ID: 1137593169 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:49706335-49706357 |
Sequence | GCCTGGAGGTGAGAACTTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 287 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 38, 4: 247} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137593169_1137593178 | 21 | Left | 1137593169 | 16:49706335-49706357 | CCTTCAAGTTCTCACCTCCAGGC | 0: 1 1: 0 2: 1 3: 38 4: 247 |
||
Right | 1137593178 | 16:49706379-49706401 | GGCCAATCAGACAGACACGCTGG | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||||
1137593169_1137593174 | 0 | Left | 1137593169 | 16:49706335-49706357 | CCTTCAAGTTCTCACCTCCAGGC | 0: 1 1: 0 2: 1 3: 38 4: 247 |
||
Right | 1137593174 | 16:49706358-49706380 | CAGCCATGGCCACAGCTGCCTGG | 0: 1 1: 0 2: 7 3: 61 4: 523 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137593169 | Original CRISPR | GCCTGGAGGTGAGAACTTGA AGG (reversed) | Intronic | ||