ID: 1137587007

View in Genome Browser
Species Human (GRCh38)
Location 16:49669738-49669760
Sequence CAGCCCAGCTGGGCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 403}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137587007_1137587014 -2 Left 1137587007 16:49669738-49669760 CCACACAGAGCCCAGCTGGGCTG 0: 1
1: 0
2: 4
3: 39
4: 403
Right 1137587014 16:49669759-49669781 TGGGAAATCGGGCCCTAGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 62
1137587007_1137587015 -1 Left 1137587007 16:49669738-49669760 CCACACAGAGCCCAGCTGGGCTG 0: 1
1: 0
2: 4
3: 39
4: 403
Right 1137587015 16:49669760-49669782 GGGAAATCGGGCCCTAGCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 75
1137587007_1137587020 29 Left 1137587007 16:49669738-49669760 CCACACAGAGCCCAGCTGGGCTG 0: 1
1: 0
2: 4
3: 39
4: 403
Right 1137587020 16:49669790-49669812 TTCCCTACTCCAGAGCCAGATGG 0: 1
1: 0
2: 0
3: 24
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137587007 Original CRISPR CAGCCCAGCTGGGCTCTGTG TGG (reversed) Intronic
900148631 1:1168815-1168837 CAGCCCAGCCTGGCTGTGTGGGG - Intergenic
900290407 1:1921306-1921328 CAGGCTGGGTGGGCTCTGTGGGG + Intergenic
900338555 1:2176863-2176885 CAGCCCAGCTGGGCTCTGGAAGG - Intronic
901217163 1:7561315-7561337 CACCCCAGCTGGGCTCCTGGAGG - Intronic
902873498 1:19327658-19327680 CAGCCCAGCGGGGCGCAGAGAGG + Intronic
903324462 1:22562242-22562264 CAGCCCTGCAAGGCTGTGTGAGG + Intergenic
903375405 1:22862776-22862798 CAGCCAAGCTGGGATAGGTGAGG + Intronic
903664649 1:24998846-24998868 CAGCCCAGCTGGTATGGGTGGGG - Intergenic
904855914 1:33498208-33498230 AAGTCAAGCTGAGCTCTGTGTGG + Intergenic
906212779 1:44021342-44021364 CAGCCCAGATGGTCTCTGCCAGG - Intronic
906795900 1:48696187-48696209 GTGCCCAGCTAGGGTCTGTGGGG + Intronic
906925017 1:50106232-50106254 CAGTCCATCTGGACTCTGTGTGG + Intronic
906941546 1:50260018-50260040 CAGCCCAGCTCAGCTCCCTGGGG + Intergenic
909517641 1:76530497-76530519 CAGCTCAGCTCAGCTCTGTTCGG - Intronic
910112058 1:83693261-83693283 GGCCCCAGCCGGGCTCTGTGTGG - Intergenic
912468703 1:109892137-109892159 CATCCCAGCTGGGCTCCCTGAGG + Intergenic
912955388 1:114152017-114152039 GAGCCCACCTGAGCCCTGTGAGG - Intronic
915142973 1:153778312-153778334 CAGGACAGCGGGGCGCTGTGGGG + Exonic
915333891 1:155129606-155129628 CAGCCAAGCTGGGCCCAGCGTGG + Intronic
915436466 1:155910701-155910723 CAGCCCCGCTGGGCTCTCACGGG - Exonic
915496458 1:156285730-156285752 CAGCCCACTTGCGCTCAGTGGGG - Exonic
916424572 1:164668492-164668514 CAGCCCAGCAGGGCCCTGGCTGG - Intronic
916549876 1:165839943-165839965 CAGCACAGCAGGACTCTGTCTGG - Intronic
917490512 1:175494173-175494195 CCACACAGCTGGGCTCTCTGGGG + Intronic
917634150 1:176918806-176918828 TAGCCTAGCTGGGGTCTGTGTGG + Intronic
919883859 1:201918530-201918552 CAGCCACGCTGGGCTCTCTTGGG + Intronic
922575439 1:226658287-226658309 CAACCCAGCTGGGCCCTGCCAGG - Intronic
922775029 1:228210687-228210709 CAGCCCAGCTGGTCTCAGCCTGG + Intronic
923290713 1:232542806-232542828 AGGCCCAGCTGAGCCCTGTGAGG + Intronic
923327290 1:232891612-232891634 CTTCCAAGCTGGCCTCTGTGAGG - Intergenic
923349848 1:233093363-233093385 CAGGCCAGCAGGGCACTGTTTGG - Intronic
1062933430 10:1367994-1368016 CACACCAGCTGGGCCCTCTGGGG + Intronic
1063116691 10:3076705-3076727 CACCTCTGCTGGGCTCTGTGTGG - Intronic
1063162931 10:3432744-3432766 CAGCTGAACTGGGCTCTGTGGGG + Intergenic
1063705741 10:8428865-8428887 CAGCCCAGCTTGGCTCTACCTGG + Intergenic
1064875061 10:19984299-19984321 CATCCCAGGTGGACTTTGTGTGG + Intronic
1064952248 10:20865941-20865963 CAGCCCAGCTGGCTTCTGGGAGG + Intronic
1064978375 10:21142329-21142351 AAGCCAAGCTGGAGTCTGTGTGG - Intronic
1065117769 10:22498874-22498896 AAGCCCACCTGGCCTCTGTGGGG - Intergenic
1065697608 10:28394195-28394217 AACCCCAGGTGGGCTCTGCGTGG - Intergenic
1066159651 10:32714618-32714640 GATCTCAGTTGGGCTCTGTGAGG - Intronic
1066495026 10:35934359-35934381 TAGCCCTGCTGGGCTATGTCTGG + Intergenic
1066956654 10:42179264-42179286 CAGCACAGAGGGACTCTGTGGGG - Intergenic
