ID: 1137595050

View in Genome Browser
Species Human (GRCh38)
Location 16:49717941-49717963
Sequence CTGGACTACCCCACAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137595045_1137595050 10 Left 1137595045 16:49717908-49717930 CCACTCATGCACACATTGGCCAG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 149
1137595042_1137595050 29 Left 1137595042 16:49717889-49717911 CCTGTTCTTCATTTCCACACCAC 0: 1
1: 0
2: 3
3: 17
4: 279
Right 1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 149
1137595047_1137595050 -9 Left 1137595047 16:49717927-49717949 CCAGTACTGAACTACTGGACTAC 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 149
1137595043_1137595050 15 Left 1137595043 16:49717903-49717925 CCACACCACTCATGCACACATTG 0: 1
1: 0
2: 0
3: 33
4: 240
Right 1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137595050 Original CRISPR CTGGACTACCCCACAGAGGG AGG Intronic
901736366 1:11314758-11314780 CAGGACGAGCACACAGAGGGAGG + Intergenic
902229911 1:15021440-15021462 CTGGACTCCCCTTCAGAGGCTGG + Intronic
903241621 1:21986549-21986571 CTCAACTGCCCCACAGAGGATGG + Exonic
903245130 1:22009723-22009745 CTCAACTGCCCCACAGAGGATGG + Exonic
904287723 1:29462757-29462779 CTGGAGTTCCCTTCAGAGGGAGG - Intergenic
904310502 1:29626386-29626408 ATGGACTACTCCAAGGAGGGAGG + Intergenic
908031736 1:60007591-60007613 CTGAACTACCAGACAGAAGGGGG - Intronic
909469585 1:76012116-76012138 AAGGCCTTCCCCACAGAGGGGGG + Intergenic
915529198 1:156493757-156493779 CAGGACTTCCCCTCAGAGGAAGG - Intronic
915584408 1:156836478-156836500 CTGTCCTTCCACACAGAGGGAGG - Intronic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
920199308 1:204249742-204249764 CAGGACTAGACCTCAGAGGGAGG - Intronic
921036348 1:211382746-211382768 CCGGCCTACGCCACAGAGCGGGG - Intergenic
923103000 1:230832035-230832057 CTGGACTATAGCACAGAGGTGGG - Intergenic
923545161 1:234918547-234918569 CTGGAGGAGGCCACAGAGGGTGG + Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063459240 10:6204613-6204635 CTGGGCTACCTCACAAAGAGGGG - Intronic
1063464111 10:6232072-6232094 CTGGACTGCTCTAAAGAGGGTGG - Intronic
1066449064 10:35511540-35511562 CTGCAGAACCCCAGAGAGGGAGG + Intronic
1069950625 10:72015865-72015887 GTGGAACACCCCACAGAGAGTGG + Intergenic
1073146971 10:101287521-101287543 CTGTTCAACCCCACACAGGGCGG - Intergenic
1075349497 10:121710970-121710992 CTGGACTACAACACACAGGACGG + Intergenic
1075785494 10:125046766-125046788 CTGGGCTGCCACACAGAAGGAGG + Intronic
1076294545 10:129374408-129374430 CTTGACTACCCCACTCAGGATGG - Intergenic
1076849020 10:133083930-133083952 CAGGACGTCCCCTCAGAGGGAGG + Intronic
1076921759 10:133458004-133458026 CTGCGGTACCCCAGAGAGGGTGG + Intergenic
1078377112 11:10805532-10805554 CTTGAATACCCCACAGGTGGAGG - Intronic
1078458715 11:11496606-11496628 AAGGGCTACCACACAGAGGGTGG + Intronic
1080376475 11:31718680-31718702 CTGGACTTCCTCACACATGGTGG + Intronic
1084656776 11:70524223-70524245 CTGCACTGCCCCCCAGGGGGTGG - Intronic
1089183555 11:116599225-116599247 CTGGAGCTCCCCACTGAGGGAGG - Intergenic
