ID: 1137586397

View in Genome Browser
Species Human (GRCh38)
Location 16:49666321-49666343
Sequence TGTCGAAGGCAGGTGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137586397 Original CRISPR TGTCGAAGGCAGGTGGGGAA TGG (reversed) Intronic
901648497 1:10729168-10729190 CGTTGAAGGCAGGTGGCCAATGG + Intronic
901720778 1:11195475-11195497 TGAAGGAGGCAGGTGGGAAATGG + Exonic
902264855 1:15256014-15256036 TGTCCAATGCAGGTGGGGGCAGG - Intronic
902387440 1:16083783-16083805 TCTCGAAGGCAGGTGAGGCCTGG - Intergenic
902742509 1:18448729-18448751 TGTCCAAGGCAGATGGAGATAGG - Intergenic
905651736 1:39661337-39661359 TGTATGAGGCAGGTGGGGCAAGG - Intronic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906945942 1:50294369-50294391 TGTGGGAGGGAGGTGGGGAGAGG - Intergenic
907633300 1:56106580-56106602 TGGTGAGGGCAGGTGGGGAAAGG + Intergenic
908424625 1:63994560-63994582 TGGAGAAGGCTTGTGGGGAAAGG + Intronic
913557923 1:119987522-119987544 CCTCCAAGCCAGGTGGGGAAGGG + Intronic
915758753 1:158289780-158289802 TGTCTAAGGCAGTTGAGGAAGGG + Exonic
915758826 1:158290482-158290504 TGTCTAAGGCAGTTGAGGAAGGG + Intronic
918194568 1:182209269-182209291 TTTGTAAGGAAGGTGGGGAAAGG - Intergenic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
919382637 1:196877788-196877810 TTTTGGAGGCAGGTGGGGAGAGG + Intronic
920198436 1:204244825-204244847 AGTAGAAGGTAGGTGGGGGAGGG - Intronic
920342440 1:205284129-205284151 TGCAGTGGGCAGGTGGGGAAGGG - Intergenic
920978164 1:210805457-210805479 GGTGGAAAGCAGGTGGGGATGGG - Intronic
921186619 1:212675696-212675718 TGTCGAAAGAAGGAAGGGAAGGG + Intergenic
923389763 1:233502422-233502444 TGTAGAAGGAAGGTGGGCCAGGG + Intergenic
923396123 1:233566486-233566508 GGTGGAAGGGAGGTGGGGATAGG + Intergenic
924487433 1:244499489-244499511 TGTCGAGGGGTGGGGGGGAAGGG - Intronic
924946840 1:248852230-248852252 TGTTGGAGGCTGGTGGAGAAAGG - Intronic
1062863361 10:828014-828036 TGTGAAGGGCAGGTGGGGACAGG - Intronic
1064259599 10:13774540-13774562 TGTCCCAGGCAGGAAGGGAAGGG + Intronic
1065125384 10:22568882-22568904 TGTCCAGTGCAGGAGGGGAAGGG - Intronic
1065232624 10:23613944-23613966 TGTCGGGGGCTGGTGGGCAAGGG - Intergenic
1065610883 10:27469711-27469733 TGTCGGTGTCAGGAGGGGAACGG - Intergenic
1065706590 10:28476467-28476489 TGTCCAAGTCAGGTCGGGAAAGG + Intergenic
1066156929 10:32688088-32688110 TGTCCAAGGAAGATGAGGAAGGG - Intronic
1067046814 10:42989802-42989824 GGTTGGAGGAAGGTGGGGAAGGG - Intergenic
1067069808 10:43123488-43123510 TGTAGCATGAAGGTGGGGAAGGG - Intronic
1067328861 10:45295393-45295415 TGTCGGAGGGTGGTGGGCAAGGG - Intergenic
1069834164 10:71298111-71298133 GGACGAAGGCAGATGGGGATGGG - Intronic
