ID: 1137591429

View in Genome Browser
Species Human (GRCh38)
Location 16:49696503-49696525
Sequence TTTTCTACCTCCAGTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137591419_1137591429 30 Left 1137591419 16:49696450-49696472 CCATGGTGCCAGATTCCAAAAAC 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591425_1137591429 -6 Left 1137591425 16:49696486-49696508 CCCCGCTCTCAAGGTGTTTTTCT 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591421_1137591429 15 Left 1137591421 16:49696465-49696487 CCAAAAACCTGACTCCATCAGCC 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591420_1137591429 22 Left 1137591420 16:49696458-49696480 CCAGATTCCAAAAACCTGACTCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591422_1137591429 8 Left 1137591422 16:49696472-49696494 CCTGACTCCATCAGCCCCGCTCT 0: 1
1: 0
2: 3
3: 15
4: 197
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591426_1137591429 -7 Left 1137591426 16:49696487-49696509 CCCGCTCTCAAGGTGTTTTTCTA 0: 1
1: 0
2: 1
3: 27
4: 281
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591427_1137591429 -8 Left 1137591427 16:49696488-49696510 CCGCTCTCAAGGTGTTTTTCTAC 0: 1
1: 0
2: 0
3: 15
4: 224
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200
1137591424_1137591429 1 Left 1137591424 16:49696479-49696501 CCATCAGCCCCGCTCTCAAGGTG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG 0: 1
1: 1
2: 0
3: 28
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137591429 Original CRISPR TTTTCTACCTCCAGTGGCTT TGG Intronic
901810165 1:11762850-11762872 ATTTCTCCCTCCAGTGGCCTAGG - Intronic
902213553 1:14920824-14920846 TTTTCTGCCCTGAGTGGCTTGGG - Intronic
905155198 1:35972147-35972169 TTGTCTAATTCCAGTGGCTCAGG - Exonic
905576397 1:39048208-39048230 GCTTCTACCTCCCGGGGCTTAGG + Intergenic
906555152 1:46705080-46705102 TTTTCTACCTACTTTGGTTTAGG + Intronic
906576047 1:46891277-46891299 TTTCCTTCCTTCAGTAGCTTTGG - Intergenic
906577293 1:46902343-46902365 ATATCTAACTCCAGTGACTTTGG + Intergenic
906595873 1:47076309-47076331 TTTCCTTCCTTCAGTAGCTTTGG + Intronic
908829748 1:68167370-68167392 TCTTCTGCCTCCAGTGGACTTGG + Intronic
909358613 1:74736344-74736366 TTTTCTACCTCAAGTTATTTGGG + Intronic
910150018 1:84131719-84131741 ATTTATGGCTCCAGTGGCTTTGG - Intronic
910463170 1:87469536-87469558 TTTTGGATCTCCAGTGACTTAGG - Intergenic
910896189 1:92072045-92072067 TTTACTAGCTCCAGTGGATGTGG - Intergenic
914854818 1:151343242-151343264 TTTTCCACCTCCTGTGCCTCTGG - Intronic
914874334 1:151501590-151501612 TTTTCTTCCCCCAGTTGCTCTGG + Intergenic
920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG + Intronic
923112418 1:230902638-230902660 TTCTCTACCTCCAGAGCCCTGGG - Intergenic
1063866052 10:10366867-10366889 TCTGCCACCTCCAGTAGCTTTGG + Intergenic
1065944800 10:30596565-30596587 TCTTCAACTTCAAGTGGCTTGGG - Intergenic
1066676449 10:37892801-37892823 CTTTCTATTTCCAGTGCCTTTGG + Intergenic