1091839706 12:3612043-3612065 CTGGACTACCACAGAGAGGGAGG + Intronic
1092003761 12:5051851-5051873 CTGGACCACTTCACTGAGGGAGG + Intergenic
1103238442 12:119394432-119394454 CTGGACTACCACATGGTGGGTGG - Intronic
1104207876 12:126657478-126657500 CTCCACTACTCCACAGAGGATGG + Intergenic
1112914160 13:104525518-104525540 CTGGAGCACCCCAAAGGGGGAGG - Intergenic
1113868324 13:113543319-113543341 GTGGAGTCACCCACAGAGGGAGG - Intronic
1119257077 14:73208087-73208109 CTGCAGAACCCCAAAGAGGGGGG + Intronic
1121282245 14:92707347-92707369 CTGGTCTAACACACAGTGGGTGG - Intronic
1121859215 14:97300577-97300599 CTGGAGGATCCCACAGAGGCAGG - Intergenic
1123467791 15:20529221-20529243 CTGGTCCCACCCACAGAGGGAGG + Intergenic
1123650321 15:22471821-22471843 CTGGTCCCACCCACAGAGGGAGG - Intergenic
1123740729 15:23280663-23280685 CTGGTCCCACCCACAGAGGGAGG - Intergenic
1123746269 15:23321895-23321917 CTGGTCCCACCCACAGAGGGAGG + Intergenic
1124278536 15:28345212-28345234 CTGGTCCCACCCACAGAGGGAGG + Intergenic
1124304164 15:28566396-28566418 CTGGTCCCACCCACAGAGGGAGG - Intergenic
1124533041 15:30522864-30522886 CTGGTCCCACCCACAGAGGGAGG - Intergenic
1124765616 15:32484780-32484802 CTGGTCCCACCCACAGAGGGAGG + Intergenic
1128343588 15:66839819-66839841 CTGGACCACCCCACAGTTTGAGG - Intergenic
1133837503 16:9379852-9379874 CTGGACTAAACCACAGAGAGAGG + Intergenic
1134490163 16:14690439-14690461 CTTGACTACCCCAGAGTGTGAGG + Intronic
1134495544 16:14729556-14729578 CTTGACTACCCCAGAGTGTGAGG + Intronic
1134501095 16:14769869-14769891 CTTGACTACCCCAGAGTGTGAGG + Intronic
1134579486 16:15359163-15359185 CTTGACTACCCCAGAGTGTGAGG - Intergenic
1134723097 16:16398388-16398410 CTTGACTACCCCAGAGTGTGAGG + Intergenic
1134944331 16:18313482-18313504 CTTGACTACCCCAGAGTGTGAGG - Intergenic
1136165753 16:28451828-28451850 CTTGACTACCCCAGAGTGTGAGG - Intergenic
1136197219 16:28663181-28663203 CTTGACTACCCCAGAGTGTGAGG + Intergenic
1136213558 16:28777328-28777350 CTTGACTACCCCAGAGTGTGAGG + Intergenic
1136258291 16:29057252-29057274 CTTGACTACCCCAGAGTGTGAGG + Intergenic
1136320204 16:29479064-29479086 CTTGACTACCCCAGAGTGTGAGG - Intergenic
1136434775 16:30218405-30218427 CTTGACTACCCCAGAGTGTGAGG - Intergenic
1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG + Intronic
1138008480 16:53357907-53357929 CTGGTCCCACCCACAGAGGGAGG + Intergenic
1138074756 16:54031113-54031135 GTGGACAACCCCACAGAGCCAGG + Intronic
1138623943 16:58234266-58234288 CTGGACTCACTCAGAGAGGGCGG + Intronic
1139917821 16:70439082-70439104 CGGGACTAGCCCACGGCGGGCGG - Intronic
1140430557 16:74899260-74899282 CTGGTCTAGTTCACAGAGGGAGG - Intronic
1141035533 16:80622339-80622361 CTGGGCAACCCCACAAGGGGTGG - Intronic
1142566453 17:843396-843418 CTGGCCGACACCACAGACGGAGG + Intronic
1142780936 17:2180651-2180673 CTGGAATTCCCCTCAGAGAGGGG + Intronic
1143606987 17:7992764-7992786 CTTGACCACCCCACAGAGCTGGG - Intergenic
1144573929 17:16417171-16417193 CTGGGCTCCCACACAGTGGGTGG + Intronic