1070750395 10:78960830-78960852 TGTGGAAGGGAGGTGGGGTGCGG - Intergenic
1070829235 10:79408486-79408508 TGTCGAGGGCACATGTGGAAAGG - Intronic
1071526975 10:86364748-86364770 TGTCGAGGGGAGTGGGGGAAGGG + Intronic
1073149536 10:101302362-101302384 GGTAGATGGAAGGTGGGGAATGG + Intergenic
1073585318 10:104704465-104704487 TGTAGAAGTCAGCTGGGGCATGG - Intronic
1073740126 10:106397247-106397269 TGTAGAAACCAGCTGGGGAATGG + Intergenic
1074433030 10:113409484-113409506 TGCCCATGGCTGGTGGGGAAGGG + Intergenic
1075903245 10:126060443-126060465 TGTCAAGGGCCGGTGGGGCAAGG + Intronic
1076838630 10:133033651-133033673 TGATGAAGGCAGGAGGGGAGGGG + Intergenic
1077213110 11:1382624-1382646 TGACGAAGGCAGGGCGGGAGTGG + Intergenic
1080623008 11:34003122-34003144 TGTCGAGGGAAGGTGGTGACTGG + Intergenic
1081644151 11:44778166-44778188 TGGGGAAGGAAGGTGGGGAGAGG + Intronic
1083261743 11:61526881-61526903 CTGGGAAGGCAGGTGGGGAAAGG + Intronic
1083937154 11:65875660-65875682 TGCCAGAGGAAGGTGGGGAATGG + Intergenic
1084580213 11:70018610-70018632 TGTCCAAGCCAGGTTGGGAGGGG - Intergenic
1085831753 11:79908807-79908829 TGTAGGTGGCAGGTGGGCAAGGG - Intergenic
1086406387 11:86502799-86502821 GGTCTGAGGCAGGTGGGCAAAGG - Intronic
1086857212 11:91879172-91879194 TGAGGAAGGCAGGTGGGGCCAGG - Intergenic
1087007277 11:93482493-93482515 TGTCCAAGGCAGGCAGAGAAAGG + Intronic
1087106205 11:94410123-94410145 TGTCGTGGGGTGGTGGGGAAGGG - Intergenic
1087290479 11:96315199-96315221 TGTAGATGGAAGGTGGGGAATGG + Intronic
1088668890 11:112121974-112121996 TGGCGAAGGCAGCAGGAGAAGGG + Intronic
1088905786 11:114154771-114154793 TGTCTTTGGCAAGTGGGGAAAGG + Intronic
1089171662 11:116515924-116515946 TGTCTCAGGCAGGTGGAGACAGG + Intergenic
1090409578 11:126498610-126498632 TGTCACAGCCAGGAGGGGAAGGG + Intronic
1090657847 11:128859624-128859646 TGTCTAAGGCAGGAGGGAAAAGG + Intronic
1090982659 11:131737098-131737120 TGTCAAGGGCAGGGAGGGAATGG + Intronic
1091391597 12:129495-129517 GGTCGAAGGCAGAGGGAGAAGGG - Intronic
1092177339 12:6419227-6419249 TGTAGTGGGCAGGTTGGGAATGG - Intergenic
1092995014 12:13941461-13941483 TTTCAAAGCCAGGTGAGGAACGG + Intronic
1094224088 12:28026388-28026410 TGTGGAGGGCAGATGGAGAAGGG - Intergenic
1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG + Intergenic
1096980369 12:55725152-55725174 TGTCCAAGGCAGATGGGGGCTGG + Intergenic
1098815703 12:75159113-75159135 TGTCGGAGGGTGGGGGGGAAAGG + Intronic
1102333185 12:112053397-112053419 TGTCCAAGGCTGGTAGGGAGAGG - Intronic
1102956309 12:117061364-117061386 TGGGGAAGGCACCTGGGGAAGGG - Intronic
1105415005 13:20203687-20203709 TCTGGAAGGCAGTTGGGGTAGGG + Intergenic
1106071275 13:26413503-26413525 GGTGGCAGGCAGCTGGGGAATGG + Intergenic
