ID: 1137593178

View in Genome Browser
Species Human (GRCh38)
Location 16:49706379-49706401
Sequence GGCCAATCAGACAGACACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137593175_1137593178 -5 Left 1137593175 16:49706361-49706383 CCATGGCCACAGCTGCCTGGCCA 0: 1
1: 0
2: 11
3: 98
4: 476
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593171_1137593178 7 Left 1137593171 16:49706349-49706371 CCTCCAGGCCAGCCATGGCCACA 0: 1
1: 1
2: 4
3: 47
4: 415
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593169_1137593178 21 Left 1137593169 16:49706335-49706357 CCTTCAAGTTCTCACCTCCAGGC 0: 1
1: 0
2: 1
3: 38
4: 247
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593172_1137593178 4 Left 1137593172 16:49706352-49706374 CCAGGCCAGCCATGGCCACAGCT 0: 1
1: 0
2: 8
3: 60
4: 433
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1137593173_1137593178 -1 Left 1137593173 16:49706357-49706379 CCAGCCATGGCCACAGCTGCCTG 0: 1
1: 0
2: 8
3: 67
4: 880
Right 1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137593178 Original CRISPR GGCCAATCAGACAGACACGC TGG Intronic
900576609 1:3385720-3385742 GGCCAATGAGGCAGCCACTCGGG + Intronic
901238024 1:7678007-7678029 GGCCACTCAGACAGCCCAGCAGG - Intronic
902474653 1:16675582-16675604 GGCCATTCTGACAGACAGGGAGG - Intergenic
902484208 1:16732162-16732184 GGCCATTCTGACAGACAGGGAGG + Intergenic
903344351 1:22674968-22674990 GGACAATCCCACAGACACCCGGG - Intergenic
903733903 1:25517786-25517808 GGCCAATCAGAATATCACGCGGG + Intergenic
904045119 1:27604036-27604058 GACCAGACAGACAGACAGGCGGG - Intronic
904535383 1:31196014-31196036 GGCCAAGCAGAAAGTCACTCTGG - Intronic
905458868 1:38107765-38107787 GCCCCATCAGACAGAAACTCGGG + Intergenic
908771874 1:67604897-67604919 GGGCAGACAGACAGACAGGCAGG - Intergenic
912063787 1:105708872-105708894 GGCCAATCAAACAAACACAGTGG - Intergenic
915729976 1:158046413-158046435 GGCCAATGAGACAGCCAAGTGGG + Intronic
916586346 1:166153474-166153496 GGCCAATCGATCAGACAGGCAGG + Intronic
922588310 1:226752635-226752657 AGCCAATCAGACACACCCACTGG - Intergenic
1062825681 10:566768-566790 GGCCCATCGGACAGACAGCCTGG + Intronic
1065189343 10:23195810-23195832 GCCCAATCCAACAGAAACGCAGG - Intergenic
1065623398 10:27606612-27606634 TGCCAATGAGACAGGCAGGCAGG + Intergenic
1069683535 10:70301545-70301567 GGCCAACCAGACAGAAAAGAAGG + Intronic
1069827659 10:71263850-71263872 GGACAAACAGACAGACAGGGAGG + Intronic
1069919761 10:71809519-71809541 GGAGAAACAGACAGACACTCAGG + Intronic
1075479953 10:122771187-122771209 GGCAGAACAGACAGACAAGCGGG + Intergenic
1076981665 11:208071-208093 GGCCACTGAAACGGACACGCAGG + Intronic
1077640249 11:3874886-3874908 GGCAAATCAGAAAGACACAGGGG - Intronic
1078415775 11:11163417-11163439 GGCCAAGCTGACGGACAAGCAGG - Intergenic
1088917186 11:114236510-114236532 AGCCCACCAGACAGACACGGGGG + Intronic
1095202412 12:39399717-39399739 GGCCTATCAGAGAGACACAGGGG - Intronic
1103062729 12:117872023-117872045 TGCCAATCATAAAGACACACAGG + Intronic
1103705041 12:122866984-122867006 CTAAAATCAGACAGACACGCTGG + Exonic
1104694489 12:130852929-130852951 GGCCAGTCAGTCAGACGCACTGG - Intergenic
1106704847 13:32269401-32269423 GGCCAATCAGCCAGGCACAGTGG + Intronic
1107838470 13:44432016-44432038 GGCCAATAAGACCTACACTCAGG + Intergenic
1109327259 13:60882901-60882923 GGCCCACCAGACAGACACATTGG + Intergenic
1113461790 13:110487026-110487048 GGCCAGACAGACACACAGGCAGG - Intronic
1118874248 14:69769507-69769529 GGCCAACGACACAGACAGGCTGG - Intronic
1122796163 14:104207267-104207289 GGCCAGTCGGGCAGACACGGAGG - Intergenic
1123770384 15:23522600-23522622 GGGCAATCAGAATGACAGGCTGG - Intergenic
1125740274 15:41957976-41957998 GGTCAATCACACAGCCACACGGG + Intronic
1132555818 16:572182-572204 GGTCACACAGCCAGACACGCTGG + Intronic
1132736893 16:1390673-1390695 GGCCAAGCGGAGAGACTCGCCGG - Intronic
1135436224 16:22428484-22428506 TGCCACACAGACAGGCACGCAGG + Intronic