1067268253 10:44766320-44766342 CAGCCCATTTGGACTCTGTCTGG + Intergenic
1067295086 10:44971133-44971155 AACCCAAGCTGGGCTCTGTGGGG - Intronic
1067762610 10:49059325-49059347 CAGCCATGCTGGGCACTGTCAGG - Intronic
1068767329 10:60778382-60778404 CAGCGTAGCTGGGCTCTGATTGG + Intronic
1069034147 10:63630311-63630333 CGGCCCAGCTCGGCTCTGGAGGG - Intergenic
1069587884 10:69620722-69620744 CAGCCCAGAAGGGCTTTTTGTGG - Intergenic
1070004354 10:72408752-72408774 CAGGCCAGCTGAGCTTTTTGAGG + Intronic
1071508361 10:86246304-86246326 CGGCCCACCTGGGCTCCCTGAGG + Intronic
1071554707 10:86593172-86593194 CAGGCCTGCTGGGCCCTGAGGGG + Intergenic
1072634588 10:97169670-97169692 GAGCCCACCTGGGCTCCCTGAGG + Intronic
1073472408 10:103731089-103731111 CACCTCAGCTGGGCCCTGTGTGG - Intronic
1074216702 10:111392097-111392119 CTGCCAAGCTGGGCTTGGTGAGG + Intergenic
1074406883 10:113187526-113187548 CAGCTCAGCTGGGCTTTGAAAGG - Intergenic
1075090453 10:119441381-119441403 CTGCCCAGGTGGGCTGTGGGAGG + Intronic
1075628719 10:123986042-123986064 CAGACCAGCTGGCATCAGTGGGG + Intergenic
1075808328 10:125205930-125205952 CAGTCCTGCTTGGCTGTGTGAGG - Intergenic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1076106649 10:127828675-127828697 CAGCCCACCTGAGCTAGGTGCGG + Intergenic
1076302899 10:129441521-129441543 CAGCCCAGCAGGGCTCAGGCAGG + Intergenic
1076489140 10:130845264-130845286 CTGCTCAGCTGGCCTCTCTGAGG - Intergenic
1076747263 10:132520532-132520554 CAGCCCAGCCTGGCACTGCGAGG - Intergenic
1076882382 10:133245836-133245858 CACCCCAGCTGCGGGCTGTGAGG + Intergenic
1077284075 11:1758198-1758220 CAGCCCAGCAGGGAACTGTTAGG + Intronic
1077889006 11:6405386-6405408 CAGCCTAGCTGGGCCCTGGCAGG - Intronic
1078240787 11:9529456-9529478 CAGCCTGGCTGGGCCCAGTGGGG - Intergenic
1078926796 11:15882292-15882314 CAGCTCAGCACAGCTCTGTGAGG - Intergenic
1078934904 11:15941686-15941708 CAGGCCAGCCTGGCTGTGTGGGG + Intergenic
1080343548 11:31296114-31296136 CAGCCCATCAGGGGTCTGTCAGG + Intronic
1080855718 11:36110002-36110024 AAGCCCAGCTGGGCTGAGAGAGG + Intronic
1082784644 11:57310206-57310228 CAGCCCAGCTTGGCACTCAGCGG - Exonic
1082799460 11:57403894-57403916 GGGCCCAGCTTGGCACTGTGGGG + Intronic
1083535962 11:63466835-63466857 CAGCCAAGCAGGGCTCTGAATGG + Intronic
1083618367 11:64037064-64037086 CAGCCCAGCTGGGGTGTGCCAGG + Intronic
1083704635 11:64505574-64505596 CAAGGCAGCTGGGCTCTCTGAGG + Intergenic
1083833473 11:65248617-65248639 CAGCCGAGGTGGGGTATGTGTGG + Intergenic
1083888337 11:65583651-65583673 CAGGCAGGCTGGCCTCTGTGAGG - Exonic
1084070168 11:66728469-66728491 CGGCCCCGCGGGGCTCTGGGCGG + Intronic
1084313502 11:68330525-68330547 CAGCCCTGGTGGGCTCCATGGGG + Intronic
1084325625 11:68398281-68398303 CACCCTAGCTGTGCTCTGAGGGG - Intronic
1084448860 11:69220796-69220818 CAGCCCACGAGGGCTCTGGGTGG - Intergenic
1084692439 11:70735002-70735024 TAGCACATCTGTGCTCTGTGAGG + Intronic
1084769620 11:71334288-71334310 CTGCCCAGCTGGGCTGAGTTGGG + Intergenic
1085511652 11:77091222-77091244 CATCCCAGCAGGGCTGTGTAGGG - Intronic
1088893117 11:114059858-114059880 CAGCCGAGCCGGGCACTGTGGGG - Exonic
1089886452 11:121829305-121829327 CAGCGCAGCTCAGCTCAGTGTGG - Intergenic
1091635054 12:2190778-2190800 CAGCCCAGCTTGGATTGGTGGGG + Intronic
1091750228 12:3017682-3017704 CAGCCAAGCCGGGATGTGTGTGG - Intronic
1091823455 12:3492579-3492601 AAGCCCAGCAGGGCTCTCTGCGG - Intronic
1091897631 12:4117873-4117895 CAGCCCAGGTGAACTCTCTGGGG - Intergenic
1092208707 12:6632602-6632624 CAGCACAGCTGGGGTCTGTTTGG - Intronic
1092272294 12:7032801-7032823 CAGACCAGCTGGTGTCGGTGGGG + Intronic
1092272338 12:7033082-7033104 CAGATCAGCTGGTGTCTGTGGGG + Intronic
1092285727 12:7128404-7128426 CAGCCAAGCTGATGTCTGTGGGG + Exonic
1092915989 12:13189413-13189435 CTGCCCTGCAGAGCTCTGTGTGG + Intergenic
1095405574 12:41863500-41863522 CAGCACAGCTGTGATCTATGTGG - Intergenic
1095981409 12:47976748-47976770 GAGCTCAAGTGGGCTCTGTGTGG + Intronic
1096622470 12:52873145-52873167 CAGCCCAGCTGGGTTGGGGGTGG - Intergenic
1096846301 12:54408940-54408962 CTGCCCAGCTGAAATCTGTGAGG + Exonic