1109367061 13:61369274-61369296 TGTCGAGGGGTGGTGGGCAAGGG + Intergenic
1111306702 13:86422929-86422951 GAGCAAAGGCAGGTGGGGAAGGG - Intergenic
1111763856 13:92500784-92500806 TATCTAAGGCAGGTGGTGAGTGG - Intronic
1112682282 13:101780612-101780634 GTTTGAAGTCAGGTGGGGAAAGG + Intronic
1113033861 13:106026364-106026386 AGTGGAAGTCGGGTGGGGAATGG - Intergenic
1113781169 13:112978370-112978392 TGTGGAAGGCAGGAGGGGGATGG + Intronic
1114549760 14:23525948-23525970 GGTCCAAGGGAGGTGGGGGAGGG + Exonic
1117537410 14:56715081-56715103 TGGTGAAGGAAGGTGGGGGAAGG - Intronic
1118332488 14:64825049-64825071 TCAGGAGGGCAGGTGGGGAAAGG + Intronic
1118332516 14:64825169-64825191 TCAGGAGGGCAGGTGGGGAAAGG + Intronic
1118485718 14:66212914-66212936 TCTCAAAGGCAGTTTGGGAAAGG + Intergenic
1119536916 14:75410142-75410164 AGTAGGAAGCAGGTGGGGAATGG - Intergenic
1119850269 14:77861780-77861802 TGTTGCAGGCAGGTGGGGCCCGG + Intronic
1120316905 14:82905910-82905932 TGGCAAAGGCAGATGAGGAAGGG + Intergenic
1120327644 14:83050673-83050695 TGTGGAAGGCAGAAAGGGAAGGG - Intergenic
1121525453 14:94616194-94616216 TGTTAGAGGCAGGTGGGGAGGGG - Intronic
1122742436 14:103880083-103880105 TGCCCAAAGCAGGAGGGGAAAGG - Intergenic
1123632071 15:22268444-22268466 GGTGGAAGGCAGAAGGGGAAAGG - Intergenic
1124160018 15:27259799-27259821 GGTGGAAGGCAGGTGGAGTAGGG + Intronic
1124218854 15:27832233-27832255 TGTGCAGGGCAGGTGGGGAAAGG - Intronic
1125676973 15:41507340-41507362 TGTCCTGGGCAGGTGGGGGAGGG - Intronic
1127311091 15:57752968-57752990 TGTCTTAGGCAGCCGGGGAAGGG + Intronic
1127819172 15:62640189-62640211 TGTAGAAGACAGGTAGGGAGTGG + Exonic
1130569611 15:85029872-85029894 TGTCTAAGGCAGGTGGGAAGGGG + Intronic
1130638371 15:85646797-85646819 TGCCTAAGGGAGGTGGGGAATGG + Intronic
1130813953 15:87411006-87411028 TTTCCAAGGCAGGGGGAGAAAGG - Intergenic
1131002730 15:88951564-88951586 TGTTGGTGGCAGGTGGGGAGAGG - Intergenic
1131176135 15:90210903-90210925 TGTCTAAGGCAGGTGGAGGGAGG + Intronic
1133172263 16:3988535-3988557 TTTCCAGGGCAGGTGGGGAGGGG + Intronic
1133281255 16:4666695-4666717 TGCCGCAGGCAGGTGGCGGAAGG - Intronic
1133308500 16:4827106-4827128 TGGCGGAGGCAGGCAGGGAAAGG - Intronic
1134009856 16:10843846-10843868 TGCAGACGGCAGGTGGGGAAGGG - Intergenic
1134109177 16:11503980-11504002 TGCCAAGGGCAGCTGGGGAAAGG - Intronic
1135379056 16:21978509-21978531 TGGAAAAGGCAGGTGGGGAAGGG - Intronic
1136374437 16:29856988-29857010 TGTAGAAGGCTGGTAGGGATTGG - Intergenic
1136665755 16:31811040-31811062 TGTCAAGGCCATGTGGGGAAAGG - Intergenic
1137586397 16:49666321-49666343 TGTCGAAGGCAGGTGGGGAATGG - Intronic