1067811960 10:49436103-49436125 TTTTCTTCCTTTGGTGGCTTTGG - Intergenic
1070497641 10:77038911-77038933 TATTCTACCTGCAGTGGCCATGG + Intronic
1071597015 10:86935658-86935680 TTTACTTCCTCCAGTATCTTAGG - Exonic
1072548235 10:96456999-96457021 TTTTCTGACCCCAGTGGTTTTGG + Intronic
1073039320 10:100590543-100590565 TTTCCTTCCTCCACTTGCTTTGG - Intergenic
1073354534 10:102843458-102843480 ATATCTAACTCCAGTGACTTTGG - Intergenic
1073742970 10:106431791-106431813 CTTTCTACCTCTATTTGCTTTGG - Intergenic
1075597032 10:123739600-123739622 TTTTCTTTCTCCAGTGGCCTGGG + Intronic
1079400527 11:20103151-20103173 CTTTCTGCCTCCACTGGCCTGGG + Intronic
1080267889 11:30420674-30420696 TTTCCTACCTCAATTTGCTTGGG + Intronic
1082171310 11:49008713-49008735 TTTACCACCACCTGTGGCTTTGG + Intergenic
1082608952 11:55276540-55276562 ATTTCTACCCCCAGTGGCATTGG - Intergenic
1083267806 11:61555056-61555078 TTTTCTTCCTCCAGAGGAGTGGG + Intronic
1083533409 11:63446453-63446475 TCTCCTTCATCCAGTGGCTTTGG - Intergenic
1085575991 11:77603757-77603779 TTTTGTGCCTGCTGTGGCTTTGG - Intronic
1086477664 11:87195765-87195787 TTTTCATCCTACAGTTGCTTAGG + Intronic
1086643260 11:89186500-89186522 TTTCCTCCCACCAGTGGCCTTGG - Intronic
1086701643 11:89905972-89905994 GTTTCTACCCCCAGCGGCATTGG + Intergenic
1086704525 11:89938553-89938575 GTTTCTACCCCCAGCGGCATTGG - Intergenic
1087854686 11:103077520-103077542 CTTTCTAACTACAGTGGCCTTGG - Intronic
1089579396 11:119471892-119471914 CTTTGTCCCTCCAGTGCCTTGGG + Intergenic
1089948367 11:122501582-122501604 TTTTCTACCTCCCTTTTCTTTGG + Intergenic
1091033901 11:132215980-132216002 TTTTCTACCTACAGAAGGTTAGG - Intronic
1092530779 12:9342963-9342985 TTTTCTACCTCCAGTGGCCTTGG + Intergenic
1092771160 12:11898121-11898143 TTTGCTTCCTCCAGTGCCTCTGG + Intergenic
1094030433 12:26006096-26006118 TTTTCTAACTCCTGGGTCTTTGG - Intronic
1096506275 12:52095540-52095562 GTTTCTACCCCCAGCGGCATTGG + Intergenic
1097572466 12:61351529-61351551 TTTTCAACTTCCAGTAGCTCAGG + Intergenic
1099232010 12:80037907-80037929 TTTTCTACCTCCTGTTCCTCAGG + Intergenic
1100605441 12:96148712-96148734 TTTTATAGCTACAGAGGCTTAGG - Intergenic
1102870477 12:116410200-116410222 TTTTCTATCTGCAGTGTCTGTGG - Intergenic
1103187400 12:118971097-118971119 TCTTCTGCATCCAGGGGCTTTGG - Intergenic
1107805708 13:44152137-44152159 TTTTCTCTCTTCAGTGCCTTTGG - Intronic
1107933452 13:45325451-45325473 CTTTCTATTTCCAGTTGCTTAGG - Intergenic
1109225376 13:59688051-59688073 TTTTCTTCCCCCAGTTGCTTTGG + Intronic
1111027269 13:82545867-82545889 TTTTCTAGTTTCAATGGCTTTGG + Intergenic
1113723112 13:112575867-112575889 TTTTCCAGCTCCAGTGACTGTGG - Intronic
1114368149 14:22052866-22052888 TTTACAACCTCCAGTGGTTTAGG + Intergenic
1118444474 14:65838913-65838935 TCCTCTGCCTGCAGTGGCTTTGG + Intergenic
1119564296 14:75615533-75615555 TTTTCTTCCTCTTGTGGATTAGG + Intronic
1120117338 14:80635383-80635405 TTTTTTACCCCCAGTGGAGTTGG - Intronic
