ID: 1137596519

View in Genome Browser
Species Human (GRCh38)
Location 16:49727618-49727640
Sequence TTGCAAGGGCTGACCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137596513_1137596519 -5 Left 1137596513 16:49727600-49727622 CCCCAGAAGGCCAATGGCTTGCA 0: 1
1: 0
2: 1
3: 13
4: 205
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596509_1137596519 13 Left 1137596509 16:49727582-49727604 CCCAACACACAGCACTCTCCCCA 0: 1
1: 1
2: 3
3: 41
4: 413
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596510_1137596519 12 Left 1137596510 16:49727583-49727605 CCAACACACAGCACTCTCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 406
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596505_1137596519 22 Left 1137596505 16:49727573-49727595 CCCCGACACCCCAACACACAGCA 0: 1
1: 0
2: 3
3: 39
4: 406
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596504_1137596519 23 Left 1137596504 16:49727572-49727594 CCCCCGACACCCCAACACACAGC 0: 1
1: 0
2: 0
3: 60
4: 532
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596507_1137596519 20 Left 1137596507 16:49727575-49727597 CCGACACCCCAACACACAGCACT 0: 1
1: 0
2: 10
3: 41
4: 479
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596514_1137596519 -6 Left 1137596514 16:49727601-49727623 CCCAGAAGGCCAATGGCTTGCAA 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596506_1137596519 21 Left 1137596506 16:49727574-49727596 CCCGACACCCCAACACACAGCAC 0: 1
1: 0
2: 7
3: 51
4: 408
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596508_1137596519 14 Left 1137596508 16:49727581-49727603 CCCCAACACACAGCACTCTCCCC 0: 1
1: 0
2: 6
3: 56
4: 488
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168
1137596515_1137596519 -7 Left 1137596515 16:49727602-49727624 CCAGAAGGCCAATGGCTTGCAAG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137596519 Original CRISPR TTGCAAGGGCTGACCCTGCC AGG Intronic
900130778 1:1086279-1086301 TTACAGGGGCTGACCCTGGCCGG + Intronic
901415191 1:9111535-9111557 TTGCGAAGGCTGACATTGCCGGG - Intronic
902404403 1:16174992-16175014 AGGCAGGGGCTGAGCCTGCCAGG + Intergenic
903584566 1:24401768-24401790 CTGCAACCGCTGCCCCTGCCTGG + Intronic
903692775 1:25185984-25186006 GTGCCAGGGCAGACCCTGCGTGG + Intergenic
903694281 1:25195866-25195888 TTTCAAGGTGTGATCCTGCCCGG - Intergenic
905283705 1:36865632-36865654 TTGCAAGGGCTATGCCTCCCTGG + Intronic
905361450 1:37423549-37423571 CTGCAAGGGCTGGCCCTGAGAGG + Intergenic
905627562 1:39498765-39498787 GTGCATGGGCTGGGCCTGCCTGG - Intronic
905668862 1:39778343-39778365 GTGCATGGGCTGGGCCTGCCTGG + Intronic
909559483 1:76993656-76993678 TTGCAAAGCCCGACTCTGCCAGG + Intronic
913403377 1:118461565-118461587 GTGCAAGCACTGACCCTGGCAGG + Intergenic
916273628 1:162970058-162970080 TTTCATTTGCTGACCCTGCCAGG - Intergenic
917962256 1:180154682-180154704 TTGCAGGGGCTGGCCCTGGCCGG - Intergenic
920230547 1:204466984-204467006 TTGCAGGGGCTCAGCCTGCTGGG - Intronic
920966600 1:210706261-210706283 TTGCAGGGGTGGACCGTGCCTGG + Intronic
