ID: 1137590452

View in Genome Browser
Species Human (GRCh38)
Location 16:49690161-49690183
Sequence CCACTGAAGCCTCTCTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137590452_1137590455 -6 Left 1137590452 16:49690161-49690183 CCATGCAAGAGAGGCTTCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 187
Right 1137590455 16:49690178-49690200 CAGTGGCCCCATTTCACAGAGGG 0: 1
1: 2
2: 12
3: 114
4: 548
1137590452_1137590460 5 Left 1137590452 16:49690161-49690183 CCATGCAAGAGAGGCTTCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 187
Right 1137590460 16:49690189-49690211 TTTCACAGAGGGGTAAACTGTGG 0: 3
1: 13
2: 199
3: 1604
4: 6298
1137590452_1137590454 -7 Left 1137590452 16:49690161-49690183 CCATGCAAGAGAGGCTTCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 187
Right 1137590454 16:49690177-49690199 TCAGTGGCCCCATTTCACAGAGG 0: 1
1: 0
2: 9
3: 41
4: 311
1137590452_1137590456 -5 Left 1137590452 16:49690161-49690183 CCATGCAAGAGAGGCTTCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 187
Right 1137590456 16:49690179-49690201 AGTGGCCCCATTTCACAGAGGGG 0: 1
1: 0
2: 13
3: 92
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137590452 Original CRISPR CCACTGAAGCCTCTCTTGCA TGG (reversed) Intronic
903451319 1:23455593-23455615 CCAGGGAACCCTCCCTTGCACGG + Intronic
905097760 1:35488842-35488864 CCACTGAAGCTACTCTTGCCAGG - Intronic
906048661 1:42852524-42852546 CCACTGAACCCACTCTGGAAGGG + Intergenic
906963524 1:50434311-50434333 CCACTGAAGCATCTCAGGAACGG + Intergenic
907323150 1:53618311-53618333 CCACTCAAGCCTCTGCTGCCAGG + Intronic
908322229 1:62989434-62989456 CTACTGGAGCCTCTCTTACCTGG + Intergenic
908326614 1:63029553-63029575 TCTCTGAAGCCTCTTTTGTAAGG - Intergenic
912700422 1:111874257-111874279 CCACTGCTCCCCCTCTTGCATGG + Intronic
913482581 1:119303142-119303164 CCACAGAAGCCTCTGCTGCATGG + Intergenic
915462729 1:156079902-156079924 CCAAAGAAGCATCTCTTGAAGGG + Intronic
916487355 1:165271585-165271607 CCACTGCACCCTCAATTGCAGGG - Intronic
916630962 1:166611806-166611828 ACACTGAAACTTCTCTAGCAAGG + Intergenic
917370482 1:174288529-174288551 CCACTGTTTCCTCTCCTGCAAGG + Intronic
922938529 1:229439850-229439872 CTACTGACGCCTCTCTTTGAGGG - Intergenic
923301374 1:232643810-232643832 CCATTGAAGCCTCTCTCCCCAGG - Intergenic
1063090984 10:2866169-2866191 CCACTGAAGCTCATCCTGCAGGG + Intergenic
1068707106 10:60089148-60089170 CCACTGATGGCTCTCATGCGTGG + Intronic
1070682077 10:78455743-78455765 ACCCAGACGCCTCTCTTGCAGGG + Intergenic
1071009824 10:80924917-80924939 CCACTGAAACTGCTCCTGCAAGG - Intergenic
1071771334 10:88731934-88731956 CTACTGATGCTTTTCTTGCAAGG - Intronic
