977 9:134634151-134634173 GTCTGCAGGGAGAAGTGTCTAGG + Intergenic
1186492240 X:9983168-9983190 GTTTGCTAGGTGAAGTGGATGGG - Intergenic
1188010052 X:25045509-25045531 CTTTGCAAGGAAGAGTGTGTAGG + Intergenic
1190076879 X:47323220-47323242 ATTTGATATGAGAAGTGTTTGGG + Intergenic
1190498006 X:51045664-51045686 GTTTGATATGAGAAATGTTTTGG + Intergenic
1190989443 X:55530581-55530603 GTTAGCTAGGAGAAGAGTGAGGG + Intergenic
1195097577 X:101519329-101519351 GGTTGCTAGGAGCTGGGTGTAGG - Intronic
1198167219 X:134069962-134069984 GGTTGGAAGGAGAAGTGTGGTGG - Intergenic