1138237909 16:55401134-55401156 GGTGGAAGGGAGGTGGCGAATGG - Intronic
1138492216 16:57383209-57383231 TGTCCCTGGCAGGTGGAGAATGG - Exonic
1138823516 16:60290106-60290128 TGTCGAAGGAAGGAGGTGATTGG + Intergenic
1140664149 16:77212947-77212969 TCTCGAGGGAAGGTCGGGAACGG - Exonic
1141883781 16:86878324-86878346 TGGGGAACGCAGGCGGGGAAAGG - Intergenic
1141970924 16:87481943-87481965 GGTGGAAGGCAGAAGGGGAAAGG + Intronic
1142179002 16:88658143-88658165 TGCTGAGGGCAGGGGGGGAAAGG + Intronic
1142311158 16:89314786-89314808 TGCAGAAGGAATGTGGGGAAAGG - Intronic
1142411966 16:89921477-89921499 GGGAGTAGGCAGGTGGGGAAGGG + Intronic
1143189335 17:5030362-5030384 TGGGGAGGGCAGGTGGGGGAAGG - Intergenic
1143561886 17:7701403-7701425 TGTCAAAGGAAGGGGAGGAATGG - Intronic
1144554891 17:16273514-16273536 TGTGGAAAGCAGCTTGGGAAGGG + Intronic
1144722370 17:17480257-17480279 TCTAGAAGCCAGGTGGGGGAAGG - Intronic
1144797722 17:17903791-17903813 TGTCCAAATCAGGAGGGGAAGGG + Intronic
1146157450 17:30535901-30535923 AGTAGCAGGCAGGAGGGGAAGGG - Intergenic
1146290529 17:31603391-31603413 TGTGGGAGGGAGGTGGGTAATGG + Intergenic
1146456792 17:33015046-33015068 TGTGGAACGGAAGTGGGGAAGGG - Intronic
1146839943 17:36144400-36144422 TTTCGAAGTCAGGTGTTGAATGG + Intergenic
1147249520 17:39144686-39144708 AGTGGAAGGCAGGTGGGGTGAGG - Intronic
1147874868 17:43613969-43613991 TGGAGAAGGGAGGTGGGGGAGGG + Intergenic
1148480091 17:47954381-47954403 TGTGGAAGCTTGGTGGGGAAAGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149404281 17:56331029-56331051 TGTTAACAGCAGGTGGGGAATGG + Intronic
1149869331 17:60168358-60168380 TGGGGGGGGCAGGTGGGGAAGGG + Intronic
1149869344 17:60168394-60168416 TGGGGGGGGCAGGTGGGGAAGGG + Intronic
1149869355 17:60168430-60168452 TGTGGGGGGCAGGTGGGGAAGGG + Intronic
1150008254 17:61482979-61483001 GGTCGTAGGGAGGGGGGGAACGG - Exonic
1151196085 17:72432068-72432090 TATGGGAGGCAGGTGGGGATGGG - Intergenic
1151516444 17:74599208-74599230 TGTGGTAGGTAGTTGGGGAAGGG - Intergenic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1153434891 18:5058812-5058834 TATAGATGGGAGGTGGGGAAGGG - Intergenic
1153526405 18:5998661-5998683 TCTCTAAGTCACGTGGGGAAGGG + Intronic
1154198436 18:12282658-12282680 TGGGGAAGGCATGTGGGGCAGGG - Intergenic
1154262314 18:12846898-12846920 TGTGGAAGGCATGTGAGTAAAGG - Intronic
1157110508 18:44816152-44816174 AATGCAAGGCAGGTGGGGAAGGG + Intronic
1157442035 18:47718912-47718934 TGTAGGAGGTGGGTGGGGAAAGG - Intergenic
1158491173 18:57910929-57910951 TGGGGAAGGCAGGTCTGGAAGGG + Intergenic
1159095556 18:63897579-63897601 TATGGAAGGCAGGTGCTGAAGGG - Intronic
1159643890 18:70894592-70894614 TGTTAAATGCAGGTTGGGAATGG + Intergenic
