ID: 1137593171

View in Genome Browser
Species Human (GRCh38)
Location 16:49706349-49706371
Sequence TGTGGCCATGGCTGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137593171_1137593180 24 Left 1137593171 16:49706349-49706371 CCTCCAGGCCAGCCATGGCCACA 0: 1
1: 1
2: 4
3: 47
4: 415
Right 1137593180 16:49706396-49706418 CGCTGGAAGAATCCCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90
1137593171_1137593178 7 Left 1137593171 16:49706349-49706371 CCTCCAGGCCAGCCATGGCCACA 0: 1
1: 1
2: 4
3: 47
4: 415
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593171_1137593181 25 Left 1137593171 16:49706349-49706371 CCTCCAGGCCAGCCATGGCCACA 0: 1
1: 1
2: 4
3: 47
4: 415
Right 1137593181 16:49706397-49706419 GCTGGAAGAATCCCATCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137593171 Original CRISPR TGTGGCCATGGCTGGCCTGG AGG (reversed) Intronic