ID: 1137589083

View in Genome Browser
Species Human (GRCh38)
Location 16:49682442-49682464
Sequence TGGCATTGCAAGTGTGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137589083_1137589090 -8 Left 1137589083 16:49682442-49682464 CCCGGTCCACACTTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 165
Right 1137589090 16:49682457-49682479 CAATGCCAGGGTCTGGAGCAGGG 0: 1
1: 1
2: 3
3: 48
4: 540
1137589083_1137589089 -9 Left 1137589083 16:49682442-49682464 CCCGGTCCACACTTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 165
Right 1137589089 16:49682456-49682478 GCAATGCCAGGGTCTGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137589083 Original CRISPR TGGCATTGCAAGTGTGGACC GGG (reversed) Intronic
901164484 1:7208104-7208126 GAGCATTGCAGGTGTAGACCGGG + Intronic
901807685 1:11748597-11748619 TGGCCTCACCAGTGTGGACCAGG - Exonic
901923348 1:12551262-12551284 TGGGATTGCAGGTGTGAGCCAGG - Intergenic
903137352 1:21318182-21318204 TGGCGTGGCAAGTGGGGAGCAGG + Intronic
904026917 1:27509753-27509775 GGGCATTGCAGGTGGGGACTCGG - Intergenic
905444242 1:38014911-38014933 TAGGATTGCAAGTGTGAGCCTGG + Intronic
905589012 1:39145855-39145877 TGGAAATACAAGTTTGGACCTGG - Intronic
906727011 1:48051520-48051542 TGGAATTGCAGGTGTTCACCAGG - Intergenic
908751416 1:67427880-67427902 TGTCATTGAGAGTGTAGACCAGG - Intronic
909942134 1:81623206-81623228 TGGAACTGAAAGTTTGGACCAGG + Intronic
911463541 1:98221753-98221775 TTGAATAGCAAGTGTGGTCCAGG + Intergenic
915055945 1:153130607-153130629 TGGCATGGCATTTGAGGACCAGG - Intergenic
916812975 1:168321739-168321761 TGGGATTACAAGTGTGAGCCAGG + Intergenic
920231856 1:204475910-204475932 GAGCATTGCCAGTGTGGCCCTGG - Intronic
920995865 1:210990500-210990522 TGACATTCCAAGTGTGACCCTGG + Intronic
922205584 1:223443407-223443429 TGGCATGGAGAGTGTGGACAGGG - Intergenic
923025264 1:230198568-230198590 TGGCCATGCATGTGTGGAGCAGG + Intronic
1063746756 10:8892584-8892606 TGGGATTACATGTGTGCACCAGG + Intergenic
1064888046 10:20134769-20134791 TAGGATTGCAAGTGTTGGCCTGG + Intronic
1065800548 10:29347583-29347605 TGGAATTGCTACTGTGGGCCAGG + Intergenic
1066106681 10:32163031-32163053 TGCCATTAAAAGTGTGGTCCAGG + Intergenic
1069537970 10:69269438-69269460 TTGTATTGAAAGTATGGACCAGG - Intergenic
1069652273 10:70058276-70058298 TGGCATTGCCAATTTGGACTTGG + Intronic
1070178144 10:73990020-73990042 TGGCTTTCAAAGTGTGGTCCAGG + Intergenic
1071029654 10:81161408-81161430 TGGCACTGCAAGTATGTACAAGG + Intergenic
1071584813 10:86809710-86809732 TGGGATTGCAGGTGTGAGCCAGG + Intronic
1075132448 10:119751637-119751659 TGTCATTCCAAGTGAGGGCCTGG - Intronic
1075688118 10:124378010-124378032 TGGAATTACAAGTGTGCACCTGG - Intergenic
1076975489 11:168097-168119 TGGGCTTGCAAGGGTGGTCCAGG - Intronic
1077949415 11:6939951-6939973 TGGGATTACAAGTGTGAGCCTGG - Intronic
1082177509 11:49078386-49078408 CGGCACTACAAGTGTGGGCCTGG + Intergenic
1083652823 11:64213167-64213189 TGGGATTACAGGTGTGGGCCTGG + Intronic
1084085115 11:66851431-66851453 TGGCCACACAAGTGTGGACCAGG + Intronic
1085391048 11:76182423-76182445 GGGCATTGCAAGAGAGGAACAGG - Intergenic
1085961797 11:81470084-81470106 TGGGATTACAGGTGTGCACCAGG - Intergenic