1144640719 17:16935169-16935191 CAGGACTGCCCCACCTAGGGAGG - Intronic
1148850819 17:50554233-50554255 CTGGTCTACAGCACATAGGGAGG - Exonic
1151161857 17:72172646-72172668 TTGGACCACCCCAAACAGGGAGG + Intergenic
1151656778 17:75499839-75499861 GGAGACTCCCCCACAGAGGGAGG - Exonic
1152214742 17:79025401-79025423 CAGGAACACCTCACAGAGGGGGG - Intronic
1155500535 18:26482805-26482827 ATGGACCAACCCAGAGAGGGTGG + Intronic
1155540374 18:26863360-26863382 CTGGAGCACCTCTCAGAGGGCGG + Intronic
1158024127 18:52875835-52875857 CTGGCCTGCCACACAGAGGCTGG + Intronic
1158726593 18:59978864-59978886 CTGGACTAGCCCAGACAAGGAGG + Intergenic
1160033054 18:75278941-75278963 CTCAACGACCCCACAGACGGAGG - Intronic
1160377352 18:78423133-78423155 CTGGACTACCATATACAGGGTGG + Intergenic
1161295752 19:3519415-3519437 CTGATCTACCCCAAGGAGGGCGG + Intronic
1161400147 19:4063706-4063728 CTGGGCCACCACACAGTGGGAGG + Intronic
1162019797 19:7863169-7863191 CTGGCGCACCCCGCAGAGGGAGG + Exonic
1163218138 19:15895631-15895653 CAGGTCAACCCCACAGAGGAGGG - Exonic
1163368619 19:16889705-16889727 CAGGACCAGCCCATAGAGGGCGG - Exonic
1164417545 19:28059292-28059314 CTGGGCTGCCCCAATGAGGGTGG + Intergenic
1165329818 19:35135273-35135295 CTGGACAGCCCCACAGGAGGGGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168402325 19:56092686-56092708 CTGGAATATCCCACAGACGCAGG + Intronic
1168468326 19:56621564-56621586 CTGGACGACCCCACAGAAAAGGG + Exonic
925140558 2:1547219-1547241 ATGGACTCCCACACACAGGGTGG + Intergenic
927168832 2:20351238-20351260 CAGGAGTACCCCACGGTGGGCGG - Intronic
927906545 2:26862734-26862756 CTGGACCTCCACACAGAGGCTGG - Intronic
928409542 2:31043984-31044006 CTTGACAACAGCACAGAGGGCGG - Intronic
928436675 2:31259018-31259040 CTGCCCTGCCTCACAGAGGGAGG - Intronic
929948210 2:46386405-46386427 CGGCATTACCCCACACAGGGTGG + Exonic
935571117 2:104660987-104661009 CTGGTCTACCCCACTGGGGCTGG + Intergenic
936428220 2:112436882-112436904 CAGGACTACCCCACAGCCCGGGG - Intergenic
937006530 2:118521511-118521533 TTGGACTCCTCCACAGATGGGGG - Intergenic
939784139 2:146487731-146487753 CTGGACCATGACACAGAGGGTGG + Intergenic
940336157 2:152529738-152529760 CTGGCCTACCCTACAGAGATTGG + Intronic
944526787 2:200627602-200627624 TTGGCCTACCCCAGAGACGGAGG - Intronic
946488184 2:220121109-220121131 CTGCCCTTCCCCACAGAGGCTGG - Intergenic
946878714 2:224156714-224156736 CTTGACAACCCCAAAGAGGGAGG - Intergenic
948133085 2:235615220-235615242 CTGGACAACCCAACCGAGGGTGG - Intronic
1168970277 20:1926264-1926286 CTGGAGAGCCCCACACAGGGAGG + Intronic
1173663140 20:44747702-44747724 GCGGACTAGACCACAGAGGGTGG - Intronic
1175743848 20:61439731-61439753 CTGGACTGCCCATCAGAGGGAGG - Intronic
1179380502 21:40894797-40894819 CTGAGCTACTCCACAGAAGGTGG - Intergenic
1180228503 21:46412610-46412632 CAGGACGACCCCACAGAGCAAGG - Intronic
1181028101 22:20137231-20137253 CTGGACTCCCCCACACCAGGCGG - Intronic
1181381530 22:22508503-22508525 CTGCACTCCCCCACAGAAAGCGG + Intronic
953608057 3:44424663-44424685 GTGGACTGCCCCACATCGGGTGG - Intergenic