1160893718 19:1393148-1393170 AGTTGAAGGCGGGTGGGGATGGG + Intronic
1161775604 19:6260527-6260549 ATTCGGAGGCAGGTGGGGCAGGG - Intronic
1161851205 19:6739046-6739068 ACTGGAAGGCAGCTGGGGAAAGG + Intronic
1161900317 19:7113865-7113887 TCTCCAGGGCAGGTGGAGAAAGG + Intronic
1165094234 19:33401930-33401952 AGTCCAGGGCAGGTGGGGAGCGG - Intronic
1167376267 19:49114091-49114113 TGTTGAATGAATGTGGGGAAAGG + Intergenic
1167666250 19:50824000-50824022 GGTTGAAGCCAGGTGGGGCAGGG + Intergenic
1168050874 19:53828886-53828908 TTTAGAAGCCACGTGGGGAAAGG + Intergenic
927858254 2:26540739-26540761 GGGCGGGGGCAGGTGGGGAAGGG + Intronic
930614231 2:53577024-53577046 GGTCGCAGGCAGGTTGTGAAAGG + Intronic
931365308 2:61614008-61614030 TGTCGGGGGGATGTGGGGAAAGG - Intergenic
932163570 2:69485452-69485474 TGTGGCAGGAAGGTGGGGAAAGG - Intronic
933377834 2:81502692-81502714 TGTAGAAGGTAGGTGAAGAAAGG + Intergenic
934527059 2:95058554-95058576 TGTCGAAGGCTGGGGGGTGAGGG + Intergenic
936633961 2:114234511-114234533 TGATGTGGGCAGGTGGGGAAGGG - Intergenic
936807147 2:116348413-116348435 TGTCCAAGGTAGGTGGGGGGTGG + Intergenic
937439279 2:121903025-121903047 GGTTGAAGGAAGGTGGTGAATGG + Intergenic
937755926 2:125538641-125538663 TGCCCAAGGCAGGAAGGGAAAGG - Intergenic
943257239 2:185611354-185611376 TGCCAAAGTCAGGTGGGGATGGG + Intergenic
945990546 2:216392258-216392280 TGTCCCAGGCAGGTGGGTAGAGG - Intergenic
946949310 2:224855580-224855602 AGTGGGAGACAGGTGGGGAAGGG - Intronic
947862011 2:233367163-233367185 TGTTATAGGCAGGTAGGGAACGG - Intronic
948180118 2:235972942-235972964 TGTCGCACACAGCTGGGGAAGGG - Intronic
948973404 2:241447352-241447374 TGTGGAAGGCCAGTGGGGAAAGG + Intronic
1168957098 20:1841822-1841844 TCTGGAAGTCAGGTGGGAAAAGG - Intergenic
1169263521 20:4154129-4154151 GGTTGAAGCCAGGTTGGGAAAGG + Intronic
1170378730 20:15732091-15732113 TGTGGAACACAGGTGGGGATGGG + Intronic
1171108090 20:22455270-22455292 TGTCCAAGGCAGGTGAGGGCAGG - Intergenic
1172621480 20:36320699-36320721 GGTCCCAGGCAGGTGGGCAAAGG - Intronic
1172898614 20:38317902-38317924 TGGCAAAGGCAGGTAGGGAATGG + Intronic
1174049949 20:47760544-47760566 TTTCAGAGGCAGGTGGGCAAAGG - Intronic
1174085884 20:48006873-48006895 GGTCAAAGGCAGGAGGGGAAAGG - Intergenic
1174184674 20:48698156-48698178 TGTGGAAGTGAGGTGGGGAATGG + Intronic
1175621367 20:60450333-60450355 GGTGGAAAGAAGGTGGGGAAAGG - Intergenic
1179794130 21:43772694-43772716 AGCGGAAGGCAGGTGGGGGAGGG - Exonic
1179927931 21:44548452-44548474 GGTGGACGGCAGGTGGGGATGGG + Intronic
1179953102 21:44722838-44722860 TGTGGAAGGCAGGTGTGGAGTGG + Intergenic
1181003663 22:19999493-19999515 TGGGGAAGGCAGGTTGGGAGGGG - Intronic