1096874075 12:54613758-54613780 CAGCCCAGCTGGTCTCTGCTTGG + Intergenic
1097221633 12:57454717-57454739 CAGGCCAACTGGACTCTGGGCGG + Intronic
1098714726 12:73815467-73815489 CAGCCTGGCTGGGCTATGAGGGG + Intergenic
1099738185 12:86597658-86597680 CAGATCAGCTGGCATCTGTGGGG - Intronic
1100977949 12:100142277-100142299 CGTCCCGGCTCGGCTCTGTGCGG - Intronic
1101274832 12:103188084-103188106 CTTCAGAGCTGGGCTCTGTGTGG + Intergenic
1101435334 12:104659438-104659460 CAGCACAGCTCTGCACTGTGGGG - Intronic
1101750862 12:107581371-107581393 CCGCCCAGCGGGGCTCTGATTGG - Intronic
1102655514 12:114479683-114479705 CACCCCAGCTCACCTCTGTGGGG - Intergenic
1104440470 12:128789601-128789623 CCGGCAAGCTGAGCTCTGTGTGG - Intergenic
1104990676 12:132622237-132622259 CAAGCCAGCTGAGCTCTGAGGGG + Intronic
1105579095 13:21676855-21676877 CAGCACAGATGGGCTCTAGGGGG + Intronic
1106132632 13:26952584-26952606 CAGCTCACCTTGGCTCTGTTTGG + Intergenic
1106549657 13:30760288-30760310 CACCCCAGCTCAGCTCTCTGTGG - Intronic
1108038122 13:46312981-46313003 CACTCTAGCTGGGCTCTGGGAGG + Intergenic
1108244351 13:48499802-48499824 CAGGACAGATGGCCTCTGTGAGG + Intronic
1108648089 13:52450355-52450377 CGGCCCGGCAGGCCTCTGTGCGG - Intronic
1108714843 13:53068944-53068966 CAGTCCCCCTGGGCTTTGTGAGG + Intergenic
1111256408 13:85675477-85675499 CAGGCCAGCTGACCTCAGTGGGG - Intergenic
1112117099 13:96368086-96368108 CAGCAATGCTGGGCTCTGTGGGG - Intronic
1112973191 13:105285843-105285865 CAGCCCAGCCCCGCTCAGTGTGG + Intergenic
1116905159 14:50396871-50396893 CCGCCCAGCTCGGCTCGGCGTGG + Intronic
1117075562 14:52100059-52100081 CAGCTCAGCTGGCCTCTTGGTGG + Intergenic
1117602359 14:57389442-57389464 CATCCCAGTTGTGCTCTGTCTGG + Intergenic
1118780729 14:69005995-69006017 CAGCCAGGCTGGGCGCTGGGAGG + Intergenic
1119933671 14:78570986-78571008 CAGCCCCGCTGGGCCCTGTGGGG + Intronic
1121557148 14:94847012-94847034 CAGCCCCGGTGGCCCCTGTGCGG - Intergenic
1122647057 14:103201874-103201896 CAGGCCACCTGGGGGCTGTGGGG + Intergenic
1124093273 15:26625732-26625754 CAGCCAAGCTGGCCACTCTGCGG + Intronic
1124810810 15:32936369-32936391 CAGCCCAGCTAGTGTCTCTGGGG + Intronic
1126875696 15:53038694-53038716 CAGGCCAGCCTGGCTGTGTGGGG + Intergenic
1127399444 15:58571904-58571926 CACTGCAGCTGGGCTCTTTGAGG + Intergenic
1127523325 15:59765716-59765738 CAGTGCAGTTTGGCTCTGTGAGG + Intergenic
1127961113 15:63891686-63891708 GAGCCCAGCTAGGCTCTTTAGGG - Intergenic
1128082339 15:64864139-64864161 CAGCCCTGCTGGGGCCTCTGAGG + Intronic
1128360987 15:66961670-66961692 CAGCCAAGCTTGGCTCTGCCTGG + Intergenic
1129189559 15:73929411-73929433 CAGCCAAGCTGACCTCAGTGAGG + Intronic
1129985833 15:79919270-79919292 CTCCCCAGCCTGGCTCTGTGTGG - Intronic
1130118818 15:81029120-81029142 CAGCTCAGCAAGGCTCTCTGTGG + Intronic
1130542739 15:84833634-84833656 CAGCCCACCAGGGCCCTGTCAGG + Intronic
1130651613 15:85765135-85765157 CAGCCGGGCTGGGCAGTGTGAGG - Intronic
1131396696 15:92092016-92092038 TGGCCCATCTGGGCCCTGTGGGG + Intronic
1132469167 16:92345-92367 CAGCCAGGGTGGGCTCTATGGGG + Intronic
1132646266 16:1000657-1000679 CAACCCAGATGGGCTGAGTGAGG - Intergenic
1133770257 16:8863615-8863637 CAGCCCAGATGGGCCATGAGAGG - Intronic
1134836967 16:17369458-17369480 CAGCCCAGGTGGGCAGGGTGGGG - Intronic
1135137013 16:19892380-19892402 CAGCCCAGCTGGGAGCTTTTGGG - Intergenic
1135304916 16:21359836-21359858 CGGCATAGCAGGGCTCTGTGGGG - Intergenic
1135913569 16:26582953-26582975 ACACCTAGCTGGGCTCTGTGTGG - Intergenic
1136024408 16:27460789-27460811 CAGCCCAGCTGGGGCCTGCCAGG + Exonic
1136105410 16:28026580-28026602 CAGCTCAGCTGGGCTCTGCTGGG + Intronic
1136301665 16:29339029-29339051 CGGCATAGCAGGGCTCTGTGGGG - Intergenic
1137484100 16:48877326-48877348 CAGCATTGCTGGGCTTTGTGGGG + Intergenic
1137582335 16:49640927-49640949 CTTGCCAGCTGGGCTCTCTGGGG + Intronic
1137587007 16:49669738-49669760 CAGCCCAGCTGGGCTCTGTGTGG - Intronic
1137606474 16:49790022-49790044 CTGCCCAGCTTGGTTCTGTGGGG - Intronic
1137948409 16:52758055-52758077 CTGCTCAGCTGAGCTCTGAGTGG - Intergenic