959074430 3:101735352-101735374 CAGGACAACCCCAGAGAGAGAGG - Intronic
964882695 3:161441980-161442002 CTGGACTTTCCCACAGAGTGTGG - Intergenic
965631057 3:170733256-170733278 CTGGACTACCTCAGAGAAAGTGG - Intronic
966665247 3:182464519-182464541 CTGGACTAGTCCAGAGAGAGTGG - Intergenic
968742658 4:2339344-2339366 CTGGAAAATTCCACAGAGGGAGG - Intronic
970116800 4:12706810-12706832 CTGTACTACCCCAGGGAGAGAGG - Intergenic
979115887 4:116821798-116821820 CTAGAATACCACACAGAGGTAGG + Intergenic
986876026 5:12110988-12111010 CTGGACTTCCCCAGAGAGGCAGG + Intergenic
991637180 5:68717899-68717921 TTGGACTTACCCACAAAGGGAGG - Intergenic
997305161 5:132830934-132830956 CTGGACCTCCCCACCGAGGGAGG - Intergenic
998045497 5:138983561-138983583 CTGGAGTGCCACACAAAGGGAGG + Intronic
1002211417 5:177601729-177601751 CTGGACTGCCCCTCAGAGCCAGG + Intronic
1011535255 6:88369804-88369826 CTGGCCTGAACCACAGAGGGAGG + Intergenic
1011674484 6:89718867-89718889 CTGGTCTTGCCCACAGAGGCTGG + Exonic
1011686334 6:89826951-89826973 CTGCACTTCCTCACAGAGTGAGG + Intergenic
1019402820 7:866327-866349 CTGGAACACCCAAAAGAGGGAGG - Intronic
1019737164 7:2656290-2656312 CTGGACCGCCCCCCAGAGGCAGG - Intronic
1026679318 7:72453285-72453307 CAGGGCTACCCCACAGTGTGTGG + Intergenic
1026991555 7:74588876-74588898 CCAGACTTGCCCACAGAGGGTGG + Intronic
1030265842 7:107621054-107621076 CTGAACCAGCCCACAGAGGTAGG - Exonic
1033245402 7:139713243-139713265 CTGATCTCACCCACAGAGGGGGG + Intronic
1033449935 7:141453636-141453658 CTTGACTCCCCAGCAGAGGGAGG - Intronic
1034331626 7:150288116-150288138 CAGGGCTACCCCACAGAGCAGGG + Intronic
1034352912 7:150428932-150428954 CTGGTCTACTCCACAGGAGGTGG - Intergenic
1035749380 8:1985141-1985163 CTGGAGACCCCCAAAGAGGGTGG + Intronic
1040063132 8:43121669-43121691 ATGGACCACCACACAGTGGGTGG - Intronic
1047995357 8:130329952-130329974 CTGTCCTGCCCCACAAAGGGAGG + Intronic
1048472466 8:134715451-134715473 CTGGATTCCCCCACAGAAAGGGG - Intergenic
1048666406 8:136666243-136666265 CTGGCTTCCCCCACAGAGAGTGG + Intergenic
1053337027 9:37284098-37284120 CTGGTCTACCACACAGTCGGGGG - Intronic
1054172705 9:61855977-61855999 CTGGCCTACCCCACAGCAGATGG - Intergenic
1054447554 9:65384980-65385002 CTGGCCTACCCCACAGCAGATGG - Intergenic
1054664835 9:67724824-67724846 CTGGCCTACCCCACAGCAGATGG + Intergenic
1057895985 9:98908904-98908926 CAGGTCTGCCCCACACAGGGTGG - Intergenic
1057966954 9:99513570-99513592 CTGCACTATCCCCCAGAGGTAGG + Intergenic
1060885380 9:127148676-127148698 CTGTACTACCCCAGAGAGTAGGG + Intronic
1062025354 9:134337796-134337818 CTGGGCGACCCCCCAGAGGGAGG - Intronic
1062680250 9:137775332-137775354 CTGGACCACCCGACAGCAGGTGG - Intronic
1186582006 X:10829978-10830000 CTTGACAACCCCAAAGAGAGTGG + Intronic
1190263440 X:48814048-48814070 CTAGAGTACCCCACAGAGTCAGG + Intronic
1197146206 X:123175465-123175487 CTGGGGTAACCCACTGAGGGAGG + Intergenic
1200360528 X:155601011-155601033 CTGGCCTCCCCCACAGGGTGTGG - Intronic
1202110167 Y:21409399-21409421 CAGTACTTCCCCAGAGAGGGAGG + Intergenic