1182150853 22:28026174-28026196 TGTTGAGGGCAGAGGGGGAAGGG + Intronic
1183379393 22:37483387-37483409 TGTCGAGGGCAGGGTAGGAAAGG - Intronic
1184101118 22:42342257-42342279 CGTCCAGGGCAGATGGGGAATGG + Intronic
950183427 3:10930716-10930738 TGGAGAAGGCAGGTGGTGGAGGG + Intronic
950829576 3:15860088-15860110 TGGCGTGGGGAGGTGGGGAACGG + Intergenic
951876699 3:27434671-27434693 TGTGAAAGGGATGTGGGGAATGG + Intronic
954622639 3:52004776-52004798 TGTCCATGGAAGGTGGGGACAGG + Intergenic
956049290 3:65230362-65230384 TGTCTAAGGCTGGTGATGAATGG + Intergenic
957038082 3:75313340-75313362 TGATGAAGGCAGATGGGGAAGGG - Intergenic
957753667 3:84457956-84457978 TGTCGGAGGCTGGGGGGGAAGGG + Intergenic
960946695 3:122971735-122971757 TCTGGAAGGCAGGTGCGGCACGG + Intronic
961108690 3:124264725-124264747 TGTGGATGGCAGAAGGGGAAGGG - Intronic
961362569 3:126377294-126377316 TGTCCAGGGCAGGAAGGGAAGGG - Intergenic
962421176 3:135230277-135230299 CCTCCAAGGCAGGTGGGGAGGGG - Intronic
963343181 3:144062341-144062363 TGTCTAACTCAGATGGGGAAAGG + Intergenic
965746862 3:171935269-171935291 TGTTGGGGGCAGGTTGGGAAGGG + Intronic
965858559 3:173119150-173119172 TGTCGAGGGGGTGTGGGGAAAGG + Intronic
967511733 3:190321261-190321283 GGTTGGTGGCAGGTGGGGAAAGG - Intronic
967700422 3:192585761-192585783 TCTTGAATGGAGGTGGGGAAGGG + Intronic
967728562 3:192884772-192884794 TGAGGAAGGCAGGCGTGGAAAGG - Intronic
968921993 4:3527163-3527185 TGTCGAAGGCTGCCAGGGAAAGG - Intronic
969234951 4:5859200-5859222 TGTTGAATGAAGATGGGGAAGGG + Intronic
969608306 4:8213090-8213112 GGTGGAGGGCAGGTGGAGAAAGG - Intronic
971196026 4:24472137-24472159 TGTCGATGGCAGATTGGGCACGG + Intergenic
974142865 4:57909878-57909900 TGTACTAGGCAGTTGGGGAAAGG + Intergenic
974482295 4:62460900-62460922 TATCTAAGTCATGTGGGGAAGGG + Intergenic
978263221 4:106789003-106789025 GGTCCCAGGGAGGTGGGGAAGGG + Intergenic
980096114 4:128492614-128492636 TTTCAAAGGCAGGTGGGAAGCGG - Intergenic
983839204 4:172435346-172435368 CCTGGAAGGCAGATGGGGAAAGG + Intronic
984212686 4:176869961-176869983 TGTCAGAGGGTGGTGGGGAAGGG - Intergenic
985629400 5:1006918-1006940 TGCCCCAGCCAGGTGGGGAAGGG - Intergenic
987638970 5:20586498-20586520 TGTCGGAGGCTGGCGGGGCAAGG + Intergenic
989391659 5:40906829-40906851 TGTGCAAGGCAATTGGGGAAAGG + Intergenic
989497552 5:42126398-42126420 TGACAAGGGTAGGTGGGGAAAGG + Intergenic
990441695 5:55852559-55852581 TGCCTAAGGAAGATGGGGAATGG + Intronic
990614716 5:57495791-57495813 TCTTGAAGGCAGGTTGGGAAAGG - Intergenic
991911298 5:71563924-71563946 GGACGGAGGTAGGTGGGGAAGGG - Intronic
992981419 5:82177845-82177867 TGTCTATGGCAGGTGGAGAAAGG - Intronic
994887400 5:105582405-105582427 TGGTGCAGGCAGGTGGGGAGGGG + Intergenic