1120190268 14:81434373-81434395 TTTACTCTCTCCAGTGGCGTGGG - Intronic
1120253211 14:82085653-82085675 TTTTTTACCTACAGTGCCTTTGG + Intergenic
1122395929 14:101430649-101430671 TATTCTTCCTCCATTGCCTTGGG + Intergenic
1122821319 14:104346801-104346823 GTTTCTGGCTCCAGCGGCTTCGG - Intergenic
1125199353 15:37087234-37087256 GTTTCTATTCCCAGTGGCTTTGG + Intronic
1129874705 15:78966073-78966095 TTCTGTACCCCCAGTGGCTTAGG + Intronic
1130002406 15:80059360-80059382 TTCTCTACCTCCAATAGCTACGG - Intergenic
1131089379 15:89609805-89609827 TTTTTTCCCTCTATTGGCTTTGG + Intronic
1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG + Intronic
1140621968 16:76746071-76746093 TTATCTACCTCCATTACCTTAGG + Intergenic
1140700248 16:77574978-77575000 TTTTCTCCCTTCAGTGGCCCTGG + Intergenic
1143855040 17:9842255-9842277 TGTTCTAACTCCAGAGACTTTGG + Intronic
1145802123 17:27694359-27694381 ATATCTAACTCCAGTGACTTTGG - Intergenic
1148559094 17:48595943-48595965 TGTGCTCCTTCCAGTGGCTTTGG + Exonic
1149826876 17:59836539-59836561 TTTTCTCCCTCCAATTCCTTCGG + Intronic
1149962701 17:61129600-61129622 TTTTCAACTTCCAGGGCCTTCGG + Intronic
1150031352 17:61739434-61739456 TTTTCAGCCTCCAGTAACTTTGG - Intronic
1152274000 17:79343549-79343571 TTTTCTTCCTCCAGTGTTTTTGG - Intronic
1153158512 18:2176700-2176722 TTTTATATCTCCAGTTGCATTGG + Intergenic
1157045647 18:44099438-44099460 TTTCCTACCTCCCCTGGCTTGGG - Intergenic
1157971110 18:52270178-52270200 CTTTCTCCCTCTTGTGGCTTGGG - Intergenic
1158433591 18:57416245-57416267 TTTGCTATCTCCATTGGCTTGGG - Intergenic
1158672961 18:59493301-59493323 ATTTCTCCTTCCAGTGACTTAGG - Intronic
1159344052 18:67175831-67175853 CTTTCAACCTACAGTGGCATAGG - Intergenic
1160350224 18:78172255-78172277 TTGTCTAAATTCAGTGGCTTTGG - Intergenic
1163399758 19:17085154-17085176 TTTGCTGCCACCAGTGTCTTCGG - Intronic
1163942497 19:20508117-20508139 ATATCTAACTCCAGTGACTTTGG - Intergenic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
926868334 2:17385064-17385086 TTTTTTACCTCAAGTGGCCAAGG + Intergenic
927227765 2:20786558-20786580 TTTTTTTCCTCCATTGCCTTTGG + Intronic
928734515 2:34270978-34271000 TTTTTTACCTCCTGTTGTTTTGG - Intergenic
930679445 2:54240816-54240838 TTTCCTTGCTTCAGTGGCTTAGG + Intronic
933344734 2:81068320-81068342 TTTTCTACCACTAGGGGCTAAGG + Intergenic
934899314 2:98144944-98144966 TTTTCTCCCTTGAGTGGCTCAGG + Intronic
936761225 2:115785848-115785870 TTTTCTTCCTCCTGTAGCTTTGG + Intronic
937537365 2:122906627-122906649 GTTTCTACCTAAAGTGGGTTGGG - Intergenic
940813057 2:158267221-158267243 TTTTGCAGCTCCCGTGGCTTTGG + Intronic
940833005 2:158489450-158489472 TTTTGTTCCTCCAGTGGAGTTGG + Intronic
940873345 2:158878424-158878446 GTTTCTACCCCTAGTGGCATTGG + Intergenic
941429580 2:165397898-165397920 TATTATGCCTACAGTGGCTTTGG + Intergenic
941850370 2:170174025-170174047 CTGTCAACATCCAGTGGCTTTGG - Intergenic
945006114 2:205408826-205408848 TTTTCTAGGTCCTGTGGTTTGGG + Intronic