1081965405 11:47166253-47166275 CCACTTCAGCCTCACCTGCAAGG + Exonic
1083308462 11:61772646-61772668 GCACTCCAGCCTCTCTGGCATGG + Intronic
1083627498 11:64079091-64079113 CCACTGCACCATCTCTTGCCAGG - Intronic
1083784085 11:64933942-64933964 CCTCAGAAGCCACTCTGGCAAGG - Exonic
1085302870 11:75468605-75468627 CCACTAAAACCTCCCATGCACGG + Intronic
1085891196 11:80581741-80581763 CCAATGAAGCATTTCATGCAGGG - Intergenic
1087005606 11:93467677-93467699 CCACTGCAGCCTCTCCTTCCTGG + Intergenic
1088680053 11:112232269-112232291 CCATTAAAGCCTCTTATGCAGGG - Intronic
1089359979 11:117879264-117879286 CCCCTGAACCCTGACTTGCAGGG - Intergenic
1090282484 11:125468250-125468272 CCACTGCAGCCTCCCTTTCCTGG + Intronic
1090711758 11:129392684-129392706 CCACTGCAGCCTCTCTTTCCTGG + Intronic
1091699540 12:2650827-2650849 CTGCAGAAGCCTCACTTGCAAGG + Intronic
1094364727 12:29668319-29668341 TCTCTGAAGCCTCTTTTACAAGG + Intronic
1094541837 12:31369226-31369248 CCGGGGAAGCCTCTCTAGCAAGG + Intergenic
1097761461 12:63470140-63470162 CCACTGAAGCATCTATGGCATGG - Intergenic
1098804547 12:75006204-75006226 TCTCTGAAGCCTCTTTTACAAGG - Intergenic
1099062253 12:77926422-77926444 CCTCCCAAGCCTCTCTTGCTAGG - Intronic
1099322040 12:81162614-81162636 CCAGTGAAGCCTCCCCTTCAAGG - Intronic
1101428374 12:104606228-104606250 CCACTGAAATCTCTGTTACATGG + Intronic
1101817887 12:108159764-108159786 CCCCTGCAGCATCTCTTGCTGGG + Intronic
1103247154 12:119467503-119467525 TCACTGAAGCCTCACATGGAGGG - Intronic
1103903439 12:124315275-124315297 CCTCTGGAGCCTCACCTGCAGGG + Exonic
1105024315 12:132838386-132838408 CCAGTGAGGCCTCTCTGGGATGG - Intronic
1106250716 13:27979875-27979897 TCACTGAATCCTCTCTTACACGG - Intronic
1106298005 13:28435703-28435725 CCACTAGTGCCTCTCTTCCAGGG + Intronic
1108747346 13:53409048-53409070 CCACTGCAGCATCTGTGGCAAGG - Intergenic
1112415295 13:99199507-99199529 CCACTGGAACCTCTCTTTGAGGG + Intergenic
1116632447 14:47352996-47353018 ACCCTGAATCCTCTCTTTCAGGG - Intronic
1118632726 14:67721124-67721146 CCACAGAAGTCTTTCATGCATGG + Intronic
1119881497 14:78103435-78103457 CCTCTGAGGGCTCCCTTGCAGGG + Intergenic
1121180157 14:91922860-91922882 CCACTGATGCCCCTTTTTCAGGG + Intronic
1122369472 14:101221407-101221429 CCAGTGATGCCTCTGTTGCTGGG + Intergenic
1122651068 14:103227355-103227377 CCACGGGGGCCTCTCCTGCAGGG - Intergenic
1124411702 15:29442653-29442675 CCACTGGAGCCTCTTTGGCCAGG - Intronic
1125254843 15:37751586-37751608 CCACTGAATCCTCTCCTCAAAGG - Intergenic
1125672410 15:41483718-41483740 CCCCGGAAGCCTCTCTGGTAGGG + Intergenic
1125733416 15:41907122-41907144 CCACAGAGGCCTCCCTTGCCAGG - Intronic
1125808530 15:42516237-42516259 TCACTGCAGCCTCTCTTTCCTGG + Intronic