922535200 1:226374615-226374637 CTGCATGGGCTGACCCACCCTGG + Intronic
1062906119 10:1180512-1180534 TGGCAGGGCCTGACCCAGCCAGG - Exonic
1070918789 10:80171193-80171215 TTGGGAGGGCAGAGCCTGCCTGG - Intronic
1074307949 10:112296470-112296492 TTCCACTGGCTGACCATGCCTGG + Intronic
1074774533 10:116757327-116757349 TCGCATGGGCTGACCCCTCCAGG + Intergenic
1076363332 10:129905565-129905587 CTCCAAGGACTGACCCTACCTGG + Intronic
1078874657 11:15380833-15380855 GTGGAAGGGCTGAGACTGCCAGG + Intergenic
1079380404 11:19933098-19933120 TGGCCATGGCTGACCCTCCCTGG + Intronic
1081546911 11:44078093-44078115 TTGAAAGGGAAGACCCTCCCTGG - Intronic
1081551702 11:44119533-44119555 TTGCATAGGCTGTCTCTGCCTGG + Intronic
1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG + Intergenic
1081631639 11:44693669-44693691 TTGTAAGGGCTGCTCCTGCCTGG - Intergenic
1083331850 11:61902424-61902446 TTGCAAAGGCTGACTCACCCTGG + Exonic
1084945200 11:72634520-72634542 TTCCAAGGGCTTCCGCTGCCTGG - Intronic
1085279228 11:75319449-75319471 TTGCACAGGCTGCTCCTGCCTGG + Intronic
1086512492 11:87574395-87574417 TTACAAGAGCTGAGCCTACCTGG + Intergenic
1089126138 11:116177815-116177837 TTTGAAGGGCTGGCCCTCCCTGG + Intergenic
1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG + Intergenic
1090245697 11:125214562-125214584 TTGCCTGGGCTGGCCCTGCCTGG + Intronic
1090934234 11:131327547-131327569 TTGCACGGGCTGCCTCTGCCTGG + Intergenic
1094157401 12:27351424-27351446 TTGCATGGACTGTCCCTCCCAGG + Intronic
1097119343 12:56719559-56719581 TGGAAAGTGCTGACCCTGCCGGG - Exonic
1097779291 12:63685069-63685091 TTGTAAAGGCTGACCCTGTAAGG + Intergenic
1101819553 12:108173337-108173359 TTGCAAGAGCTCACCATGCCTGG - Intronic
1102002128 12:109563842-109563864 TGGGAAGGGCTGACCCTGCGGGG + Intronic
1102458937 12:113088090-113088112 GGGCCAGGGCTGACCCTGCCAGG - Intronic
1103142438 12:118560420-118560442 TTGCAAGGTCTGACAATGCTAGG - Intergenic
1105638097 13:22235718-22235740 TTGTAAGGGCTGACTCTGTGGGG + Intergenic
1105840700 13:24251662-24251684 TTGCAAGAGCTGCCACTTCCTGG + Intronic
1114255357 14:20996926-20996948 CTGCCAGGGCTGAAGCTGCCTGG + Exonic
1114652510 14:24294879-24294901 GTGCATGAGCTGACGCTGCCTGG + Intronic
1119693655 14:76695823-76695845 TGTCAAGGGCTGACCCTGTGTGG - Intergenic
1121532910 14:94671109-94671131 CTGCACGTGCTGGCCCTGCCTGG - Intergenic
1122365297 14:101191591-101191613 CTGGAAGGGCTGCCCCTCCCTGG + Intergenic
1122696420 14:103555209-103555231 TTGCAAAGGCTGCCCCTGTTTGG + Intergenic
1122887316 14:104715858-104715880 TCGCAAGGGCAGATGCTGCCAGG + Intronic
1122946071 14:105010302-105010324 GTGCATGGGCTGACCCTGATGGG + Exonic
1125713707 15:41806744-41806766 GAGCAAGGGCTCACCCTGCTGGG + Intronic
1127862907 15:63009323-63009345 TTGCACAGGAAGACCCTGCCAGG + Intergenic
1128537592 15:68502631-68502653 TTGCAATGTGAGACCCTGCCGGG - Intergenic
1128913559 15:71539014-71539036 TTACAAGTGCTGATCCAGCCAGG + Intronic
1129660751 15:77551518-77551540 AGGCAGGGGCTGCCCCTGCCTGG + Intergenic
1131425714 15:92344036-92344058 TTGGCACGGCTGCCCCTGCCTGG + Intergenic