1138597850 16:58038624-58038646 TAGCCCAGCTGTGCCCAGTGAGG - Intronic
1139006019 16:62572486-62572508 CCACCCATCTGAGCTCTGTGTGG - Intergenic
1139851144 16:69952136-69952158 CGACCCAGCTGGGCTCTGCCAGG + Intronic
1139852350 16:69958958-69958980 CAAGCCAGCTGGGCTGTGGGCGG + Exonic
1139880122 16:70175048-70175070 CGACCCAGCTGGGCTCTGCCAGG + Intronic
1139881321 16:70181866-70181888 CAAGCCAGCTGGGCTGTGGGCGG + Exonic
1139965500 16:70742776-70742798 CAGCCCGGCTGGGCTGTGGCGGG + Intronic
1140371185 16:74413638-74413660 CAAGCCAGCTGGGCTGTGGGCGG - Exonic
1140372387 16:74420469-74420491 CGACCCAGCTGGGCTCTGCCAGG - Intronic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141627890 16:85271072-85271094 CAGCCCACCTGGCCTCAGGGAGG + Intergenic
1141671890 16:85496490-85496512 CAGCCCGGGTGGCCTCGGTGCGG + Intergenic
1141766761 16:86064132-86064154 CAGGACAGCTGGGCTCTGCCTGG - Intergenic
1142053038 16:87972897-87972919 CAGCCCTGCAGGCCCCTGTGTGG + Intronic
1142063351 16:88045588-88045610 CGGCATAGCAGGGCTCTGTGGGG - Intronic
1142114476 16:88349073-88349095 CAGGCCAGCATGGCTCTGGGCGG + Intergenic
1142155545 16:88531370-88531392 CAGCCCATTTGGGGTCAGTGTGG + Intronic
1142281979 16:89153544-89153566 CTGCCGTGCAGGGCTCTGTGAGG + Intronic
1142755204 17:2012335-2012357 CAGCCCAGCTGTGTTCCTTGTGG - Intronic
1142812040 17:2399964-2399986 CAGCCCAGCCCAGCTCTGGGAGG + Intronic
1142878394 17:2866240-2866262 CAGCCAAGGTGGGATCTGAGCGG - Intronic
1142972610 17:3623081-3623103 GAGCCCACCTGGGGTCTGGGCGG + Intronic
1143103038 17:4514505-4514527 CAGCCCAGATGGGGACTTTGGGG + Intronic
1143190043 17:5034192-5034214 CAGCCCTGCTGGCCCCTCTGTGG - Exonic
1143409790 17:6701981-6702003 CAGCCCGTCTGGGCTGAGTGGGG - Intronic
1144872644 17:18380532-18380554 CAGCCTGGCTGGGCCCTGGGAGG - Intronic
1145282024 17:21475145-21475167 GTGCCAAGCTGGCCTCTGTGGGG + Intergenic
1145772565 17:27504239-27504261 GTGCCCAGCCTGGCTCTGTGAGG + Intronic
1146649530 17:34598207-34598229 CTTGCCAGCTGGGCTCTCTGGGG - Intronic
1147575206 17:41594941-41594963 CAGCCCAGCTGGGGGCAGAGGGG + Intergenic
1147582892 17:41636901-41636923 CAGCCCAGAGGACCTCTGTGTGG - Intergenic
1147791450 17:43016431-43016453 CAGGCCAACCGGGCTGTGTGTGG - Exonic
1148049095 17:44760358-44760380 AAGCCTATCTGGGCACTGTGTGG - Intronic
1148325240 17:46779493-46779515 CGGCCCAGCTGGGCAGTGGGTGG - Intronic
1148700198 17:49582414-49582436 CAGCCCAGCTGGGGGCTGCCGGG + Intronic
1149657252 17:58316726-58316748 CAGGGCAGCTGGGCTCTGCCAGG - Intronic
1151631430 17:75313780-75313802 GAGCCCAGGTGGGGTTTGTGGGG - Intergenic
1151632399 17:75319735-75319757 CAGCCCAGGTGGGCTTTCTCAGG + Exonic
1151748612 17:76024490-76024512 CAGCCTGGCTGGGCCCTGGGAGG + Intronic
1151972676 17:77466938-77466960 GTGCTCGGCTGGGCTCTGTGGGG + Intronic
1152227235 17:79098096-79098118 CATCCCAGCTGTGCTCAGGGGGG - Intronic
1152539552 17:80968032-80968054 CAGGCGAGCCGGGCTCAGTGAGG - Intergenic
1152566549 17:81102959-81102981 CAGACCAGCTGAGCACAGTGGGG - Intronic
1152610925 17:81314681-81314703 GAGGCCAGCCTGGCTCTGTGCGG - Intronic
1152898639 17:82927774-82927796 CAGCGTGCCTGGGCTCTGTGTGG + Intronic
1152929350 17:83101947-83101969 GAGTCCAGCTGAGCTCCGTGTGG + Intergenic
1153006183 18:500473-500495 CAGCTCCGCGGGGCTCTGGGCGG - Intronic
1153493293 18:5671614-5671636 CAGCTCTGCGAGGCTCTGTGGGG - Intergenic
1153748070 18:8200564-8200586 CAGGCCAGATGGGCTGCGTGCGG - Intronic
1153943146 18:9994364-9994386 GAGCTTGGCTGGGCTCTGTGAGG + Intergenic
1153981573 18:10315027-10315049 CAGTGCAGGTGGCCTCTGTGAGG + Intergenic
1154063287 18:11083545-11083567 CAGCCCTGCAGGGCACGGTGTGG + Intronic
1154356622 18:13626716-13626738 GAGCCCAGCTGTGCTGGGTGGGG - Intronic
1154945556 18:21158246-21158268 CAGCCCAACTGGGATCTGCCTGG - Intergenic
1155158479 18:23177480-23177502 CAGCCCCGCCGGTCTATGTGTGG + Intronic
1156312707 18:35939427-35939449 CTGCCCTGCTCTGCTCTGTGAGG - Intergenic
1157004043 18:43560322-43560344 CAGCCTATCTGGGTTCAGTGTGG - Intergenic
1160053146 18:75455596-75455618 CAGCCCCGCTGCGCCCTGCGGGG + Intergenic