1126644610 15:50862441-50862463 CCACTGAAGCATACCTTCCAAGG + Intergenic
1126870498 15:52982048-52982070 TCACTGGAGCCTCTCTTGCCAGG + Intergenic
1127838369 15:62808935-62808957 CCACTCAAGCCCCTCTTCCTAGG - Intronic
1128986037 15:72222345-72222367 GACCTGAAGCCTCCCTTGCAGGG + Intronic
1131894562 15:97012357-97012379 ACACTGATGCTTCTGTTGCAGGG - Intergenic
1132892702 16:2212089-2212111 TCAGTGATGCCTCTCTTGCCGGG - Exonic
1134562509 16:15222906-15222928 CTACTGAAGCCTCATCTGCAGGG - Intergenic
1134923049 16:18134533-18134555 CTACTGAAGCCTCATCTGCAGGG - Intergenic
1137590452 16:49690161-49690183 CCACTGAAGCCTCTCTTGCATGG - Intronic
1138033548 16:53580161-53580183 CCACTGAAGCCCCACCTTCAGGG - Intergenic
1138214179 16:55188808-55188830 CCACTGAAGTCTCACATTCATGG - Intergenic
1141646238 16:85369548-85369570 CCACTCCTGCCTCCCTTGCAAGG + Intergenic
1142316997 16:89353881-89353903 CCTCTGCAGCCTCTCATGCAGGG + Intronic
1142792430 17:2277971-2277993 CCACTGGAGCCTCTATTTCCTGG - Intronic
1146464203 17:33073497-33073519 ACAGGGAAGCCTATCTTGCAAGG + Intronic
1150321512 17:64218169-64218191 TCACTGAAACCTCTGTTTCATGG - Intronic
1150822691 17:68448206-68448228 CTGCTGCAGCCTCTCTTGCCAGG - Intronic
1154439276 18:14373231-14373253 TCACTGAAGCAGCTCTTGCTGGG - Intergenic
1155577935 18:27268512-27268534 CAACTAAAGTCACTCTTGCATGG - Intergenic
1157027330 18:43861263-43861285 CCACTGATGTCTCTCTGGCTTGG + Intergenic
1158094726 18:53757815-53757837 TCTCTGAAGCCTCTTTTGTAAGG + Intergenic
1159129108 18:64259880-64259902 CCACTCAAGGCTCTGTTCCAGGG + Intergenic
1159209704 18:65301702-65301724 CCACAGGACCCTCTCTAGCAAGG - Intergenic
1160875083 19:1293155-1293177 CCACGGAGGCCTCCCCTGCAGGG + Intronic
1163699271 19:18779036-18779058 GCCCTGATGCCTCCCTTGCAGGG - Exonic
1164626782 19:29734583-29734605 CCAGTGAAGGCACTGTTGCAAGG + Intergenic
1167053568 19:47095059-47095081 CCACAGAAGTCTCTCTCCCAGGG + Intronic
1167470051 19:49670494-49670516 CCGCTGAAGCCTCTCTCTCCGGG + Intronic
926582642 2:14648035-14648057 CAACTGAAAACTCTATTGCAAGG + Intronic
927114838 2:19889658-19889680 CCTCTGAAGCCTCTAGGGCATGG + Intergenic
928380388 2:30812843-30812865 ACAATGATGCCTCTCTTGTAGGG - Intronic
928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG + Intronic
930547356 2:52785509-52785531 CCTCTGAGGCCTCTTTGGCAAGG - Intergenic
930993487 2:57687575-57687597 TCCCTTAAGCCTCTCTTGTAAGG - Intergenic
931860065 2:66345738-66345760 CCACTTAAGCCCCTCTTCCATGG + Intergenic
931950230 2:67354063-67354085 CCACTGAAGCCTCTGCTCCATGG - Intergenic
935433644 2:103004529-103004551 CACCTGCAGCCTCTCTTGGAGGG + Intergenic
937287578 2:120762912-120762934 CCACTGAAGCCTTTCCTCCTCGG - Intronic