1133280619 16:4663016-4663038 TTGCCTGGGCTGGGCCTGCCAGG + Intronic
1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG + Intronic
1140818119 16:78639294-78639316 TTGTAAGGACTGACCCAGCTTGG - Intronic
1142396560 16:89835271-89835293 TTGCAAGAGCTGCCCAAGCCAGG - Intronic
1142704210 17:1684290-1684312 TTGCAAGCGCTGATCCAGCGGGG - Intronic
1142766132 17:2065271-2065293 ATGCATGCGCTGGCCCTGCCTGG + Intronic
1143999110 17:11036224-11036246 ATGCAGGAGCTGACCCTTCCAGG + Intergenic
1145996841 17:29109800-29109822 TTTCCAGAGCTGGCCCTGCCCGG - Intronic
1146682807 17:34820764-34820786 TTGAAAGGTCTGACCCTCCTAGG + Intergenic
1146815664 17:35940019-35940041 TCCCAAGGGCATACCCTGCCTGG + Intronic
1147214974 17:38893755-38893777 TTGGAAGGGCTGAGCCGGCCAGG + Intronic
1147471553 17:40666798-40666820 TTGCCAGGACTGACCCTCCAGGG - Intergenic
1148982202 17:51587249-51587271 TTGCAATGGCAGAGCCTGCCTGG + Intergenic
1149656075 17:58310216-58310238 TGGCTGGGGCTGACCCTGCCTGG - Intronic
1152747518 17:82048291-82048313 TTGCAAGGGCTCAGCCTGGCAGG - Exonic
1203165018 17_GL000205v2_random:86218-86240 TGACAAGGGCTGAGCCTTCCTGG - Intergenic
1161044353 19:2127106-2127128 CTGGAAGGGCTGGCACTGCCAGG - Intronic
1161235603 19:3196575-3196597 TTGCACCGGCTGCCCCTCCCAGG + Intronic
1162497614 19:11032150-11032172 TGGGGAGGGCTGGCCCTGCCAGG + Intronic
1162945902 19:14043333-14043355 TTGCATCTGCTGCCCCTGCCCGG - Intronic
1163115133 19:15184727-15184749 TTCCAAGGGCTGACCCACACAGG + Intronic
1164674650 19:30093186-30093208 TTACAGGGGCTGAGCATGCCAGG + Intergenic
1165806387 19:38583620-38583642 TGGGAAGGGCTGGCCCTGCCTGG + Intronic
1165899565 19:39162776-39162798 TACCAAGGGCTGACTCTGCTGGG - Intronic
1166126771 19:40719271-40719293 GTGCAGGGGCTGACCCTCCTGGG + Intronic
1166198261 19:41220353-41220375 GGGCAGGGGCTGGCCCTGCCAGG + Intronic
1166957065 19:46471635-46471657 TTGCTAGGGCTGAGCCCGGCCGG + Intergenic
1167002798 19:46755929-46755951 TTGCCACGGCCAACCCTGCCAGG + Exonic
1167007305 19:46784444-46784466 TAGCAAGGGCTCCCCCTGGCTGG + Intronic
1168566338 19:57427389-57427411 TTGCACTTTCTGACCCTGCCTGG + Intronic
925102830 2:1263607-1263629 TTGCCAGAGCTGACCCTGCCAGG + Intronic
926574768 2:14567757-14567779 TCTGAAGGGCTGACCCTGGCAGG - Intergenic
926724421 2:15986460-15986482 TTCCCAGGGCTGGCCCTGACAGG - Intergenic
927915448 2:26933169-26933191 GTGCCAGGGCTGACTTTGCCAGG + Intronic
928635184 2:33238470-33238492 TTGCCAGGGCTGAAAATGCCAGG - Intronic
929000731 2:37344909-37344931 TAGGTAGGGCTGACCCGGCCAGG - Intronic
929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG + Intergenic
931776617 2:65546559-65546581 TTGCTCGGGCTGACCATGCCTGG + Intergenic
932447042 2:71787484-71787506 TTGTCAGGGCTCAGCCTGCCAGG - Intergenic
934196662 2:89842641-89842663 CTGCAAGTGTAGACCCTGCCTGG - Intergenic
948265294 2:236631680-236631702 GTGCAAGGGCAGGGCCTGCCTGG + Intergenic
949075702 2:242056110-242056132 TTGCAAGCGCTAACACCGCCTGG + Intergenic
1169360901 20:4948095-4948117 TTGCCAGAGCTGCCCCTGCTGGG + Intronic