1160386100 18:78497871-78497893 CAGCCCTCCTGAGCTCTATGTGG - Intergenic
1160424010 18:78768001-78768023 CTCCCCAGCTTGGCTCTGAGGGG + Intergenic
1160506106 18:79427619-79427641 CTGGACAGCTGGCCTCTGTGCGG + Intronic
1160506237 18:79428081-79428103 CTGGACAGCTGGCCTCTGTGCGG + Intronic
1161056920 19:2195315-2195337 CAGCTCTGCAGGCCTCTGTGTGG - Intronic
1161124941 19:2550590-2550612 TGGCCCTGCTGGGCTCTGAGGGG + Intronic
1161129642 19:2580259-2580281 CAGCCCTGCTGCTCTCTGTCTGG + Intronic
1161493596 19:4575804-4575826 CTACCCCGCTGGGCTCAGTGAGG - Intergenic
1161570953 19:5030692-5030714 CAGCCCAGCTGTGTGCCGTGTGG + Intronic
1162555478 19:11383464-11383486 CAGCTCAGCTGGCCGCTGGGTGG - Intronic
1163571035 19:18082452-18082474 CAGGACATCTGGCCTCTGTGAGG - Intronic
1163654401 19:18537488-18537510 TAAGCCAGCTGAGCTCTGTGGGG - Intronic
1164152357 19:22566057-22566079 CAGCCTTGCTGGGCTGTGGGGGG + Intergenic
1164587610 19:29485693-29485715 CAGACCAGGTGGGCTGAGTGGGG - Intergenic
1164729898 19:30495683-30495705 CAGCCCAGCTGTTCTTTATGGGG + Intronic
1164776836 19:30859285-30859307 CTGCCCTGCTGGGCTGTCTGAGG + Intergenic
1166368940 19:42291008-42291030 GACCCCTGCTGGGCACTGTGGGG + Exonic
1167116357 19:47491349-47491371 CAGCAGGGCAGGGCTCTGTGGGG + Intronic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
1168492359 19:56821540-56821562 CACCCCAGCTGGACTCTAGGGGG + Intronic
925020126 2:562573-562595 CAGTTCACCTGGGCCCTGTGGGG + Intergenic
925223581 2:2162462-2162484 CAGCCCTGCTGCCCTCTGAGGGG - Intronic
925977155 2:9149541-9149563 CAGCGGCTCTGGGCTCTGTGTGG + Intergenic
926537045 2:14125846-14125868 CAACACAGCTGGGCTCTGCTGGG - Intergenic
926929752 2:18024876-18024898 AAGCCTAGGTGGGCTGTGTGGGG - Intronic
927509120 2:23633256-23633278 CCACCCAGCTGGGCTGTGTTAGG + Intronic
927511129 2:23644405-23644427 TAGCCCAGAGGGGCTATGTGGGG - Intronic
927712354 2:25333664-25333686 CAGAGCAGCAGGGCTTTGTGGGG + Intronic
929007808 2:37412440-37412462 GACACCAGCTGGGCTGTGTGAGG + Intergenic
929156651 2:38794325-38794347 CAGCCCGGGCTGGCTCTGTGGGG + Intergenic
930531341 2:52592239-52592261 AAACAGAGCTGGGCTCTGTGGGG - Intergenic
931667349 2:64618792-64618814 CAGACCAGCTGGTCTCTGAGGGG + Intergenic
932506073 2:72233399-72233421 CAGCCTGTCTGGGCTCTGTGGGG + Intronic
933726427 2:85430103-85430125 CAGCAGTGCTGGGCTCTGGGAGG - Intronic
934466904 2:94271532-94271554 CAGCACAGAGGGACTCTGTGGGG + Intergenic
934495019 2:94789104-94789126 CTGGCCAGCTGGCCACTGTGTGG - Intergenic
936155727 2:110046488-110046510 GAGCCCAGGTGGCCTCTGAGGGG - Intergenic
936188961 2:110324945-110324967 GAGCCCAGGTGGCCTCTGAGGGG + Intergenic
936451512 2:112637010-112637032 CCCACCAGCTGGGCCCTGTGGGG + Intergenic
936622068 2:114110639-114110661 CAGCTAAGCAGAGCTCTGTGGGG - Intergenic
937255931 2:120555608-120555630 CAGCACAGCTGGGATTTGGGTGG + Intergenic
937377910 2:121350395-121350417 CAGCTCAGGTGGCCTCTCTGTGG - Intronic
937695084 2:124800021-124800043 CTGCCCATCAGGGCTTTGTGAGG + Intronic
938153199 2:128903964-128903986 CAGCCCACCTCTGCACTGTGGGG - Intergenic
938169177 2:129059516-129059538 TAGCCACGCTGGGGTCTGTGGGG + Intergenic
939782538 2:146465933-146465955 CAGCCTGTCTGGGCTCAGTGCGG - Intergenic
939830444 2:147064558-147064580 CAGCTCCACTAGGCTCTGTGTGG - Intergenic
941654506 2:168128456-168128478 GAGCCCAGTTGGTCTCTGAGGGG - Intronic
942381135 2:175392165-175392187 CAACAAAGCTGGGCTCTGTTGGG - Intergenic
946058343 2:216920238-216920260 AAGGCCAGCTGGGCTCAGGGTGG + Intergenic
946133018 2:217622198-217622220 CTGCCCTGCTGGGCTTTGTACGG + Intronic
946175451 2:217919590-217919612 CAGCCCAGCTGGCATCAGGGTGG + Intronic
946955787 2:224928814-224928836 AAGTTCATCTGGGCTCTGTGTGG - Intronic
947589861 2:231379450-231379472 CATCCCACCTGGGCCCTGTTGGG + Intergenic
947612625 2:231533226-231533248 CTACCCAGCTCTGCTCTGTGGGG + Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948366565 2:237458847-237458869 CAGCCCAGCTGAGGTCTTAGGGG - Intergenic
948868084 2:240785378-240785400 CTGCCCAGCTGGGCACTGCATGG - Intronic