938617184 2:133011914-133011936 CCCCTGAGCCCTCTTTTGCATGG + Intronic
942068415 2:172293686-172293708 CCCCAGAAGCCTCTCAGGCAGGG - Intergenic
946548507 2:220774537-220774559 CCTCTGAAGCCTCTTTTATAAGG + Intergenic
946735671 2:222752088-222752110 CCACTGAGGCCTCTTTTATAAGG - Intergenic
948306343 2:236949713-236949735 CCTCTGGGGCCTCTGTTGCAGGG + Intergenic
948757354 2:240167384-240167406 CCACTGAGACCTCTCTGGGAGGG + Intergenic
949010346 2:241674753-241674775 TCACTGCAGCCTCTCTTTCCTGG - Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1171390978 20:24801645-24801667 CCTCTGAAGCCTCTCCAGCCTGG + Intergenic
1173294596 20:41745623-41745645 CCACTTAAGGATCTCTTGTAAGG + Intergenic
1175246609 20:57586054-57586076 CCCCTGAAGCCTCTCTTCCCTGG - Intergenic
1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1177576419 21:22962423-22962445 CCACACAGGCCTCTCTTTCATGG - Intergenic
1178097015 21:29226827-29226849 TCTCTGAAGCCTCTTTTACAAGG + Intronic
1178376666 21:32073254-32073276 CCTCTGAAGTCCATCTTGCAGGG - Intergenic
1179462686 21:41548344-41548366 CCTCAGATGCCTCTCTGGCAGGG - Intergenic
1179480517 21:41673907-41673929 TCACTAAAGCTTCTCTTCCAAGG + Intergenic
1182234382 22:28864057-28864079 CCACTGCAGCCTCTCCTTCATGG - Intergenic
1184501605 22:44878108-44878130 TCGCTCAAGCCCCTCTTGCAAGG + Intergenic
949624797 3:5853527-5853549 CCAGTGAAGCCTCTGTTGCTAGG + Intergenic
952672366 3:35985715-35985737 CCACTGTAGCATCCCATGCAAGG - Intergenic
953409940 3:42685207-42685229 GCACTGGAGCCTCTCTTCCAGGG - Intergenic
955868617 3:63412831-63412853 CCACTGAAGCATTTCGTGCAAGG + Intronic
960162220 3:114362727-114362749 CCACTGAATCCTCTGTTGACAGG - Intronic
960994914 3:123334224-123334246 ACACTGACCCCTCACTTGCAGGG - Intronic
961470213 3:127106668-127106690 CCTCTGCAGCCTCGGTTGCAGGG - Intergenic
962023859 3:131527141-131527163 CCGCTGAAGCCTCTCTCTCCCGG + Intergenic
962271523 3:133980976-133980998 CCAGTGGAGCCTCTCTAGCATGG - Intronic
963434008 3:145244814-145244836 TCACTGAAGGCTTTCTTGCATGG + Intergenic
966726955 3:183116652-183116674 CTACTGAAGCCTCTCTCACAAGG - Intergenic
969445782 4:7244069-7244091 TCACTGCAGCCTTTCCTGCATGG + Intronic
970339541 4:15090745-15090767 ACACTCAAGACTCCCTTGCATGG + Intergenic
970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG + Intergenic
971117430 4:23664442-23664464 CAACTGAAGCCCCACTTTCATGG - Intergenic
972148986 4:36065056-36065078 ACTCTGAAGGCTCTCTTGCCTGG - Intronic
974014504 4:56636456-56636478 AAACTGAGGCCTGTCTTGCATGG - Intergenic
977294194 4:95193026-95193048 CCACTGAAATCTCTCTTGAAGGG + Intronic
980688685 4:136262717-136262739 TCCCTTAAGCATCTCTTGCATGG - Intergenic
981888602 4:149709819-149709841 CCACAGAAGCTGCTCCTGCAAGG + Intergenic