1086688204 11:89757455-89757477 AGGCACTACAAGTGTGGGCCTGG - Intergenic
1086717654 11:90082490-90082512 AGGCACTACAAGTGTGGGCCTGG + Intergenic
1094328860 12:29270716-29270738 TCATATTGCAAGTGGGGACCAGG + Intronic
1096435603 12:51588943-51588965 TGGGACTACAAGTGTGCACCAGG + Intergenic
1097060398 12:56278906-56278928 TGGGATTACAGGTGTGCACCAGG + Intronic
1097090249 12:56499116-56499138 TGCCACGGCAAGTGTGAACCAGG + Intergenic
1097984132 12:65765490-65765512 TTGCATTACAAGTATGGACTAGG + Intergenic
1099185562 12:79512491-79512513 GGGCACTTCAAGTCTGGACCTGG + Intergenic
1102136572 12:110581137-110581159 TGGGATTACAAGTGTGAGCCTGG - Intronic
1102691845 12:114767314-114767336 TGGCATTGCAAGGGTGTTACTGG + Intergenic
1103372437 12:120429817-120429839 TGGGATTACAAGTGTGAGCCAGG - Intergenic
1105309854 13:19196737-19196759 TTGCATTGAAAGTGTAGATCAGG + Intergenic
1105527642 13:21190873-21190895 TTGCATTGAAAGTGTAGATCAGG - Intergenic
1108148752 13:47508463-47508485 TGGAATTCAAAGTGTGGTCCTGG + Intergenic
1114243230 14:20888680-20888702 TCTCATTGGAAGTGTGGATCAGG + Intergenic
1116390874 14:44387713-44387735 TAGGATTACAAGTGTGGACCAGG + Intergenic
1126499255 15:49326392-49326414 TGGGATTACAGGTGTGCACCCGG + Intronic
1127705727 15:61545570-61545592 AGACATTGCATGTGTGGACTGGG - Intergenic
1128592616 15:68914805-68914827 TGGGATTGCAGGTGTGTGCCAGG + Intronic
1128670161 15:69568578-69568600 GGGAATTCCAAGTGTGGACTGGG - Intergenic
1132967725 16:2668372-2668394 TGCCACGGCAAGTGTGAACCAGG + Intergenic
1134071793 16:11264857-11264879 TGGCATTGATCGGGTGGACCAGG + Intronic
1134349897 16:13427109-13427131 TGGCATTGCAAGAGGGGAAAGGG + Intergenic
1137483791 16:48874901-48874923 AGGCATTGCAATTGTGCAGCAGG + Intergenic
1137589083 16:49682442-49682464 TGGCATTGCAAGTGTGGACCGGG - Intronic
1138657714 16:58500573-58500595 CTGCATTGCCCGTGTGGACCCGG + Intronic
1141686325 16:85571949-85571971 TGGTATTGGATGTGGGGACCAGG + Intergenic
1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG + Intergenic
1142850757 17:2703691-2703713 GGGCATGGCATGTGTGGACATGG - Intronic
1144714574 17:17425009-17425031 TGACATTGCAGGTGAGGAGCAGG + Intergenic
1146632080 17:34477494-34477516 TGGCATTGCTAGAGTTGACTGGG - Intergenic
1146904643 17:36610195-36610217 TGGCATTACAGGTGTGAACCTGG + Intergenic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1152862713 17:82705172-82705194 TGGCCCTGCAGGTGTGGATCGGG + Intergenic
1152923560 17:83077857-83077879 TGGCCCTTCAAGGGTGGACCGGG + Intergenic
1153746378 18:8184086-8184108 TGGCAGTGTGGGTGTGGACCTGG - Intronic
1154377564 18:13822685-13822707 TGGCATGGCATGTGTAGTCCTGG + Intergenic
1159246523 18:65812234-65812256 TGGGATTACAGGTGTGTACCTGG + Intronic
1159908177 18:74117420-74117442 TGGCACTGTAAGTGTGGTCAGGG - Intronic
1161159265 19:2752860-2752882 TGGGATTGCAGGTGTGAGCCAGG + Intergenic
1162188070 19:8922680-8922702 GGGCATTGGAGGGGTGGACCAGG + Intronic
1163854699 19:19692049-19692071 TGGGATTGCAGGTGTGCACCTGG + Intergenic
1164084417 19:21888354-21888376 TGCCACGGCAAGTGTGAACCAGG + Intergenic
925278913 2:2669481-2669503 TGAAATTGCAGGTGAGGACCTGG + Intergenic
925941761 2:8827437-8827459 TGGCCTTGGAAGAATGGACCTGG - Intronic
