ID: 1137594388

View in Genome Browser
Species Human (GRCh38)
Location 16:49714161-49714183
Sequence CAGGAGATCATGGGCTCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137594377_1137594388 24 Left 1137594377 16:49714114-49714136 CCAGGAGCCGGAGCATCTTCCTG 0: 1
1: 0
2: 3
3: 13
4: 158
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594374_1137594388 30 Left 1137594374 16:49714108-49714130 CCATCCCCAGGAGCCGGAGCATC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594381_1137594388 -1 Left 1137594381 16:49714139-49714161 CCCTGCAGACGGCTCATTCTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594376_1137594388 25 Left 1137594376 16:49714113-49714135 CCCAGGAGCCGGAGCATCTTCCT 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594375_1137594388 26 Left 1137594375 16:49714112-49714134 CCCCAGGAGCCGGAGCATCTTCC 0: 1
1: 0
2: 2
3: 4
4: 134
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594378_1137594388 17 Left 1137594378 16:49714121-49714143 CCGGAGCATCTTCCTGTGCCCTG 0: 1
1: 1
2: 1
3: 50
4: 333
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594382_1137594388 -2 Left 1137594382 16:49714140-49714162 CCTGCAGACGGCTCATTCTCCCA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1137594380_1137594388 5 Left 1137594380 16:49714133-49714155 CCTGTGCCCTGCAGACGGCTCAT 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137594388 Original CRISPR CAGGAGATCATGGGCTCCGA AGG Intronic
900891975 1:5456093-5456115 CAGGAGAACATCAGCTCTGAGGG + Intergenic
904557196 1:31373053-31373075 CAGGCGTGCAAGGGCTCCGACGG + Exonic
905622750 1:39462934-39462956 CAGGGAATCTTGGGCTCCTAGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
913205338 1:116533343-116533365 CCTGAGATCATGGACTGCGATGG - Intronic
917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG + Intronic
923193468 1:231642207-231642229 CGGGTGAGCATGGGCTCCGCGGG - Intronic
923398416 1:233590526-233590548 CAGGTGATCAAGGGCTCTGGGGG - Intergenic
1067335036 10:45354438-45354460 CAGGAGATCATGCGGTCAGCTGG + Intergenic
1069862805 10:71481948-71481970 CAGGAGAGCCTGGGCTGCAAAGG + Intronic
1075017586 10:118921555-118921577 ACGGAGATTATGGGCTACGAAGG + Intergenic
1075768278 10:124912232-124912254 CAGGAGATCCTGGACTCAGGAGG - Intergenic
1076264784 10:129101170-129101192 CAGGAGATTAGAGGCTACGAGGG - Intergenic
1078751621 11:14170382-14170404 CAGGAGATTTTGGGCTGAGAAGG + Intronic
1085385757 11:76157318-76157340 CAGAAGAACAGGGGCTCTGAAGG - Intergenic
1089036320 11:115396734-115396756 AAGGAGATGATGGGCTGGGAAGG + Intronic
1089306671 11:117530641-117530663 CAGGAGATCAGGAGCTGGGAGGG - Intronic
1092088174 12:5782814-5782836 CTAGAGAGCATGGGCTCCAATGG + Intronic
1093724871 12:22492848-22492870 CAGTAGATCAAGGGTTCCAAAGG + Intronic
1099907013 12:88783346-88783368 CAGGTCATCATGGGCTGTGATGG + Intergenic
1101358551 12:104004484-104004506 GAGGAGATTATGGGCTGAGACGG - Intronic
1110676533 13:78252959-78252981 CAGGAGAACATAAGCTCCAATGG + Intergenic
1111907186 13:94268959-94268981 CAGGGGCTCATGGGCTGGGAGGG + Intronic
1114268851 14:21089326-21089348 GAGGAGAACATGGGCTGCCAGGG - Exonic
1117330991 14:54711834-54711856 TAGCAGATCAGGGGCTCCTAAGG - Intronic
1123707290 15:22959541-22959563 CAGGAGGCCATGGGCTCGGCTGG + Intronic