982199979 4:152950632-152950654 CCCCTGGAGGCTCTCTTGCCTGG + Intronic
982617148 4:157653134-157653156 CCAATGAAACCTCTTTTGAAGGG - Intergenic
982800913 4:159706411-159706433 CCATTGAAACCTCTTTTGTATGG + Intergenic
984204055 4:176764767-176764789 ACACTGAATCCTCTCTAGAAAGG + Intronic
985822267 5:2168454-2168476 CCTCTGAAGCCTCCCTTGATGGG + Intergenic
988123031 5:26992369-26992391 CCTCTCATGCCTCTCTTACAAGG - Intronic
990637520 5:57746085-57746107 CCTCAGAAGCCTCTCTTATAAGG - Intergenic
991769341 5:70025926-70025948 ACAATGAAGCCTACCTTGCAGGG + Intronic
991848636 5:70901344-70901366 ACAATGAAGCCTACCTTGCAGGG + Intronic
992590165 5:78286395-78286417 ACTGTGAAGCCTCTTTTGCAAGG - Intronic
993566908 5:89487924-89487946 CCACAGAAGATTCTCTTGAAGGG - Intergenic
994222783 5:97215654-97215676 TCTCTGAAGCCTCTTTTGTAAGG - Intergenic
995311567 5:110718189-110718211 CCAATGAAGTCTATCTAGCACGG - Intronic
995997627 5:118320635-118320657 CCACAGAATCCCCTCTTTCATGG - Intergenic
997404449 5:133633922-133633944 TCACTGAAACCTCCCTGGCAGGG + Intergenic
998583156 5:143402356-143402378 CCACTTAAGACCCTCTGGCATGG - Intronic
999747486 5:154603352-154603374 CCACAGGAGTCTGTCTTGCAAGG + Intergenic
1000313792 5:160069756-160069778 CCAGTCTAGCCTGTCTTGCACGG + Intronic
1001276545 5:170355456-170355478 CCATTGCAGCCTCTCATGGAGGG + Intronic
1002326065 5:178407165-178407187 CCACTGATGCCACCCTTGCTGGG - Intronic
1002779982 6:358489-358511 CCACTGCTGCTTCTCTTGCCTGG - Intergenic
1004564871 6:16786911-16786933 CTACTGAAGCATCTTTTACAAGG + Intergenic
1006214661 6:32430095-32430117 GAACTGAAGGCTCTCTGGCAGGG + Intergenic
1008878698 6:56357803-56357825 CCACTGATACCTCTTCTGCAAGG - Intronic
1009311721 6:62162239-62162261 CCCCTGAAGCATTTCTTGCAAGG + Intronic
1010995288 6:82524947-82524969 CCACTGAATCATCTCTTGTAAGG - Intergenic
1011043783 6:83059760-83059782 GCACTGATGCCTCCCTTGCTTGG - Intronic
1011106569 6:83787916-83787938 TCGCTGAGGCCTCTTTTGCAAGG - Intergenic
1014727059 6:124983986-124984008 TCTCTGAAGCCTCTTTTGTAAGG + Intronic
1017679290 6:156847291-156847313 CAACTGGAGCGTCTCTGGCAGGG + Intronic
1019624620 7:2009686-2009708 CCACTGCAGCCCCTGATGCAAGG + Intronic
1021215887 7:17914702-17914724 CCCCTTAAGCTTCTCTTGTAGGG - Intronic
1022046926 7:26629031-26629053 CCACTGGAGCATCTGTTGTAAGG + Intergenic
1022493307 7:30837249-30837271 CCACAGCAGCCTCTTCTGCAGGG + Intronic
1022541201 7:31136755-31136777 CCACTGGAGACTCTATTCCAAGG + Intergenic
1023737782 7:43249771-43249793 CCACAGATGCCTCTCTTGCTTGG + Intronic
1025232573 7:57212381-57212403 TCACTGGAGCCTCTCTTTCCCGG + Intergenic
1027348247 7:77284151-77284173 CCACAGAGGCCTCGCTTGAATGG - Intronic