945699662 2:213153850-213153872 CTTTCTCCCTCTAGTGGCTAAGG + Intergenic
1168862131 20:1053014-1053036 TTGTCTATCTCCTCTGGCTTGGG - Intergenic
1170986626 20:21265270-21265292 TTTCCTCTCTCCAGTCGCTTGGG + Intergenic
1172062813 20:32198029-32198051 TTTTCTACTTCCTGTCTCTTAGG - Intronic
1174683827 20:52434449-52434471 TTTCCTTCCTCCAGTGGCTCAGG + Intergenic
1175525981 20:59633791-59633813 TTTATTACCTCCTGTGGCTCTGG + Intronic
1177264888 21:18769854-18769876 TTTTCTACCTCCAGCTCCCTAGG + Intergenic
1177844183 21:26269400-26269422 TTTCCTGCCTCCACTGCCTTTGG + Intergenic
1179355973 21:40660089-40660111 ATATCTACCTCCTGTGGTTTTGG - Intronic
1179558123 21:42193714-42193736 GTTGCCACCTCCAGTGGCTCAGG + Intergenic
1180126206 21:45791979-45792001 TTTCCTTGCTCCAGTCGCTTGGG + Intronic
1180991034 22:19936352-19936374 ATATCTAACTCCAGTGACTTTGG + Intronic
1181776538 22:25164068-25164090 TTCTCACCTTCCAGTGGCTTTGG + Intronic
1182791192 22:32954395-32954417 TTTGCTACCTGCAGTGGATAGGG + Intronic
1183880008 22:40819293-40819315 TTTCCTAACTCCACTGGCTGCGG - Exonic
1184913466 22:47551075-47551097 TTTTCTAACTCCCGGGGCTGGGG + Intergenic
951523708 3:23632753-23632775 GTTTTTCCCTCCAGTGGCGTGGG + Intergenic
956636952 3:71374655-71374677 TTTGCTACCTCCAATAGCTTTGG - Intronic
957353332 3:79053322-79053344 ATATCTAACTCCAGTGACTTTGG + Intronic
958456454 3:94337857-94337879 TTTTCTATTTCCAGTATCTTAGG + Intergenic
959019195 3:101169714-101169736 TTTTCTAGCTCCAGTGGTTATGG - Intergenic
959907382 3:111725002-111725024 TATTCTTCCTTCTGTGGCTTGGG + Intronic
961802329 3:129461283-129461305 TCTTGTTCCTCCAGTGACTTTGG + Exonic
961802341 3:129461414-129461436 TTCTCTACCTTCAATGGCTGAGG + Intronic
961917015 3:130386868-130386890 TTTTCTAGCTCCACAAGCTTTGG - Intronic
962471736 3:135715134-135715156 TTTTCTTCCTGCAGTGGGTTGGG - Intergenic
963926437 3:150956491-150956513 CTTTCTCTCTCCTGTGGCTTAGG - Intronic
964611008 3:158614868-158614890 TCTTCTAGCTGCAGTTGCTTGGG + Intergenic
964636977 3:158868853-158868875 TTTCCTCCCTCCAGTCCCTTGGG + Intergenic
964637232 3:158871058-158871080 TTTCCTCCCTCCAGTCCCTTGGG + Intergenic
965875610 3:173315036-173315058 CTTTCTACCTTCATTTGCTTGGG + Intergenic
966067767 3:175836847-175836869 TTTTAGACCTCCAATGACTTGGG - Intergenic
966745391 3:183270198-183270220 TCTTCTCCCTCCAGTGGATTAGG - Exonic
966923094 3:184627267-184627289 GGCTCTACCTCCAGGGGCTTAGG - Intronic
967294670 3:187953439-187953461 TTTTCTACTTGCTGTGCCTTTGG + Intergenic
967723502 3:192839965-192839987 TTTTTTACCTGCAGTGGCTGTGG - Intronic
968268962 3:197385699-197385721 TTTTCTATCTGCAGTGCATTTGG + Intergenic
968466561 4:754479-754501 CCTTCTACCTCCAGGGGCTCTGG - Intronic
969192912 4:5536836-5536858 TTTTCTTTCTCCTGAGGCTTTGG - Intergenic
970538449 4:17053946-17053968 TTTTCTAGCTCCAGAGTCTATGG + Intergenic
971500869 4:27316646-27316668 TTTTCTTCTCCTAGTGGCTTAGG + Intergenic
971717941 4:30204837-30204859 GTATCTACCTCCAGTGGGTAGGG - Intergenic