1172123378 20:32611336-32611358 GTGGAAGGGCTGGCCCTCCCGGG - Intergenic
1172464050 20:35142271-35142293 TTTTAAGGACTGACCATGCCAGG - Intronic
1172653900 20:36525311-36525333 TTAGGAGGGCTGGCCCTGCCAGG + Intronic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1173583861 20:44166931-44166953 TGGCAGGGGCGGCCCCTGCCAGG - Intronic
1176406732 21:6372873-6372895 TGACAAGGGCTGAGCCTTCCTGG + Intergenic
1178133155 21:29596248-29596270 TAACAAGGACTGATCCTGCCTGG + Intronic
1180065559 21:45410420-45410442 GGTCAAGGGCTGACCCTGCGGGG + Intronic
1180137870 21:45872727-45872749 TGGCAAGGGCTGTCTGTGCCTGG + Intronic
1180903560 22:19392545-19392567 GTCCTAGGGCTGGCCCTGCCTGG - Intronic
1181138548 22:20786695-20786717 GTGCAACGGCTGCCCCTGACAGG + Intronic
1181981422 22:26769481-26769503 AGGCAAGGCCTGACCCTCCCAGG + Intergenic
1182070306 22:27458763-27458785 TGGGAAGGGCTGAGCCTGCAGGG + Intergenic
1182285333 22:29243677-29243699 CTGATAGGGCTGGCCCTGCCCGG - Intronic
1183231660 22:36586141-36586163 TTCCAAGGGCCCTCCCTGCCAGG + Intronic
1183453226 22:37907573-37907595 TTGCCAGGGCTCCCCCAGCCTGG + Intronic
1184245101 22:43231739-43231761 TGGCAGGGGCTCACCCTGGCAGG + Exonic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
950490314 3:13300673-13300695 TTGCACGAGGTGACCCTGCAGGG - Intergenic
950541986 3:13618317-13618339 TGGGAAGGGCTGATCTTGCCAGG + Intronic
950660908 3:14466567-14466589 GTCCGAGGGCTGACGCTGCCGGG + Exonic
952867421 3:37863170-37863192 TTACAAGGCCTGGCCCTTCCAGG + Intronic
953232848 3:41079916-41079938 CTACAAGTGCTGACCCTTCCTGG - Intergenic
953242110 3:41158879-41158901 TGGCAAGTGCTGACTCTGCTCGG - Intergenic
954106441 3:48412184-48412206 TTGGAGGGCCTGACCCTCCCTGG + Intronic
955089215 3:55732759-55732781 CTGCAAGAGCTGACCCTATCAGG + Intronic
956170376 3:66429028-66429050 TTGGAGAGGTTGACCCTGCCTGG - Intronic
956379740 3:68653161-68653183 TCTCTCGGGCTGACCCTGCCTGG - Intergenic
971349550 4:25843822-25843844 TTGCCAGGCCAGACCCGGCCAGG - Intronic
979178196 4:117691814-117691836 TGGAAAGGGCCGACCCTTCCTGG + Intergenic
984724932 4:183011720-183011742 CTGCAGGGGCTGAGCCTGCAGGG + Intergenic
985677136 5:1238001-1238023 ATCAGAGGGCTGACCCTGCCAGG + Exonic
985878520 5:2619362-2619384 TTGAAGAGGCTGCCCCTGCCAGG + Intergenic
986066725 5:4241161-4241183 TTGCAGGCTCTGACCCTGCAGGG - Intergenic
986372549 5:7094136-7094158 TTACACTGGCTGACCCTGCAAGG + Intergenic
989753129 5:44919673-44919695 ATGGAAGAGCTGACCATGCCCGG + Intergenic
990714554 5:58622361-58622383 CTGCAGGGACTGACCCTCCCAGG - Intronic
991772162 5:70050458-70050480 TTCCAAGGCCTGAACCTTCCAGG - Intronic
991851455 5:70925876-70925898 TTCCAAGGCCTGAACCTTCCAGG - Intronic
995494835 5:112730645-112730667 TTGCTAGGGCTGCTCCTGCAAGG - Intronic
997851364 5:137335708-137335730 GTGCAAGGCCTGACCCTTTCTGG - Intronic
998153351 5:139769722-139769744 GTGCAATGACTGACCCAGCCTGG - Intergenic
1000934702 5:167293651-167293673 TTGCAAGCGTTGACCTTTCCTGG - Intronic
1002716594 5:181231876-181231898 TTGCCAGGGATGGCCCTTCCTGG - Intronic
