ID: 1137594777

View in Genome Browser
Species Human (GRCh38)
Location 16:49716301-49716323
Sequence TTGGTGCTGCCTCATGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137594777_1137594789 26 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594789 16:49716350-49716372 CTGAGACACTCCATATCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 194
1137594777_1137594784 3 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594784 16:49716327-49716349 GCTCAGCCAAGCCCTTGGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 188
1137594777_1137594791 30 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594791 16:49716354-49716376 GACACTCCATATCCAAGGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1137594777_1137594788 25 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594788 16:49716349-49716371 GCTGAGACACTCCATATCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 139
1137594777_1137594782 -2 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594782 16:49716322-49716344 AACCTGCTCAGCCAAGCCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 171
1137594777_1137594790 29 Left 1137594777 16:49716301-49716323 CCCCCATCATGAGGCAGCACCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1137594790 16:49716353-49716375 AGACACTCCATATCCAAGGGCGG 0: 1
1: 0
2: 1
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137594777 Original CRISPR TTGGTGCTGCCTCATGATGG GGG (reversed) Intronic
902517969 1:17000076-17000098 CTGGTGCTGCCCCAGGAGGGTGG - Exonic
902759830 1:18573953-18573975 TTGGTGCTGGCTGTTCATGGTGG - Intergenic
902780033 1:18699007-18699029 TTGGTGTTCCATCCTGATGGGGG - Intronic
906822606 1:48945094-48945116 GTGGTGCTGCCACATTATTGAGG + Intronic
909340358 1:74524787-74524809 AAGGGGCTGCCTCATGAAGGGGG + Intronic
915068317 1:153244550-153244572 TTGGTGGTACCTGATGGTGGTGG + Intergenic
915468709 1:156113419-156113441 TTGGTGAGGCCTGAGGATGGAGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
923542143 1:234896241-234896263 GTGGAGCTGTCTCAAGATGGTGG - Intergenic
1073590952 10:104757173-104757195 GTTGTGCTGCCACATGATGTGGG - Intronic
1075529648 10:123218556-123218578 TTGTTGCAGCCTGATGAGGGTGG + Intergenic
1076330521 10:129661364-129661386 TTGGTACAGCCTTATGAGGGGGG - Intronic
1076449771 10:130548910-130548932 GTTTTGCTGCCTCCTGATGGAGG + Intergenic
1078928613 11:15896098-15896120 TTGGTGCTTCCCCAGTATGGGGG - Intergenic
1081987306 11:47315329-47315351 TAGGTGCTGGTTCATGCTGGGGG + Intronic
1083386064 11:62311257-62311279 CTGGGGCTGCCTCATGTTTGTGG - Intergenic
1084593786 11:70105338-70105360 TTGGAGCTGTCTGATGGTGGCGG + Intronic
1085929263 11:81061612-81061634 TTGTTGCTACCACATTATGGTGG - Intergenic
1091239848 11:134045032-134045054 TTAGTGCGGCCTCAAGGTGGGGG + Intergenic
1092920897 12:13230829-13230851 TTTTTGCTGGCTCACGATGGAGG + Intergenic
1093237531 12:16629635-16629657 GTGGTGTGGACTCATGATGGAGG - Intergenic
1102017740 12:109659089-109659111 TTAGTGCTACCTCATCATGCTGG + Intergenic
1102206733 12:111096133-111096155 TTGGTTCTCCCTGCTGATGGGGG - Intronic
1104227005 12:126844975-126844997 TTGCTACTGCATGATGATGGGGG + Intergenic
