ID: 1137593175

View in Genome Browser
Species Human (GRCh38)
Location 16:49706361-49706383
Sequence TGGCCAGGCAGCTGTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 11, 3: 98, 4: 476}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137593175_1137593181 13 Left 1137593175 16:49706361-49706383 CCATGGCCACAGCTGCCTGGCCA 0: 1
1: 0
2: 11
3: 98
4: 476
Right 1137593181 16:49706397-49706419 GCTGGAAGAATCCCATCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 139
1137593175_1137593180 12 Left 1137593175 16:49706361-49706383 CCATGGCCACAGCTGCCTGGCCA 0: 1
1: 0
2: 11
3: 98
4: 476
Right 1137593180 16:49706396-49706418 CGCTGGAAGAATCCCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90
1137593175_1137593178 -5 Left 1137593175 16:49706361-49706383 CCATGGCCACAGCTGCCTGGCCA 0: 1
1: 0
2: 11
3: 98
4: 476
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137593175 Original CRISPR TGGCCAGGCAGCTGTGGCCA TGG (reversed) Intronic