ID: 1137593178

View in Genome Browser
Species Human (GRCh38)
Location 16:49706379-49706401
Sequence GGCCAATCAGACAGACACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137593175_1137593178 -5 Left 1137593175 16:49706361-49706383 CCATGGCCACAGCTGCCTGGCCA 0: 1
1: 0
2: 11
3: 98
4: 476
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593171_1137593178 7 Left 1137593171 16:49706349-49706371 CCTCCAGGCCAGCCATGGCCACA 0: 1
1: 1
2: 4
3: 47
4: 415
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593172_1137593178 4 Left 1137593172 16:49706352-49706374 CCAGGCCAGCCATGGCCACAGCT 0: 1
1: 0
2: 8
3: 60
4: 433
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593169_1137593178 21 Left 1137593169 16:49706335-49706357 CCTTCAAGTTCTCACCTCCAGGC 0: 1
1: 0
2: 1
3: 38
4: 247
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593173_1137593178 -1 Left 1137593173 16:49706357-49706379 CCAGCCATGGCCACAGCTGCCTG 0: 1
1: 0
2: 8
3: 67
4: 880
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137593178 Original CRISPR GGCCAATCAGACAGACACGC TGG Intronic