926303492 2:11620242-11620264 TGGGATTACAAGTGTGAGCCAGG + Intronic
926913291 2:17871091-17871113 TGGCCATGCAAGTGTGGAAGAGG + Intergenic
928768788 2:34679903-34679925 TGGGATTACAGGTGTGAACCAGG + Intergenic
930436292 2:51347909-51347931 TGGCATTATAAGCGTGCACCAGG - Intergenic
930440265 2:51395622-51395644 TAGCATTGGAAGTTTTGACCAGG + Intergenic
934215341 2:90026641-90026663 GGGCACTGCAAGTGTTTACCAGG - Intergenic
935398624 2:102637410-102637432 TGGCACTGCAACTGTGCCCCAGG - Intronic
937480580 2:122254333-122254355 TGGCATTACAGGTGTGAGCCTGG + Intergenic
942894652 2:181037696-181037718 TGGCATTACAGGTGTGAGCCTGG - Intronic
943670627 2:190656540-190656562 TGGCTTTGCAAATGTAGACTTGG + Intronic
944674387 2:202023145-202023167 TGGCTTTGAAAGTGTGAAGCCGG - Intergenic
946058337 2:216920219-216920241 TGGCATTGCCAGTGTGCAGAAGG + Intergenic
946360588 2:219217214-219217236 TGGGATTACAGGTGTGTACCCGG - Intronic
946651677 2:221898170-221898192 TGGCATTGCAATTCTGTTCCAGG + Intergenic
948802232 2:240438167-240438189 TGGCCTTGCAAGTCTGGAGGAGG - Intronic
1170172951 20:13435795-13435817 TGGCATAGCAAGTGAGCACGTGG + Intronic
1170867787 20:20175307-20175329 TTCCACTGCAAGTGTGGTCCAGG + Intronic
1174236325 20:49095582-49095604 TGGGATTACAAGTGTGAGCCTGG + Intronic
1174374501 20:50116701-50116723 TGGGATTACAGGTGTGAACCAGG - Intronic
1174773339 20:53321820-53321842 TGTCATGGACAGTGTGGACCCGG + Intronic
1176259214 20:64170425-64170447 GGGCACTGCAAGTCTGGACCAGG + Intronic
1181484065 22:23219488-23219510 TGGCCATGCAATAGTGGACCTGG - Intronic
953315221 3:41921040-41921062 TGGGATTACAAGTGTGAGCCTGG - Intronic
960430235 3:117559948-117559970 TGGGATTGCAGGCGTGAACCCGG + Intergenic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
961705017 3:128777854-128777876 TGGGATTACAGGTGTGCACCTGG + Intronic
968432903 4:569144-569166 TGCCATTGGAAGTGTGGGCTGGG + Intergenic
970108099 4:12607917-12607939 GGGCTTTGCAAGTAGGGACCGGG - Intergenic
972709849 4:41584288-41584310 TGGCATTGCCAGTGTAGAAATGG + Intronic
974256906 4:59469079-59469101 TGGCTGTGCAAGTTTGGACAAGG - Intergenic
975319426 4:72993669-72993691 TGGCTTGGCAAGTGTGAACAAGG - Intergenic
975901730 4:79161582-79161604 TTGCATTGAATCTGTGGACCAGG + Intergenic
977460102 4:97314584-97314606 TGGCATTGGAAGTGTGGGAGGGG - Intronic
980611189 4:135166099-135166121 TGCTTTTGCAAGTGTGGCCCAGG - Intergenic
981133538 4:141185542-141185564 TAGTATTGGAAGTTTGGACCAGG - Intronic
984235286 4:177150043-177150065 TGGGATTACAAGTGTGAGCCTGG - Intergenic
984780027 4:183516902-183516924 TGGTATTGCAAGGCTGGCCCAGG - Intergenic
984881785 4:184416039-184416061 TGGAATTACAAGTGTGAGCCTGG - Intronic
984888327 4:184470747-184470769 TGTCATTGCAGGTGTGCACTGGG - Intronic
985938006 5:3111517-3111539 TGGAATTACAAGTGTGAGCCCGG + Intergenic
992564723 5:77986088-77986110 TGGCATTGCACATGTTGCCCAGG + Intergenic
997554205 5:134780758-134780780 TGGGATTGCAGGTGTGAGCCAGG - Intronic
998899529 5:146838300-146838322 TGGCATTACAGGTGTGAGCCCGG - Intronic
1001135863 5:169102152-169102174 TGCCATTGCCTGTGTGGAGCTGG + Intronic
1002861950 6:1087187-1087209 TGCCACAGCAAGTGTGGACAAGG - Intergenic
1007081225 6:39106256-39106278 TGGGATTACAGGTGTGCACCTGG - Intronic