1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG + Intronic
1141526888 16:84617656-84617678 GGACAATCTAACAGACGCGCTGG + Intronic
1142045437 16:87922318-87922340 TGCCACACAGACAGGCACGCAGG + Intronic
1143590110 17:7880193-7880215 GGCCAATCAGACAGAAGAGAGGG + Intronic
1146202555 17:30872495-30872517 GGCCAAGCAGACAGAGATGTGGG - Intronic
1152698828 17:81809175-81809197 GGGCAGACAGACAGACAGGCAGG - Intronic
1153995043 18:10433540-10433562 GGCCAATCACACAAACTCTCAGG + Intergenic
1160188443 18:76694686-76694708 GGCCAATCACACAGAAACCAGGG + Intergenic
1168254988 19:55160288-55160310 GCCCTGTCAGACAGACACGCAGG + Intronic
1202707974 1_KI270713v1_random:37665-37687 GGCCATTCCGACAGACAGGGAGG - Intergenic
925261972 2:2536833-2536855 GGACAGACAGACAGACACACAGG - Intergenic
925404061 2:3594714-3594736 CACCAATCAGACAGAAACGAGGG - Intergenic
928251821 2:29687376-29687398 AGGCAAGCAGACAGACAAGCAGG - Intronic
933767563 2:85720486-85720508 GACCAGTCAGAGAGACAGGCAGG + Intergenic
939446254 2:142313228-142313250 AGCCAATAAGAGAGACAGGCAGG - Intergenic
940057339 2:149526718-149526740 GGCCAATCTGACTTTCACGCAGG + Intergenic
941627219 2:167843471-167843493 GGCTAATCAGACAGACTGCCAGG + Intergenic
1169001475 20:2171061-2171083 AGGCAATCAGGCAGACAGGCAGG + Intronic
1170813889 20:19696867-19696889 GGCCATGCAGTCAGGCACGCTGG - Exonic
1173349626 20:42233038-42233060 GGCAAAGCAGACAGACAGGTAGG - Intronic
1174510170 20:51045336-51045358 GGCCAATCTGACAGGCAGGCAGG + Intergenic
1178818429 21:35952761-35952783 GGCCAATCAAGCAGAAATGCAGG + Intronic
1179116000 21:38493397-38493419 GGCCAAACAGATACACACGGTGG + Intronic
1181895631 22:26105136-26105158 GGCCATTCTGACAGACACCTGGG - Intergenic
1183661726 22:39225319-39225341 GGCCAAGCAGAGAGACACAGGGG + Intronic
1184317900 22:43711995-43712017 GGCCAATCAAACAAAAAAGCTGG + Intronic
1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG + Intronic
1185247614 22:49781418-49781440 GGCCCATCAGTCAGACCTGCAGG - Intronic
954154829 3:48679575-48679597 GGACATGCAGACAGACACGCAGG - Exonic
954818921 3:53307678-53307700 GGGCAATCAGACAAACCTGCTGG + Intronic
961072267 3:123943985-123944007 AGCCAATCAGTCAGAAACACAGG + Intronic
961531299 3:127541998-127542020 ACCCAAGCAGACAGACAGGCAGG + Intergenic
963233393 3:142932121-142932143 GGCCAATGAGACAGGAAGGCAGG - Intergenic
968471320 4:783749-783771 GGGCAATCAGACAGACCCATAGG - Intergenic
970607366 4:17693184-17693206 GGACACTCAGCCAGACAGGCAGG - Intronic
972672659 4:41228526-41228548 GGACAGACAGACAGACAGGCAGG - Intergenic
973229963 4:47829548-47829570 GGCCAATCAGTCAGAAGTGCAGG + Intronic
988672947 5:33401553-33401575 GGCCAGCCAGACAGACAACCTGG + Intergenic
997373930 5:133383557-133383579 GGCCTGTCAGTCAGACAGGCAGG - Intronic
998282265 5:140823088-140823110 GGCCACTTCCACAGACACGCTGG - Exonic
1000234138 5:159342018-159342040 AGCCCATCAGATAGACACGTGGG - Intergenic
1006170141 6:32087704-32087726 GGCCAACCAGACTTACACGTCGG - Intronic
1007593629 6:43038260-43038282 TGCCTACCAGACAGACAAGCTGG + Exonic
1011736020 6:90311310-90311332 GGCCTGTCAAACAGACATGCTGG + Intergenic
1013658831 6:112273503-112273525 GGCCAGCCAGCCAGACACGGTGG - Intergenic
1017897956 6:158697821-158697843 GTCCTATCAGGCAGACACTCTGG - Intronic
1020318812 7:6925725-6925747 CCCCAATCAAACAGACACCCAGG - Intergenic
1023213293 7:37831591-37831613 TGCAAATCAGGCAGACATGCAGG - Intronic
1028641156 7:93043547-93043569 GGCCAGCCAGGCAGAGACGCGGG + Intergenic
1043151429 8:76721435-76721457 GGCAAATGAGACAGACACAAAGG + Intronic
1053323357 9:37120092-37120114 GGCCAAGCAGCCAGCCACGCTGG + Intergenic
1062147477 9:134997651-134997673 TGCCAAGCAGACAGACCCACTGG - Intergenic
1195174102 X:102298016-102298038 GGACAAAGAGACAGACACACAGG + Intergenic
1195184763 X:102389077-102389099 GGACAAAGAGACAGACACACAGG - Intronic
1198808499 X:140511138-140511160 GGCCACTCAGACGGCAACGCCGG - Intergenic