1030468539 7:109933932-109933954 CTACTGAAGGCTTTCCTGCAAGG - Intergenic
1032390884 7:131554945-131554967 ACACTGCAGCCCCTCTTCCAGGG + Intronic
1033458094 7:141520487-141520509 CATCTGAAGTCTCTCTGGCAAGG + Intergenic
1034916960 7:155048031-155048053 TCTCTGGAGCCTCTCTTCCAAGG - Intergenic
1035754800 8:2023131-2023153 GCACTGAAGCCTCTGCTGCGGGG + Intergenic
1036595355 8:10206906-10206928 GCACTGAAGCCACGCTTGGAGGG - Intronic
1038551230 8:28470574-28470596 CCAGTGAATCCTTTCTTACAGGG + Intronic
1038664371 8:29525239-29525261 TCACTGCAGCCTCTATTGCTTGG + Intergenic
1039216022 8:35272439-35272461 CCACTGTGGCCTCTGCTGCAAGG - Intronic
1039854291 8:41399020-41399042 CCACTGAAACTTATCTTGTAAGG + Intergenic
1041136537 8:54765113-54765135 CCACGGAAGAATCTCATGCATGG - Intergenic
1041345124 8:56889218-56889240 CCACACAAGCTTCTCTTACAGGG + Intergenic
1045476288 8:102555592-102555614 TCACTGAATCCACTCTTGCTTGG + Intronic
1047617346 8:126573619-126573641 TCACTGAAGTCTCTTTTGTAAGG - Intergenic
1048255848 8:132904630-132904652 ACACTGACGCTTCTCTTGCCAGG - Intronic
1048889531 8:138935218-138935240 CCACTCAATCTTCTCTTGGAAGG + Intergenic
1051517631 9:17948531-17948553 CCACTGAGGCTTTACTTGCAAGG - Intergenic
1052437220 9:28444373-28444395 CCACTGCTGCTTCTGTTGCATGG - Intronic
1056904540 9:90633787-90633809 CCATTGAAGCGCCTCTTGCCAGG - Intronic
1058471899 9:105288421-105288443 CCACTGCAGCCTCCATTGCCAGG + Intronic
1059682717 9:116601987-116602009 CCAACTTAGCCTCTCTTGCAGGG - Intronic
1060164596 9:121399820-121399842 CCACTAAAGGCTCTCTTGCCAGG - Intergenic
1060398670 9:123334327-123334349 ACACTGCAGCCTCTCTTCCCAGG - Intergenic
1061493256 9:130957691-130957713 CAACTGGAGCCTCTCCTCCAGGG + Intergenic
1061953222 9:133948100-133948122 GCACTGCAGCCTCTCTTTAAGGG - Intronic
1062000041 9:134211360-134211382 CCACGGAGGCCTCCCTTGCTGGG + Intergenic
1185923016 X:4114898-4114920 TCTCTGAAGCCTCTCTTAGAAGG + Intergenic
1186190187 X:7060562-7060584 TCACTGAGGCCTCTCAGGCATGG + Intronic
1187437290 X:19284284-19284306 CCAGTCAAGACTCTCTTCCAAGG - Intergenic
1187467420 X:19539838-19539860 CCACAGTGGCCTCTCTTCCAAGG - Intronic
1188349277 X:29107520-29107542 CTACTGAAACCTCTTTTGGATGG - Intronic
1188852231 X:35145913-35145935 CAGTTGAAGCCTCTGTTGCAAGG - Intergenic
1189777060 X:44479934-44479956 CCACAGTAGCCTCTCTTTCAGGG + Intergenic
1190878102 X:54474280-54474302 CCTCTGCAGCCTCCCTTCCAGGG + Intronic
1199406944 X:147473294-147473316 CCACTGAAGCTCCTTTTGCCTGG - Intergenic
1200078937 X:153566089-153566111 CCCCTGCAGCCTCTCCTTCATGG + Intronic
1201628838 Y:16045942-16045964 CCACTGTATTCTCTCTTGTAGGG + Intergenic
1202016846 Y:20417590-20417612 TCACTGAAGCCTCTGTTTCCTGG - Intergenic