949064563 2:241981861-241981883 CAGCCCAGCTGGGCTCTCCCTGG - Intergenic
1168887829 20:1272379-1272401 CAGGCCAGTTGGGCTGTTTGGGG + Intronic
1169640417 20:7744610-7744632 CAGCCCAACTGGCATCAGTGGGG + Intergenic
1170392665 20:15892131-15892153 CACCCCTGCTGTGCTCTGGGAGG - Intronic
1171167582 20:22985503-22985525 CAGCCCATCTGGGATTTGTTTGG - Intergenic
1172083275 20:32358843-32358865 CAGCCGAGGGGGGCTCCGTGGGG + Intronic
1172184434 20:33022474-33022496 CAGAGGAGCAGGGCTCTGTGGGG + Intronic
1172690551 20:36786517-36786539 CACCCCAGCTGGACTCTGAAGGG + Exonic
1173596390 20:44261138-44261160 CAGCCCAGCTGGGGGATGAGAGG + Intronic
1173918313 20:46725839-46725861 CAGCCGTGCTGGCCTCTGTGGGG + Exonic
1174088440 20:48027172-48027194 CAGACCCTCCGGGCTCTGTGGGG - Intergenic
1175368404 20:58470829-58470851 CAGCCCTGCCTGGCTCTCTGTGG - Intronic
1176014146 20:62920222-62920244 CATCCCAGCAGGGTACTGTGGGG + Intronic
1176266126 20:64210273-64210295 CAGCCCAGCTGGGCACTGCCTGG - Intronic
1179045643 21:37842895-37842917 CAGCAGAGCTGGGCTATGAGGGG - Intronic
1179489812 21:41734040-41734062 CAGCCCAGCTGGTCTCTTCACGG - Intergenic
1180115171 21:45698473-45698495 CAGCCTAGCAGGGCTCTCTTGGG + Intronic
1180141912 21:45898204-45898226 CCACCCAGCTGCACTCTGTGGGG + Intronic
1180588044 22:16910763-16910785 CAGCACAGAGGGACTCTGTGGGG + Intergenic
1180698452 22:17769141-17769163 AGGCCCTGCTGTGCTCTGTGAGG - Intronic
1180917450 22:19499046-19499068 TAGCCCACCTGGGCTCAATGAGG - Intronic
1181509388 22:23382245-23382267 CATCCTGGCTGGGCGCTGTGCGG + Intergenic
1181808074 22:25387006-25387028 CAGCCCTGGTGGGCTCCGTGGGG - Intronic
1182000834 22:26918385-26918407 CAGCCCAGCTTGGCTCTGATTGG + Intergenic
1182067064 22:27438346-27438368 CAGCCCAGCTGGCTTCTGGCGGG + Intergenic
1182253481 22:29020683-29020705 GAGCCCACCTGGACTCTGGGAGG - Intronic
1183012243 22:34956423-34956445 CAGCCAAGCTGAGCTGTGTGGGG - Intergenic
1183335565 22:37244071-37244093 CATCCCAGTTGGGGGCTGTGAGG + Intronic
1183344480 22:37299458-37299480 CGGTCCAGCTCAGCTCTGTGAGG - Intronic
1183714597 22:39526356-39526378 CCTCCCAGCTGGGCTTTGAGGGG + Intergenic
1183979369 22:41530743-41530765 CTGCTGAGCTGGGCCCTGTGGGG + Exonic
1184443355 22:44532561-44532583 CAACCCAACAGGGCTATGTGTGG - Intergenic
1184959896 22:47921333-47921355 CAGGCCTGGTGGGCCCTGTGCGG + Intergenic
1185275196 22:49947701-49947723 TGCCCCAGCTGGGCTCTGGGTGG - Intergenic
950284754 3:11735894-11735916 CAGCCACGCTGGGCCCTGCGTGG - Intergenic
950444415 3:13028082-13028104 CAGCCCTGCGGGGCTTTGAGGGG - Intronic
950764965 3:15266775-15266797 CAGCCCTGGTGTGCTCTGTTAGG - Intronic
953121124 3:40043646-40043668 ATTCCCAGCTGGGCTGTGTGAGG + Intronic
954776352 3:53022157-53022179 CAGCCTAGCTGGACTGGGTGCGG + Intronic
955395647 3:58555411-58555433 CAGGACAGCTGTCCTCTGTGTGG + Intergenic
956264246 3:67379697-67379719 CAGCCCAACAGAGCTCTGGGTGG - Intronic
959262269 3:104097894-104097916 CAGCTCAGCTGGGGTCTGTGGGG - Intergenic
959481672 3:106880435-106880457 CAGCTGAGCTGGGCTGTGTGAGG - Intergenic
960906916 3:122610824-122610846 CAACCCAACTGTCCTCTGTGGGG - Intronic
960936063 3:122903406-122903428 CAGAACAGCTGGGCCCTGGGAGG + Intergenic
961554476 3:127688712-127688734 CACACAAGCTGGGCTCTGTCCGG - Intergenic
962064044 3:131960684-131960706 CAGACCAGCTGGCATCAGTGAGG - Intronic
962256518 3:133873472-133873494 CAGCACAGCTGGGCTGGGAGAGG + Intronic
962400671 3:135056380-135056402 CAGCCGTGCTGGGCTCTCTTGGG + Intronic
962473315 3:135732510-135732532 CAGCCTGTCTGGGCTCAGTGTGG - Intergenic
962847860 3:139287030-139287052 CAGCCCAGCTGGACTCAGGCTGG + Intronic
966915820 3:184583700-184583722 CGGCGCGGCTGGGCTCCGTGGGG - Intronic
967942424 3:194776542-194776564 CTTCCAAGCTGGGCTGTGTGTGG - Intergenic
968503444 4:961394-961416 GAGGCCAGCTGGGCTCAGCGGGG + Intronic
968590901 4:1459188-1459210 CTGCCCAGCTGGCCTGTGTGAGG + Intergenic
968672837 4:1861410-1861432 TAGCACAGCTGGAATCTGTGGGG - Intergenic
968850128 4:3073421-3073443 CAGCTCAGCAGAGGTCTGTGGGG - Intergenic
976771903 4:88662252-88662274 CAACCCAGCTGGGATCTGTCAGG + Intronic