1126884372 15:53133986-53134008 CATGACATCATGGGCTCAAAGGG + Intergenic
1130383583 15:83392612-83392634 CAGGAGACCCTGGGCTCTGCAGG + Intergenic
1135956938 16:26963676-26963698 CAGGAGACCATGGTCCCAGATGG + Intergenic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1137894340 16:52194913-52194935 CATGAGATCAAGGGCTCTGTCGG + Intergenic
1142031907 16:87842707-87842729 CAGGAGATCAAGGCCTCAGCAGG - Intronic
1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG + Exonic
1142474757 17:182154-182176 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1143599252 17:7933111-7933133 CAGGAGATCCTCCGCCCCGAGGG - Exonic
1148729031 17:49819367-49819389 CAGGAAATAATGGGGTCAGAAGG + Intronic
1149849157 17:60025254-60025276 CAGGTGATCAAGGGCACCCAGGG - Intergenic
1149861011 17:60121270-60121292 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1149916366 17:60613672-60613694 CAGGTGGGCATGGGCTCCGCAGG + Intronic
1151364915 17:73611099-73611121 CAAGAGACCAGGGGCTCCGAGGG + Intronic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1157476268 18:48025466-48025488 CAGGAGATCAGGAGCACCCAGGG + Intergenic
1160352479 18:78195474-78195496 CAGGAGCCCATGGCCACCGAGGG + Intergenic
1161801464 19:6418754-6418776 CAGGAGATCATGATCCCCGCGGG - Exonic
1163725318 19:18919973-18919995 CAGGAGATCCGGGGTTCCGGAGG + Intronic
1166197011 19:41213644-41213666 CAGGAGATCCTGGGAACAGAAGG - Intergenic
929435231 2:41923653-41923675 GAGGAGAACATGGGCTTCTAGGG + Intergenic
931882168 2:66578647-66578669 CAGGAGCCCAGGGGCTCCGGGGG - Intergenic
931891203 2:66674492-66674514 AAGGAAATAATGGGCTCCAAAGG + Intergenic
932783528 2:74579262-74579284 CAGGAGTTCCTGGCCTCTGAGGG + Intronic
935328182 2:101956727-101956749 CAGGAGAGCAGAGGCTGCGAAGG + Intergenic
935572084 2:104672272-104672294 CAGGAGCACTTGGCCTCCGATGG + Intergenic
937090434 2:119202634-119202656 AAGGAGATCAGGGTCTCCTAGGG - Intergenic
937126526 2:119478353-119478375 CAGGAGGCCAGGGGCTCCCAGGG + Intronic
940639017 2:156329155-156329177 CAGGAGACCATGGGCTGCGGCGG - Intronic
1169706905 20:8516226-8516248 CAGGAGGACCTGGGCTCAGAGGG - Intronic
1172655238 20:36532787-36532809 CAGAAGATGGTGGGCTCCCAAGG + Intergenic
1172906919 20:38377285-38377307 CGGGAGATCATTGGCTCCCTTGG - Intergenic
1174738858 20:52992488-52992510 CAGGAGACAAGGGGCTCCTATGG - Intronic
1175024607 20:55888780-55888802 TAGGAGGTCATGGGCTCTCATGG - Intergenic
1175503426 20:59466200-59466222 CAGGAGCGCAGGGGCTCGGATGG - Intergenic
1175696864 20:61109168-61109190 CAGGAGGTCATGGGCTGTGGTGG - Intergenic
1175922905 20:62458432-62458454 CAGCAGAGCCTGGGCTGCGAGGG + Intergenic
1175992876 20:62798122-62798144 CAGGAGCCCATGGACACCGAGGG - Intronic
1177095928 21:16832715-16832737 AAGATGATCATTGGCTCCGAAGG - Intergenic
1179645425 21:42772294-42772316 CAGGAGTGCTTGGGCTCAGAGGG + Intronic
1180706359 22:17812506-17812528 CAGGAGATCATGTGCATCAAAGG - Intronic
1181022806 22:20112519-20112541 CAGGAGCTGAAGGGCTCCCAGGG - Exonic
1183634402 22:39052332-39052354 GTGGAGATCATGGGCTACAAAGG + Exonic
1184814828 22:46861613-46861635 CAGTAGAACATGGGCACCGCTGG - Intronic
1185347672 22:50317540-50317562 CAGGAGGTCCTGGGCTCAGAAGG + Intronic
1185416234 22:50711983-50712005 CAGGAGGGAAAGGGCTCCGAGGG + Intergenic
950404943 3:12798387-12798409 CAGGAGCTCAGGGTCTCCCAGGG - Intronic
