ID: 1137593172 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:49706352-49706374 |
Sequence | AGCTGTGGCCATGGCTGGCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 502 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 60, 4: 433} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137593172_1137593180 | 21 | Left | 1137593172 | 16:49706352-49706374 | CCAGGCCAGCCATGGCCACAGCT | 0: 1 1: 0 2: 8 3: 60 4: 433 |
||
Right | 1137593180 | 16:49706396-49706418 | CGCTGGAAGAATCCCATCCCTGG | 0: 1 1: 0 2: 0 3: 3 4: 90 |
||||
1137593172_1137593178 | 4 | Left | 1137593172 | 16:49706352-49706374 | CCAGGCCAGCCATGGCCACAGCT | 0: 1 1: 0 2: 8 3: 60 4: 433 |
||
Right | 1137593178 | 16:49706379-49706401 | GGCCAATCAGACAGACACGCTGG | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||||
1137593172_1137593181 | 22 | Left | 1137593172 | 16:49706352-49706374 | CCAGGCCAGCCATGGCCACAGCT | 0: 1 1: 0 2: 8 3: 60 4: 433 |
||
Right | 1137593181 | 16:49706397-49706419 | GCTGGAAGAATCCCATCCCTGGG | 0: 1 1: 0 2: 0 3: 13 4: 139 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137593172 | Original CRISPR | AGCTGTGGCCATGGCTGGCC TGG (reversed) | Intronic | ||