976812048 4:89108678-89108700 AAGCCCAGCTGGGGTCTGAGGGG - Intronic
978370206 4:108022422-108022444 CAGCCCTCCTGACCTCTGTGAGG - Intronic
979177172 4:117679428-117679450 CACCCCAGTGGGACTCTGTGTGG - Intergenic
980234695 4:130090502-130090524 CAGCCCACCTCTGCGCTGTGAGG + Intergenic
985660528 5:1154967-1154989 CAGGCCTGGTGGCCTCTGTGTGG + Intergenic
987120767 5:14764428-14764450 CAGCCTAGATGGCCTCTGTTGGG - Intronic
987188599 5:15450671-15450693 CAGCGGAGCTGGGCTCGGAGCGG - Intergenic
994025334 5:95074946-95074968 ATGCCCAGCTTGGCTCTGTCGGG + Intronic
995650279 5:114361774-114361796 CAGCCCAGCTGCACTGCGTGGGG + Intronic
999204022 5:149835603-149835625 CTGCCCACCTGGGCTGGGTGCGG - Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001768185 5:174271517-174271539 CAGCCCAGCTGGGGTGGGTGGGG + Intergenic
1002057385 5:176606284-176606306 GAGCACAGCTGGGCTCTGACAGG - Intronic
1002164981 5:177338453-177338475 TCGCTCAGCTGGGCCCTGTGGGG - Intronic
1004522015 6:16370202-16370224 CAGCCCTGCCAGGCTCTGTCGGG - Intronic
1005982086 6:30844323-30844345 CAGCACAGCTGGGTTCTGGATGG + Intergenic
1006342065 6:33452496-33452518 CACCCCATCTGGGTTCTGGGTGG - Exonic
1006407828 6:33855509-33855531 CAGCCCAGCTCTGCTCTATTTGG - Intergenic
1007230520 6:40344833-40344855 CGGGCCAGCTGGGGTCTGAGTGG - Intergenic
1007736894 6:43987517-43987539 CTGCCCTGCTGGGCTGAGTGGGG - Intergenic
1007809486 6:44476050-44476072 CAGCCCAGCAGGCCTCCATGGGG - Intergenic
1007959571 6:45946695-45946717 CAGACCAGCAGGTCTCTATGGGG + Intronic
1009712085 6:67336720-67336742 CAGGCCAGCTGTTCTCTGTCTGG - Intergenic
1009971335 6:70628138-70628160 CAGCCCACCTCTGCGCTGTGGGG - Intergenic
1011163475 6:84419233-84419255 CAGCCCAGGTGGGTACTGAGAGG - Intergenic
1014511504 6:122328131-122328153 CAGCCCTGCTGTGATCTGGGTGG + Intergenic
1016356788 6:143227306-143227328 CAGCCCAGCAGGGTCCTGTGTGG + Intronic
1016717542 6:147251508-147251530 CAGTCTGGCTGGGCTCTGTCGGG - Intronic
1016804858 6:148202446-148202468 CAGCCCACCAGGGCTCAGGGAGG - Intergenic
1017714046 6:157195701-157195723 GAGCCAAGATGTGCTCTGTGGGG - Intronic
1017834833 6:158168073-158168095 CGGCGCAGCTGGGCGCGGTGGGG - Intronic
1018266341 6:162028680-162028702 CAGACATGCTGGGCTCTGTGTGG - Intronic
1018281868 6:162195084-162195106 CAGCGAAGCTGGTTTCTGTGTGG - Intronic
1018382286 6:163269327-163269349 TAGGCCAGCTGGGCTCTGCCTGG + Intronic
1018675812 6:166221486-166221508 AGGCAAAGCTGGGCTCTGTGGGG - Intergenic
1018723100 6:166588769-166588791 CTGCCCAGCTGGACTCTCTTCGG - Intronic
1019170303 6:170129975-170129997 CAGCCCAGCTGTGCAGGGTGTGG + Intergenic
1019415777 7:925963-925985 CAGTCAGGCTGGGCCCTGTGTGG + Intronic
1020010986 7:4805663-4805685 CAGCTGTGCTGGGCTCAGTGCGG + Exonic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020418106 7:7969100-7969122 CCGCCCGGCTGGGCTCGGTGTGG - Exonic
1021531296 7:21648595-21648617 CAGCCCAGCTGGACTAGCTGAGG + Intronic
1021615566 7:22499894-22499916 CAGCCCAGCTGGGTTGTGGCCGG - Intronic
1021981280 7:26058153-26058175 CAGCCCAGGTGGAGTGTGTGGGG + Intergenic
1022458763 7:30584339-30584361 AAGCCAAGCTGGGAACTGTGGGG + Intergenic
1022498898 7:30870451-30870473 CAGGCCTGCTGGGCTGTCTGTGG + Intronic
1022505443 7:30906448-30906470 CAGCCAGGCTGGGGTCCGTGAGG - Intergenic
1023628504 7:42139959-42139981 CAGGCCAGCAGGCTTCTGTGAGG - Intronic
1026564651 7:71480062-71480084 CAGCCCAACTGGGGTTAGTGTGG - Intronic
1026681122 7:72467363-72467385 CAGCCTAGCTGGGGTCTGGCAGG - Intergenic
1027993092 7:85388517-85388539 CAGGCCAGCTGGCATATGTGAGG - Intergenic
1028376933 7:90154741-90154763 CAGCCCAGCTGGGTTGTGGCCGG + Intronic
1029109848 7:98207456-98207478 GTGCCCACCTGGGCTATGTGGGG + Exonic
1029159846 7:98543817-98543839 CAGCCCAGCTGGGGACCCTGAGG + Intergenic
1029708076 7:102286021-102286043 CAGTCCCGCTGGGCTTTGCGGGG - Intronic
1031701223 7:124929566-124929588 CAAGCCACCTGAGCTCTGTGAGG + Intronic
1033275918 7:139971556-139971578 CAGCCCAGATGACCTCTGGGAGG - Intronic
1034260044 7:149749590-149749612 CAACCCAGGTGTCCTCTGTGTGG - Intergenic