950727280 3:14924525-14924547 CTGGAGGCCATGGGCTCCGCAGG + Intronic
953766978 3:45750478-45750500 AAGGAGACCATGGGCTTCCAAGG - Intergenic
954417661 3:50401584-50401606 CAGAACATCCTGGGCTCCCAAGG + Intronic
954882289 3:53844416-53844438 GAGGAGCTCATGGGGTCAGATGG - Intronic
962280568 3:134048855-134048877 CTGGAGGTGATGGCCTCCGAAGG - Intronic
965800912 3:172493136-172493158 AAGGAGATTTTGGGCTCAGATGG + Intergenic
965859091 3:173125299-173125321 GAGGAGATCATGGGCCCTGGAGG - Intronic
968266072 3:197364347-197364369 CTGCTGATCATGGGCTCTGAGGG + Intergenic
968405543 4:336874-336896 CAGGAGCTCCTGGGAACCGAGGG + Intergenic
969412406 4:7037674-7037696 CAGGAGATCAAAGGCTGAGATGG + Intergenic
970973357 4:22012534-22012556 CAGAAGATCATTGGGTCCAAAGG + Intergenic
976477581 4:85502606-85502628 AAGGAGATTTTGGGCTCAGAAGG + Intronic
977681383 4:99801979-99802001 AAGGAGATCAGGAGCTCCCAAGG - Intergenic
979949529 4:126874740-126874762 CAGGTGGGCATGGGCTCCGTTGG - Intergenic
981603679 4:146520872-146520894 CAGGAGATGATGGGCACTGGTGG - Intronic
983511064 4:168610242-168610264 CAGGAGAACAGGAGCTCTGAGGG - Intronic
985065907 4:186121582-186121604 GAGAAGATCATGGGATCCTATGG + Intronic
986651209 5:9964880-9964902 CAGGAGATGTGGGGCTCAGACGG - Intergenic
1002463393 5:179388265-179388287 CAGGATTTCATGTGCTCCCAAGG + Intergenic
1003613050 6:7630443-7630465 TAGAAGATCATGGCCTCTGAGGG + Intergenic
1004031532 6:11874714-11874736 CATGAGATCAGTAGCTCCGATGG + Intergenic
1006237077 6:32642914-32642936 CATGAGATCAATGGGTCCGAGGG - Intronic
1019527638 7:1487844-1487866 CAGGAGATCCTGGCCTTCGAGGG - Exonic
1021672793 7:23048941-23048963 AAGGAGATCATGGGCTAGTAGGG - Intergenic
1022391363 7:29947250-29947272 GAGAAGGTCATGGGCTCCCAGGG - Intronic
1026869475 7:73841823-73841845 CAGGAGGTCATGGCCCCTGATGG + Intronic
1026903142 7:74048046-74048068 CAGGACAGCTTGGGCCCCGAGGG + Intronic
1029659877 7:101952904-101952926 CAGGAGGACATGGGCTCTGTCGG + Intronic
1032057811 7:128697639-128697661 CAGGAGGTCCCGGGCTGCGACGG - Intergenic
1032078395 7:128846785-128846807 CAGGACATCTTGGCTTCCGAGGG - Exonic
1033320626 7:140336323-140336345 CAGGTGATCTTGGGCTCAGGGGG - Intronic
1034463561 7:151212097-151212119 AAGAAGATCATGAGCTCCTAAGG + Intronic
1035671242 8:1418869-1418891 CTAGAGATCATGGGTTCCCATGG + Intergenic
1035860159 8:3019816-3019838 CAGAAGATCATGGCCTCTCAGGG + Intronic
1042480619 8:69298078-69298100 CAGAAGTTCATGGGCTCAGTGGG + Intergenic
1046291913 8:112173195-112173217 CAGGAGATCATCTGCACCCAGGG + Intergenic
1049431101 8:142565431-142565453 CAGCAGCTCTTGGGCTCCCAAGG + Intergenic
1049782309 8:144434616-144434638 CAGCAGATCATGGGGGCTGAGGG + Intronic
1057348050 9:94269380-94269402 CAGGAGTGGATGGGCTCCAAGGG - Intronic
1060962674 9:127692147-127692169 CAGGAGGTCAAGGGCGGCGAGGG - Exonic
1195208157 X:102624895-102624917 CAGGGTATCATGGGCTCACAGGG + Intergenic
1199575980 X:149314278-149314300 CAGGAGACTCTTGGCTCCGAGGG + Intergenic
1199601565 X:149544264-149544286 CAGGAGATCTGGAGCTCAGAAGG + Intronic
1199648812 X:149935220-149935242 CAGGAGATCTGGAGCTCAGAAGG - Intronic
1200213972 X:154359344-154359366 CAGGACATCTTGGCCTCGGAGGG + Exonic
1201852007 Y:18495314-18495336 AAGGAGATCATGTTCTCTGAAGG - Intergenic
1201881314 Y:18825066-18825088 AAGGAGATCATGTTCTCTGAAGG + Intronic