971805783 4:31356198-31356220 TTTTTCACCTGCAGTGGGTTGGG + Intergenic
971887204 4:32465927-32465949 TTTTCTTCCACAAGTGGCTAAGG - Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
973540679 4:51932335-51932357 TTTTTTCCCTCCACTGGCTGTGG + Intergenic
974333465 4:60508973-60508995 TTTTCTGTTTCCATTGGCTTGGG - Intergenic
977184940 4:93925314-93925336 TTTTCTAACTCCTCTGCCTTTGG + Intergenic
978327549 4:107576315-107576337 TTTGCAAACTCCAATGGCTTTGG - Intergenic
979604727 4:122625727-122625749 TTTTCTGCTTTCACTGGCTTTGG + Intergenic
980192020 4:129537329-129537351 TTTTATACGTCTAGTTGCTTAGG - Intergenic
985103723 4:186482362-186482384 TTGTCTCTCTACAGTGGCTTTGG + Intronic
985620334 5:951685-951707 GTTTCTGGGTCCAGTGGCTTTGG + Intergenic
989437036 5:41426458-41426480 TTTTTTACTTCTAGTGGCTTGGG + Intronic
989783320 5:45296976-45296998 TCTTCTAGCTCCACTGGGTTAGG - Intronic
991130194 5:63113622-63113644 TTTTCTACATCCAAAGGCTGAGG + Intergenic
991203293 5:64019310-64019332 TTCTCTTCCTCCTGTGCCTTTGG - Intergenic
992412209 5:76517003-76517025 ATTTCTACCTTCAGCTGCTTTGG - Intronic
993489301 5:88526628-88526650 TTTGCTTCCTGCAGTGGCTATGG + Intergenic
996401778 5:123070471-123070493 TTTTCTACTTCCTCTAGCTTAGG + Intergenic
996518700 5:124402025-124402047 GTTTCCACCTCTAGTGGCTTAGG - Intergenic
997122046 5:131184759-131184781 TTATGTACCTCCAGTGGCTGAGG + Intronic
997660952 5:135589279-135589301 GTTTATACTTGCAGTGGCTTGGG + Intergenic
997767017 5:136514752-136514774 TTTCCTTCCTCCTGTGGCTTAGG - Intergenic
997785511 5:136708747-136708769 TGTTCTTCCTCCAGTGATTTGGG - Intergenic
998028512 5:138842426-138842448 TTTCCTATATACAGTGGCTTCGG - Intronic
1004370378 6:15047258-15047280 TTTGGTGCCTCCAGCGGCTTTGG - Intergenic
1007326570 6:41065847-41065869 TTTTCTCCCTAGAGTGACTTTGG - Exonic
1008429192 6:51394826-51394848 TTTTCCACTTCCAGTGTATTTGG + Intergenic
1009061321 6:58400667-58400689 CTGTCTAACTCCAGTGGCTTTGG + Intergenic
1009248991 6:61275219-61275241 ATGTCTAACTCCAGTGACTTTGG + Intergenic
1009527085 6:64761048-64761070 TTTTCTACCATCAGTGGATTTGG + Intronic
1012805330 6:103886067-103886089 GATTCTACCTCCAGTGGATTTGG - Intergenic
1012831438 6:104208195-104208217 TTTTATTCCCCCAGTGGCATTGG - Intergenic
1013201989 6:107907018-107907040 TTTAATGCCTCCAGTTGCTTTGG - Intronic
1014257162 6:119172663-119172685 TTTTCAACCCACAGTAGCTTTGG - Intergenic
1016101460 6:140106119-140106141 TGTTTTACCTCCAGGGGCATGGG - Intergenic
1016964765 6:149708726-149708748 GGTTCTCCATCCAGTGGCTTAGG - Intronic
1016987643 6:149907110-149907132 TTTACTTCCTCCAGTATCTTTGG + Intergenic
1017404126 6:154098466-154098488 TTTTCTACCTCATGTAGTTTTGG + Intronic
1017993740 6:159512291-159512313 ATTTCTACCTGGAGTGGCTGAGG + Intergenic
1018283597 6:162214278-162214300 TTTTCTATCTCCAGTATCCTAGG + Intronic
1018286033 6:162238787-162238809 CATTGTACCTCCAGTGGCTCTGG - Intronic
1020088999 7:5327162-5327184 TTTTCTACCTCTCCTGGCCTTGG - Intronic
1021048959 7:15958316-15958338 TTTTTTAACTCCATTGTCTTGGG - Intergenic