1007927006 6:45657895-45657917 TGGCAGAGAAAGTGTTGACCTGG + Intronic
1010247245 6:73673078-73673100 TGGGATTACAAGTGTGAGCCTGG + Intergenic
1011695865 6:89912158-89912180 TGGTATTACAAGTGTGAGCCTGG + Intergenic
1017681040 6:156863958-156863980 TGGTATTGCAAGTCTGGAAACGG - Intronic
1017821167 6:158049973-158049995 TGGCTCTGCAGGTGTGCACCCGG + Intronic
1018811292 6:167300191-167300213 GGCCAATGCAAGTGTGGACGTGG + Intronic
1020052491 7:5091154-5091176 TGGGATTACAAGTGTGCACCTGG - Intergenic
1020271460 7:6599055-6599077 TGGGATTGCAGGTGTGAGCCTGG + Intronic
1021452468 7:20795744-20795766 TGGGATTGGAAGTGGGGACTTGG - Intergenic
1022211696 7:28216680-28216702 TGGCACTGCAAGTGGAGAACAGG + Intergenic
1022285509 7:28953530-28953552 TCCCATTGCAAGTATGGACAAGG - Exonic
1022742957 7:33140511-33140533 TGGCATTTCAAGTGTGAATTTGG + Intronic
1022795299 7:33727152-33727174 TGCCATTCAAAGTGTGGTCCTGG + Intronic
1024023550 7:45391896-45391918 TGCCATGGCAAATGTGGCCCAGG - Intergenic
1026213694 7:68329392-68329414 TGGGATTACAGGTGTGAACCAGG - Intergenic
1030238124 7:107289869-107289891 TGGCATAGCAAGTTTGGCACAGG - Intronic
1030259146 7:107544133-107544155 TGGGTTTGCAAGGGTGGTCCTGG - Intronic
1031287624 7:119890637-119890659 TGGGATTACAAGTGTGAGCCAGG - Intergenic
1031761677 7:125720662-125720684 TGGTGTTACAAGTGTGCACCTGG + Intergenic
1034217467 7:149419654-149419676 TGGGATTGCAGGTGTGAGCCCGG - Intergenic
1035720631 8:1788756-1788778 TGGGATTACAGGTGTGCACCTGG - Intergenic
1036293668 8:7517840-7517862 GGGCAGAGCCAGTGTGGACCAGG - Intergenic
1036328893 8:7803155-7803177 GGGCAGAGCCAGTGTGGACCAGG + Intergenic
1040587643 8:48758062-48758084 TGGAATTGTTAGTGTGGAGCAGG + Intergenic
1042715736 8:71770440-71770462 TGGCGTTCCAATTCTGGACCTGG - Intergenic
1042715761 8:71770600-71770622 TGGAATTCCAACTCTGGACCTGG - Intergenic
1044433225 8:92133391-92133413 AGGCATTGCAAGTGTGGGTGTGG + Intergenic
1047500138 8:125433824-125433846 TGGGATGGCAAGTGTTGACAGGG + Intronic
1048621770 8:136141427-136141449 GGGCATTGCTAGTCAGGACCTGG + Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1056543686 9:87595581-87595603 TGGTATTGCACGTGGGGACAAGG - Intronic
1057197809 9:93124757-93124779 TGGCCTTGTAGGTGTGGACGAGG + Intronic
1057500770 9:95595262-95595284 AGGCATTGCATCTCTGGACCTGG - Intergenic
1057921504 9:99102008-99102030 AGGCATTGCAACTGTGTTCCAGG + Intergenic
1058836397 9:108861910-108861932 TGGCAGTGCTAGTGTGGCCTGGG - Intergenic
1061094401 9:128446643-128446665 TGGCATTTCAAGAGTGAGCCAGG - Intergenic
1062312923 9:135948933-135948955 TGGGATTACAGGTGTGCACCAGG - Intronic
1062450128 9:136611704-136611726 TGGCAATGTGAGTGGGGACCGGG - Intergenic
1185735030 X:2489828-2489850 CGGCATTGAAGGTGTGGCCCAGG + Exonic
1192120074 X:68447219-68447241 TGGGATTACAAGTGTGAGCCTGG + Intergenic
1192548031 X:72029525-72029547 TGGGATTGGAAGGGTGGACAAGG - Intergenic
1192552216 X:72063452-72063474 TGGCCTTGGAAGTGTGTACATGG - Intergenic
1197464314 X:126784396-126784418 TGGCATTGAGTGTGTGCACCGGG - Intergenic
1198929629 X:141839572-141839594 TGGGATTGCAGCTGTGGGCCTGG - Intronic
1199623773 X:149721944-149721966 TGGCATTGCCCGTTTGGAGCGGG - Intergenic
1201707720 Y:16955092-16955114 TGCCATCGCAACTGTGGACCAGG - Intergenic