1105724769 13:23151868-23151890 TTGCTGCTGCCACATGAAGAAGG - Intergenic
1109262247 13:60158562-60158584 TTGGGGCTGCCTCCTCCTGGTGG + Intronic
1109297378 13:60551813-60551835 TTCCTGCTGCCTCATGAAGAAGG - Intronic
1111610303 13:90597096-90597118 TTGGATCTGCCTCTTGATTGTGG + Intergenic
1113566988 13:111325194-111325216 GAGGCGCTGCCTCAGGATGGCGG - Intronic
1114778863 14:25516114-25516136 TTGCTGCTGCCACATGAAGAAGG - Intergenic
1115707183 14:36011350-36011372 CTGGTGCTGCCTCTTGCTGAAGG + Intergenic
1118093417 14:62508920-62508942 TTGGTTCTGCCTCCTTTTGGTGG - Intergenic
1119295405 14:73528964-73528986 TGGGTGCTGCCTCATAATGCTGG - Intronic
1119299085 14:73556999-73557021 GGGGTGCTGCCTCATAATGCTGG - Intronic
1120935583 14:89892404-89892426 TGGGTGCTGCTTCCTGCTGGGGG - Intronic
1125920093 15:43520284-43520306 CTGGTGCTGCCTGGGGATGGGGG - Intronic
1126701954 15:51375923-51375945 TGGGGGCTGGCTCATTATGGTGG + Intronic
1128356490 15:66931061-66931083 GTGATGCTGTCTCCTGATGGAGG - Intergenic
1131032129 15:89195247-89195269 TTTGTGCTGCCTCTGCATGGGGG + Exonic
1136370642 16:29833983-29834005 CTGGTTCTGCCTGATGATGGTGG - Exonic
1137594777 16:49716301-49716323 TTGGTGCTGCCTCATGATGGGGG - Intronic
1139431252 16:66912116-66912138 TTGGAGCTGCCTCATAACTGAGG + Exonic
1140114668 16:72031181-72031203 TTGGTTCTGCCTTAAGCTGGTGG + Intergenic
1141289546 16:82704977-82704999 TTGCTGCTGCCTCATGAGGAAGG + Intronic
1143701742 17:8665703-8665725 TTAGTGCTGCCTGAAGACGGGGG - Intergenic
1144093627 17:11880590-11880612 TGAGTGCTGGCTCATGATGAGGG + Intronic
1146312369 17:31779132-31779154 TTTGGGCTGCCTCCTGATGAAGG - Intergenic
1148156319 17:45427030-45427052 GTGGTGCTGCTTCCTGACGGGGG - Intronic
1150982278 17:70155927-70155949 TTGGTGCTTCCTCATTAAAGTGG - Intergenic
1151117118 17:71749405-71749427 TTCTTGCTGCCTCACTATGGGGG + Intergenic
1151726127 17:75885684-75885706 TGGGTGCTTCCTGAGGATGGAGG + Intronic
1152159021 17:78655774-78655796 TTAGAGGTGGCTCATGATGGGGG - Intergenic
1152297338 17:79475743-79475765 GTGGGGTTGCCTCATGATGATGG + Intronic
1153294106 18:3529266-3529288 TTGCTGCAGCCTCACGATGGAGG - Intronic
1155021442 18:21900670-21900692 CTGGAGCTGCCTCAGGCTGGTGG - Intergenic
1157577037 18:48750421-48750443 TCTGTGCTGCCGCAAGATGGAGG + Intronic
1157784475 18:50469560-50469582 TTGGTGATGCCTCCTGGTGCTGG + Intergenic
1158204507 18:54977122-54977144 TGGCTGCTGCCTCATCAGGGTGG + Intergenic
1161238602 19:3209816-3209838 TTGGTGGTGCTTTGTGATGGTGG - Intergenic
1163726432 19:18925710-18925732 TTGCTGCTGCCTCGTCAGGGAGG + Intronic
1164981221 19:32616009-32616031 TTGGTGCTGCCTCAGGGTGATGG + Intronic
1166500522 19:43337720-43337742 TTCTTGCTGCCTCATCTTGGTGG + Intergenic
1166509601 19:43395979-43396001 TTCTTGCTGCCTCATCTTGGTGG - Intergenic
1167534635 19:50041866-50041888 TGGCTGCAGCCTCAGGATGGAGG - Intronic
1168315437 19:55482926-55482948 CTGGTGCTGCCGCAGGTTGGAGG - Exonic
925189587 2:1872042-1872064 CTGGTGCAGCCGCATGAAGGTGG + Intronic
925438903 2:3867171-3867193 TGGGTGCTGCCGAATGATTGGGG - Intergenic
925834046 2:7925680-7925702 TTGGAGCAGCCTCAGGATGGTGG + Intergenic
926287672 2:11502857-11502879 TTGTTGCTGTCTCATGGTTGAGG + Intergenic