1024593639 7:50913590-50913612 TTTTGTACCTCCAGTTCCTCAGG + Intergenic
1024598081 7:50956448-50956470 TTTGCTACCTCCTGTGGTATTGG - Intergenic
1024693370 7:51827571-51827593 TTATCTTCCTGCAGAGGCTTTGG + Intergenic
1026219254 7:68378234-68378256 CATTCTACCTCTGGTGGCTTTGG - Intergenic
1026426448 7:70299232-70299254 TTTTCTGCCTCCAGACTCTTTGG + Intronic
1028315637 7:89398862-89398884 TTTTATATCTCCAGGTGCTTTGG - Intergenic
1028423567 7:90660969-90660991 GTTTCTACCTCCTGTGACTCAGG - Intronic
1030086303 7:105818813-105818835 TTTTCTAGCTGCAGTGTTTTGGG - Intronic
1031112250 7:117624940-117624962 TATTCTACCTCCAGTACCTCTGG - Intronic
1033009821 7:137609119-137609141 TTTTCCACCTCCCTTGCCTTGGG - Intronic
1034910313 7:154992066-154992088 TTTTCTACTTCCAAAGACTTGGG + Intronic
1036238762 8:7065151-7065173 CTTTCTACCCCCAGCGGCATTGG + Intergenic
1037933573 8:22899195-22899217 TTTTCTACCTCCAGAGAGCTGGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040139534 8:43894246-43894268 ATATCTAACTCCAGTGACTTTGG + Intergenic
1041214106 8:55582891-55582913 TTTGCCACCTCCAGAGCCTTCGG + Intergenic
1044755327 8:95455758-95455780 TGTTCTACCTCTCTTGGCTTTGG + Intergenic
1050636182 9:7615658-7615680 TTTTAGGCTTCCAGTGGCTTGGG + Intergenic
1051598902 9:18852412-18852434 TTTTCCACTTCCAGTGGCCAGGG - Intronic
1053283058 9:36834073-36834095 TTTTCACCCTCTAGTGGCCTTGG - Exonic
1054725877 9:68649519-68649541 TTTTCTTCCTAAAATGGCTTGGG + Intergenic
1055149014 9:72972691-72972713 TATTCTACCCACAGTGGCTTAGG + Intronic
1056455549 9:86756208-86756230 TTTTCTGCCTACAGTGGCCTGGG - Intergenic
1056548388 9:87631790-87631812 TTTTCTACCTTCAGAGATTTGGG + Intronic
1056921591 9:90794996-90795018 TTTTGAATCTCCAGTGGCTTGGG + Intergenic
1057088319 9:92231737-92231759 TTTTCTACCTCCAGATGGTATGG + Intronic
1057282046 9:93720208-93720230 TTTTCTCCCTCCTGGGGCTGTGG - Intergenic
1058595723 9:106613461-106613483 TTAAATACCTCCAGTGGCTGTGG + Intergenic
1059341323 9:113599085-113599107 TTTTCTGTCTCCAAAGGCTTTGG + Intergenic
1059570679 9:115431331-115431353 CTTTCTAGATCCAGTGACTTTGG + Intergenic
1060535429 9:124382925-124382947 TTGTCTATCTCCAGTTGATTGGG - Intronic
1060691595 9:125665769-125665791 TTTTATACCTCCATTGTATTTGG + Intronic
1186131001 X:6465230-6465252 TTTTCAACCGCCAGTTGCTATGG - Intergenic
1187088753 X:16070865-16070887 TTTTCTTCCTACAATAGCTTTGG + Intergenic
1187254368 X:17628739-17628761 TTTACCACCTCCAATGCCTTGGG + Intronic
1190832197 X:54069260-54069282 TTTTCTCCATCCTGTGACTTTGG - Exonic
1190944162 X:55074788-55074810 TCTTTCACTTCCAGTGGCTTTGG - Intergenic
1191693393 X:63963720-63963742 TCTTCTTCCTCCATTGGCTTTGG - Intergenic
1192398427 X:70809053-70809075 TTTTCCTCCTCCATTGACTTGGG - Intronic
1192494629 X:71607243-71607265 ATTTCTGCCTCCAGTTACTTAGG - Intronic
1194514215 X:94829803-94829825 TCTTGTACTTCCAGTGGTTTGGG - Intergenic
1201351312 Y:13045185-13045207 TTGTCTACTTCCAGTTGCTATGG - Intergenic