995330694 5:110942652-110942674 TGGCAAAGGAAGGTGAGGAATGG + Intergenic
995367291 5:111377086-111377108 TGTTGAAGGAAGGTGGGTAGTGG + Intronic
997564603 5:134877227-134877249 GCTCTAAGGCAGGTGGGGATAGG + Intronic
998154729 5:139778222-139778244 TGTACAAGGCAGGTGGGAAGTGG + Intergenic
1000125291 5:158237675-158237697 GGTTGAAGGTAGGTAGGGAAGGG + Intergenic
1000132094 5:158309983-158310005 TGAGGAAGGGAGGTAGGGAAGGG - Intergenic
1000132177 5:158310189-158310211 TGAGGAAGGGAGGTAGGGAAGGG - Intergenic
1000332869 5:160219638-160219660 TGTCCAAGGCAGGATGGGAGTGG - Intronic
1001139559 5:169133202-169133224 TGAGGGATGCAGGTGGGGAAAGG - Intronic
1001512896 5:172336340-172336362 GGAAGAAGGGAGGTGGGGAAGGG - Exonic
1001609967 5:172992498-172992520 TGTCAAAGGCAGGGGGTGAGAGG - Intronic
1004337602 6:14778536-14778558 TGACCAAGGCAGGAGTGGAAGGG - Intergenic
1005853263 6:29838958-29838980 TGTCCAAGGCAGGAGAAGAAGGG + Intergenic
1006371168 6:33644489-33644511 TGGAGAAGGCAGGAGAGGAAGGG - Intronic
1006374103 6:33662440-33662462 TGTCTGAGGCAGGTGGGGCTGGG + Intronic
1007509504 6:42364407-42364429 AGTCTAAGGGAAGTGGGGAAAGG - Intronic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1008280509 6:49590308-49590330 TGTCTAAGTCATGTAGGGAAGGG + Intergenic
1009320930 6:62286897-62286919 TGTGGAAGGGAGGTTGGGAGGGG + Intergenic
1011769549 6:90660702-90660724 TGGGGAAGGCAGGAGAGGAAAGG - Intergenic
1013146688 6:107400841-107400863 TCTCTAAGGCAGTTGGGGCAGGG - Intronic
1013707481 6:112855189-112855211 TTTCCAAGGCAGGTTTGGAAGGG + Intergenic
1017035367 6:150262421-150262443 TGAAGAAGGAGGGTGGGGAAGGG - Intergenic
1018070517 6:160160884-160160906 TGAGGAAGGCAGGAAGGGAAGGG - Intergenic
1018244485 6:161809247-161809269 CCTCAAAGGCAGGGGGGGAAGGG + Intronic
1018896457 6:168021766-168021788 TATCGAAGTCTGGTAGGGAAGGG + Intronic
1019156175 6:170040237-170040259 TGTTAGAGCCAGGTGGGGAAGGG + Intergenic
1020667784 7:11069322-11069344 TCTGGAAGGGAGATGGGGAAGGG + Intronic
1023605790 7:41929544-41929566 TGTCTATGGCTGGTTGGGAAAGG - Intergenic
1024225717 7:47325365-47325387 TGGAGAAGGCAGGTGGGTACCGG - Intronic
1026018740 7:66692673-66692695 GGTGGGAGGCGGGTGGGGAAGGG - Intronic
1026881666 7:73910021-73910043 GGTGGGAGGCGGGTGGGGAAGGG + Intergenic
1026930535 7:74220809-74220831 TGTGGCAGGCAGGTGGGGCAGGG - Intronic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1030488906 7:110206584-110206606 GCTAGCAGGCAGGTGGGGAATGG - Intergenic
1032672585 7:134098959-134098981 TGGGGTAGGGAGGTGGGGAAAGG + Intergenic
1033133338 7:138764210-138764232 TCTCGAAGGGAAGAGGGGAAAGG + Intronic
1033705824 7:143884260-143884282 AGTTGAAGGGAGATGGGGAAAGG - Intronic