927386017 2:22534538-22534560 TTTGTGCTGCATTATGATGTGGG - Intergenic
927515344 2:23668857-23668879 TGGGTGCTGCCTCTGGAGGGTGG - Intronic
934868772 2:97840348-97840370 AGGGTGCTGCCTCATTGTGGTGG - Intronic
936458336 2:112692673-112692695 CTGATGCTGACTCATGCTGGAGG + Intergenic
936632155 2:114215259-114215281 TTGTTGCTGTCTGTTGATGGAGG + Intergenic
937021691 2:118662870-118662892 TTAGTGTTGCCTTATGATGTAGG - Intergenic
937071534 2:119067315-119067337 TTGGGGCTGCCTCAGGATCACGG - Intergenic
940127577 2:150344094-150344116 TTAGTACTGCCTCATGATACAGG - Intergenic
942155045 2:173119579-173119601 TTTGTGCTGCCTCGTGATACTGG - Intronic
942786027 2:179703841-179703863 TTGATAATGCCTCATGATGGAGG + Intronic
947642823 2:231716452-231716474 TGGGAGCTGCTTCATGAGGGTGG + Intergenic
1169019284 20:2317029-2317051 TTAGTGCTGACTCATTTTGGGGG + Intronic
1169319074 20:4616448-4616470 TTGCTGCTGCCACATGAAGAAGG - Intergenic
1169328725 20:4699389-4699411 TGGGGGCAGCCTCATGGTGGTGG + Exonic
1169328733 20:4699413-4699435 TGGGGGCAGCCTCATGGTGGTGG + Exonic
1170849668 20:19993520-19993542 GTAGTGCTGACTCAGGATGGGGG + Intronic
1170934500 20:20797771-20797793 TTTGTGCTGCATCCTGCTGGGGG - Intergenic
1173740703 20:45399700-45399722 TTGCTGCTGCCACATGAAGAAGG + Exonic
1174673471 20:52330776-52330798 TTGGTGATGGCTCAGGATAGAGG - Intergenic
1181153994 22:20906103-20906125 TTGGTGCAGCCTCAGGATGGGGG + Intergenic
1183952019 22:41357528-41357550 TGGGGGCTGCCTGATGAGGGCGG - Exonic
1185123781 22:48991871-48991893 GAGATGGTGCCTCATGATGGTGG + Intergenic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
950394217 3:12721280-12721302 TTGGTGGTGCGGCAGGATGGTGG + Intergenic
951923818 3:27885729-27885751 TAGGAGCTGCCTCATTATTGAGG - Intergenic
953032500 3:39187684-39187706 TTGGGGGTGCCTCAGGCTGGGGG + Exonic
953864811 3:46575165-46575187 TTGTTGCTGCCTCCAGGTGGGGG - Intronic
955370037 3:58343313-58343335 TTGATGCTGCCTGATGCTAGAGG - Intronic
956533680 3:70251524-70251546 TTGCTCTGGCCTCATGATGGTGG + Intergenic
957412979 3:79864060-79864082 TTGGTGTTGCCTCATAAAAGTGG - Intergenic
965545159 3:169908420-169908442 CTGATGCTGCCTCAGGCTGGAGG - Intergenic
965660474 3:171036639-171036661 TTGCTACAGCCTCATGAGGGTGG + Intergenic
966320208 3:178694143-178694165 TTCCTGCTGCCACATGAAGGAGG - Intronic
971874449 4:32288306-32288328 TTGGTGCTGACTTAAGAAGGTGG + Intergenic
972496800 4:39641758-39641780 TTGGTGCTGGCTGTTGGTGGAGG - Intergenic
975389789 4:73802709-73802731 ATGGTGTTGCATCATGCTGGAGG - Intergenic
978096312 4:104783223-104783245 ATGGTGCTGCTTCAAGATGTTGG - Intergenic
981044146 4:140251087-140251109 TTGCTGCTGGCTGATGGTGGAGG + Intergenic
981192091 4:141876095-141876117 TGGGTGCTGCCTACTGATTGGGG - Intergenic
983216365 4:165006659-165006681 TGGGATCTGCCTCAGGATGGGGG + Intergenic
983563839 4:169129086-169129108 TTGGTGTGTCCTGATGATGGGGG - Intronic
984262766 4:177461838-177461860 TTGAGGCTGCCTAGTGATGGAGG + Intergenic
984291603 4:177802312-177802334 TACTTGGTGCCTCATGATGGGGG + Intronic
985921121 5:2975567-2975589 GTGGTGGTGCCACATGTTGGGGG - Intergenic
986968083 5:13300007-13300029 TTGCTGCTGCCACATGAAGAAGG - Intergenic