1034416763 7:150969390-150969412 CACCTCAGCTGTGCTCTCTGTGG + Intronic
1034794309 7:153999093-153999115 CAGCCCAGCTCTCCTCTGGGAGG + Intronic
1034891823 7:154846426-154846448 CAGCCCGGCTGTGCTCTGCTGGG - Intronic
1035282927 7:157788647-157788669 CAGCCCTGCTGGGCTATGCGGGG + Intronic
1036710801 8:11077386-11077408 CAGCCCTGGGGCGCTCTGTGAGG + Intronic
1037752508 8:21692075-21692097 CAGCCTGGCTGGGCTCTGGTGGG - Exonic
1039434076 8:37547605-37547627 CAGCCCAGGTAGGCTCTGCCAGG + Intergenic
1040259048 8:45716361-45716383 CTGCACAGCTGGTCTATGTGAGG - Intergenic
1040977268 8:53207748-53207770 CACCACAGCTGGGCCCTGAGGGG - Intergenic
1042042442 8:64607014-64607036 CAGACCAGCTGGGCCCTGGGAGG + Intronic
1042208026 8:66348514-66348536 CAACCCAGCTGGGTTCACTGGGG - Intergenic
1045502954 8:102757260-102757282 CTGCCCTGCTGGGCTCTGTGGGG + Intergenic
1045676735 8:104615386-104615408 CAGCCTGTCTGGGCTCAGTGTGG - Intronic
1049054283 8:140222757-140222779 CATGCCAGCTGGGTTCTGTTAGG - Intronic
1049064453 8:140301905-140301927 CAGGGCAGCTGAGCTCTGGGAGG - Intronic
1049211181 8:141387132-141387154 GAGGCCAGCAGGGCTGTGTGTGG + Intergenic
1049747943 8:144270877-144270899 CAGCCCAGCTCGGCTCGCAGGGG - Intronic
1049767064 8:144359767-144359789 CAGCCCTGCTGGCCTCTCTGTGG + Exonic
1050351370 9:4743186-4743208 GAGCCCTGCTGGGCACAGTGGGG - Intergenic
1051334741 9:16055544-16055566 CAACGCCGCTGGGCCCTGTGAGG + Intronic
1052739706 9:32381822-32381844 CACCCCAGCTGTGCTCTGGTGGG - Intergenic
1053165569 9:35841558-35841580 CAGCACAGCTGGTGTGTGTGGGG + Exonic
1053275397 9:36779854-36779876 GTGCCCTGCAGGGCTCTGTGTGG - Intergenic
1053526537 9:38835640-38835662 CTGGCCATCTGGGCTATGTGGGG - Intergenic
1054198763 9:62060065-62060087 CTGGCCATCTGGGCTATGTGGGG - Intergenic
1054639592 9:67528300-67528322 CTGGCCATCTGGGCTATGTGGGG + Intergenic
1056385770 9:86095677-86095699 CAGCCCTGCTGGGCTCTTTTGGG - Intronic
1057309530 9:93933426-93933448 CGGGCCAGCTGGGCTCCCTGAGG - Intergenic
1058643712 9:107111139-107111161 CAGCCCAGCTGAGGTCTGATTGG + Intergenic
1058943119 9:109832838-109832860 CTGCCCCGCTGGCCTCTCTGAGG - Intronic
1059347435 9:113639108-113639130 CAGCCCTGCTGGGGTATGTGTGG + Intergenic
1059439658 9:114299880-114299902 CAGTCCGCCTGGGCTCTGAGGGG - Intronic
1060405420 9:123370670-123370692 CTGCCCTGCCCGGCTCTGTGTGG + Exonic
1060406379 9:123375064-123375086 CTGCCCAGCTGGGCCCTGCCAGG - Intronic
1060505839 9:124197912-124197934 CAGCCTGGCTGAGCTCTTTGTGG + Intergenic
1061225944 9:129281047-129281069 TGGCCCAGCTGGGGCCTGTGTGG + Intergenic
1061673494 9:132202396-132202418 CAGCCCACCTGCCCCCTGTGGGG - Intronic
1061880529 9:133566704-133566726 GAGCCCAGCTGGGTTGGGTGGGG + Intronic
1062344831 9:136109841-136109863 CTGCCCAGCTGGGCTGGGGGAGG + Intergenic
1203616992 Un_KI270749v1:74817-74839 CAGCACAGAGGGACTCTGTGGGG - Intergenic
1185830642 X:3299608-3299630 CAGCTCAGTTGGGCTCTGCTGGG + Intergenic
1186195861 X:7109981-7110003 CCTCCCAGCTGGAATCTGTGTGG + Intronic
1186553041 X:10527320-10527342 CATCCCAGCTGGACTCTCTTCGG + Intronic
1189093477 X:38112727-38112749 AGGCTGAGCTGGGCTCTGTGTGG + Intronic
1189358415 X:40328992-40329014 CTGGCCAGCTGGCATCTGTGGGG + Intergenic
1191252210 X:58265092-58265114 CAGGCCCGCTGGGGTCTTTGAGG + Intergenic
1192175152 X:68880759-68880781 CAGAACAGTGGGGCTCTGTGGGG - Intergenic
1195244459 X:102983057-102983079 CTGCTCAGCTGGGCTCAGTAAGG - Intergenic
1197299418 X:124760046-124760068 CAGCCCACCTGTGCACTGGGAGG + Intronic
1198299950 X:135325496-135325518 CAGGCCAGCTGAGCTCCGGGTGG + Intronic
1199679709 X:150216195-150216217 CACCCCTGCTGGGCACTGTGTGG - Intergenic
1199695522 X:150340854-150340876 CACCCCTGCTGGGCACTGCGTGG + Intergenic
1200230147 X:154439845-154439867 CAGGACAGCTGGGCTGTGAGTGG + Intronic
1201194678 Y:11480281-11480303 CAGCACAGAGGGACTCTGTGGGG + Intergenic
1201247287 Y:12017318-12017340 CAGCTCAGTTGGGCTCTGCTGGG - Intergenic
1201261242 Y:12160918-12160940 AGGCTCAGCTGGGCTCTGTTTGG - Intergenic
1201481467 Y:14443940-14443962 CAGCCCAGGTCTGGTCTGTGTGG - Intergenic