1034017282 7:147600731-147600753 GGTCAAAGGCAGGAGGAGAAGGG - Intronic
1034244537 7:149634634-149634656 TGGAGAAGGCACGTGTGGAAGGG + Intergenic
1034333821 7:150307582-150307604 CGTCGAAGGGAGATGGGGAAGGG - Intronic
1034627498 7:152504661-152504683 TGTGGAAGGCAGCTGGGGAGAGG - Intergenic
1035659264 8:1334573-1334595 GGTCGAGGGCAGGTGGGGAAGGG - Intergenic
1037834319 8:22207243-22207265 GCTGGAAGGCAGGTGGGGCAAGG - Intronic
1041369589 8:57144449-57144471 TGTTGAAGGTAGGTGGGGATAGG - Intergenic
1041460275 8:58103773-58103795 TGTGGGAGGCAGGAGGAGAAGGG - Intronic
1043526558 8:81104082-81104104 TGTGGAAGGTGGGTGGGAAAGGG - Intronic
1044220604 8:89664726-89664748 GGTAGGAGGCAGGTGGGGAGTGG - Intergenic
1044618091 8:94162834-94162856 TGTGGAGTGCAGGTGGGGACAGG + Intronic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1049653806 8:143789056-143789078 TGTGGAAGGCAGGAGGGGTGTGG + Intergenic
1051324747 9:15953212-15953234 TGTTGAATGCAAGTGGTGAAAGG + Intronic
1052728651 9:32260549-32260571 TGTGTAAGGCAGGTGGGGGCGGG - Intergenic
1053168359 9:35860527-35860549 TCCGGAAGGCAGGTGGGTAATGG + Intergenic
1056279848 9:85030373-85030395 TGTAGATGGCAGATGGGGCATGG - Intergenic
1058050560 9:100402043-100402065 TGGGGATGGGAGGTGGGGAAGGG - Intergenic
1058906619 9:109487197-109487219 TGTGGAAGGTAGGAGGGGAGAGG + Intronic
1059282458 9:113146683-113146705 TGTCGGGGGCAGGGGGAGAAGGG + Intergenic
1062546683 9:137066709-137066731 TCTCCAAGGCAGCTGGGTAAGGG + Intronic
1186444698 X:9617273-9617295 TGTGGAAGGACGGTGGGCAAGGG - Intronic
1186487339 X:9943528-9943550 TTTAGAAGGCTGGTGGGAAAGGG + Intronic
1186998864 X:15154482-15154504 TGCCTAGGGCTGGTGGGGAATGG + Intergenic
1187558273 X:20374059-20374081 TGTGGAAGGGAGGAGAGGAAAGG + Intergenic
1189510997 X:41661312-41661334 TTGGGAAGGCAAGTGGGGAAAGG + Intronic
1189823928 X:44898232-44898254 AGTTGATGCCAGGTGGGGAATGG + Intronic
1190868274 X:54403125-54403147 TGTGGGAGGCCGGTGGGGGACGG - Intergenic
1192226460 X:69231522-69231544 AGTGGAAGGCAGGTGGAGAAGGG + Intergenic
1192569340 X:72190035-72190057 TGGCGGAGGCAGGAAGGGAAGGG - Intronic
1195370414 X:104167075-104167097 GGTCGAAAGCAGGTGGGGGAGGG - Intronic
1195465186 X:105172081-105172103 TGTGGAAGGCATGAGGGTAAAGG + Intronic
1198276195 X:135097893-135097915 TGTGGAGCCCAGGTGGGGAAAGG - Intergenic
1198310314 X:135422848-135422870 TGTGGAGCCCAGGTGGGGAAAGG + Intergenic
1198502461 X:137265222-137265244 TGTCTAAGACAGGTGGGGCTGGG + Intergenic
1200254511 X:154572783-154572805 TGTCGCAGGCCTGAGGGGAAGGG + Intergenic
1200263258 X:154631625-154631647 TGTCGCAGGCCTGAGGGGAAGGG - Intergenic
1201678801 Y:16619492-16619514 AGTCCAAGGCAGGTGGAGCAAGG + Intergenic