ID: 1137593169

View in Genome Browser
Species Human (GRCh38)
Location 16:49706335-49706357
Sequence GCCTGGAGGTGAGAACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137593169_1137593178 21 Left 1137593169 16:49706335-49706357 CCTTCAAGTTCTCACCTCCAGGC 0: 1
1: 0
2: 1
3: 38
4: 247
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593169_1137593174 0 Left 1137593169 16:49706335-49706357 CCTTCAAGTTCTCACCTCCAGGC 0: 1
1: 0
2: 1
3: 38
4: 247
Right 1137593174 16:49706358-49706380 CAGCCATGGCCACAGCTGCCTGG 0: 1
1: 0
2: 7
3: 61
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137593169 Original CRISPR GCCTGGAGGTGAGAACTTGA AGG (reversed) Intronic