990391363 5:55324994-55325016 TTTGTTCTGCCACAAGATGGTGG + Intronic
990454867 5:55975242-55975264 TTGGTACTGCCTCGAGATGGTGG + Intronic
991456332 5:66808263-66808285 GTGCTGCTGTCTCATGAAGGAGG + Intronic
997359750 5:133287513-133287535 TGGGTGCTGGCCTATGATGGAGG + Intronic
997564019 5:134873693-134873715 TTGGCTCTGGCTCATGGTGGAGG - Intergenic
1000254521 5:159525259-159525281 CTGGGGCTGCCTGAGGATGGGGG + Intergenic
1001098355 5:168793941-168793963 TTCGAGCTGCCTCATTATGTTGG + Intronic
1007882689 6:45185175-45185197 TTGCTGCTGGGTCAGGATGGAGG - Intronic
1011175116 6:84551647-84551669 ATGGTGGTGGCTCAGGATGGTGG - Intergenic
1012500267 6:99880794-99880816 GTGGTGGTGGCTGATGATGGAGG + Intergenic
1014339551 6:120187320-120187342 TTGGTGCTGGCTCTGGCTGGAGG + Intergenic
1014436334 6:121424932-121424954 TTCATGCTGCCTTATGATGAAGG - Intergenic
1014929008 6:127310850-127310872 GTGGTGCTTCCTGATGATTGAGG - Intronic
1016327977 6:142924880-142924902 TTGATGCAGCATCATGTTGGAGG - Intronic
1016570633 6:145508082-145508104 TTGGTGCTGCCTTATGTGGCTGG - Intronic
1017708476 6:157146218-157146240 TTGTTGGTGCCACTTGATGGGGG - Intronic
1021624416 7:22578611-22578633 TTGGTGCTGGCTGATGGCGGGGG + Intronic
1024977997 7:55131518-55131540 ATGGTGCTGCTTCAGGCTGGAGG - Intronic
1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG + Intergenic
1032280445 7:130495606-130495628 TTGTTGCTCCTTAATGATGGAGG + Intronic
1034871666 7:154690631-154690653 CTCTTGCTGCCTCATGATGCGGG - Intronic
1036975850 8:13411599-13411621 TTGGTGCTGGATGTTGATGGTGG + Intronic
1037292193 8:17362816-17362838 TTGCTGCAGCCTCTTGCTGGTGG - Intronic
1041348953 8:56929717-56929739 TGGGTGCTGACTGGTGATGGAGG + Intergenic
1042130991 8:65586697-65586719 TTGGTTCTCCCTGATGCTGGTGG + Intergenic
1045243994 8:100426733-100426755 TTGGTGGTGGTTAATGATGGTGG - Intergenic
1047421436 8:124711102-124711124 GTGGTGATGCTTCATGATGATGG - Intronic
1049850913 8:144829632-144829654 TGGGTGCTGACTGATGATGCAGG - Intronic
1053575214 9:39353142-39353164 TGGCTGCTGACTCATCATGGTGG - Intergenic
1053839718 9:42181076-42181098 TGGCTGCTGACTCATCATGGTGG - Intergenic
1054096776 9:60911825-60911847 TGGCTGCTGACTCATCATGGTGG - Intergenic
1054118180 9:61187451-61187473 TGGCTGCTGACTCATCATGGTGG - Intergenic
1054589575 9:66995113-66995135 TGGCTGCTGACTCATCATGGTGG + Intergenic
1060585467 9:124782742-124782764 GAGGTGCTACCTCCTGATGGGGG - Intronic
1061885118 9:133587498-133587520 TTGGCACAGCCCCATGATGGAGG - Intergenic
1062270025 9:135704103-135704125 TTCGTGCTGCCTGGTGGTGGGGG + Intronic
1187159799 X:16753745-16753767 ATGGTGCTACCTCATGACGGAGG + Intronic
1187348134 X:18486016-18486038 TAGGTTCTGCTTCAGGATGGTGG - Intronic
1188793654 X:34436553-34436575 TTGGTTTTGCCAAATGATGGAGG + Intergenic
1190300690 X:49055275-49055297 TGGGGACTGCCTCATGTTGGGGG + Intronic
1192126401 X:68504441-68504463 CTGGTGATGACTCAGGATGGGGG - Intronic
1192308697 X:69990546-69990568 TTGTTACAGCCTCATGAAGGTGG + Intronic
1197214678 X:123856968-123856990 TTGGTGCTGGTTGTTGATGGGGG + Intergenic
1197364108 X:125543488-125543510 TTGTTGCTGCCTCAGCTTGGAGG + Intergenic