1007600313 6:43076968-43076990 TTACCTGGGCCGACCCTGCCGGG - Exonic
1009635502 6:66259748-66259770 TTTGAGGGGTTGACCCTGCCAGG + Intergenic
1010762125 6:79735431-79735453 TTGCATAGGCTGACCCCTCCCGG + Intergenic
1013705907 6:112833612-112833634 TTGTCAGGACTGGCCCTGCCTGG + Intergenic
1015513241 6:134060134-134060156 TTGCATGGGCTGATCCCTCCAGG + Intergenic
1016038945 6:139411962-139411984 TTGCAGGGGCTGGCCGTGGCAGG + Intergenic
1016892036 6:149016403-149016425 TTCCATTTGCTGACCCTGCCAGG - Intronic
1018030636 6:159838446-159838468 TTGCATGCACTGACTCTGCCTGG - Intergenic
1019359471 7:597399-597421 GTGCAAAGGCAGACTCTGCCTGG + Intronic
1019430491 7:996786-996808 TGGCAGTGACTGACCCTGCCAGG - Intergenic
1020113639 7:5462495-5462517 CTGCAACGCCTGACCCAGCCCGG - Intronic
1021131339 7:16916215-16916237 TTGCAAGTGATCACCCAGCCTGG + Intergenic
1021898171 7:25257112-25257134 TTCCCAGAGCTGGCCCTGCCTGG - Intergenic
1022938215 7:35202756-35202778 TTGTAAAGGCTGACCCTGTAAGG + Exonic
1025995349 7:66524136-66524158 TTGCAGGGGCTGTCCCTGCAGGG + Intergenic
1026654369 7:72244112-72244134 ATGCATGGGCTGACCCTGCAAGG + Intronic
1026986983 7:74560955-74560977 TTGCAGGGGCTGTCCCTGCAGGG + Intronic
1026986995 7:74560995-74561017 TTGCAGGGGCTGTCCCTGCGGGG + Intronic
1032511661 7:132477420-132477442 TTGGAAGGGCAGCCCCTGTCTGG - Intronic
1037521858 8:19687815-19687837 TTTCAATGGCTGACACTTCCAGG + Intronic
1039562421 8:38523324-38523346 TGGGAAGGGCTGACCCACCCTGG + Intronic
1042294844 8:67207530-67207552 TGACAAGGTCTGACACTGCCAGG + Intronic
1044377295 8:91491190-91491212 TTAAAAGGGCTGTCCCTGGCTGG - Intergenic
1047895130 8:129358184-129358206 TTGCATGGCTTTACCCTGCCTGG + Intergenic
1049072217 8:140364990-140365012 TTGCTAGGGCAGGCCCTCCCTGG - Intronic
1049072230 8:140365034-140365056 TTGCAAGGCCTGTCCCTCCCTGG - Intronic
1052994873 9:34546607-34546629 TAGCAAGGGCAGCCCCTGCCTGG - Intergenic
1053427927 9:38023202-38023224 TTGCCTGGACTGTCCCTGCCTGG - Intronic
1057698682 9:97347279-97347301 CTGGCAGGGCTGACCCTGGCTGG + Intronic
1060487953 9:124061417-124061439 CGGCAAGGGAAGACCCTGCCCGG - Intergenic
1061369003 9:130187443-130187465 TGGCCAGGGCTGCCTCTGCCTGG + Intronic
1062071643 9:134558494-134558516 TGGCATGTGCTGTCCCTGCCAGG + Intergenic
1062283693 9:135763524-135763546 TTGGCAGGGCTGACCCTATCAGG + Intronic
1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062665123 9:137666478-137666500 TGGGAAGGGATGACACTGCCAGG + Intronic
1062711139 9:137975794-137975816 TTCCCAGGGCTGAGCCTTCCAGG - Intronic
1185536049 X:862364-862386 TTCCGGGGTCTGACCCTGCCTGG - Intergenic
1186425782 X:9464216-9464238 TTGCAATGGCTTACACGGCCTGG - Intronic
1187076573 X:15941325-15941347 TAGCAGGGGCTGACTTTGCCTGG + Intergenic
1189364294 X:40376479-40376501 TAGGAAGGGCTAACCTTGCCTGG + Intergenic
1195727473 X:107933345-107933367 TGGCAGGGGCTTAGCCTGCCAGG - Intergenic
1198394583 X:136208804-136208826 TTGCAAAGGCTAACCTGGCCTGG - Intronic
1199942515 X:152639416-152639438 TTGCAGGGGCTGACGTTCCCTGG + Intronic
1201505189 Y:14690951-14690973 TGGCATGGGCTGACGCTGTCAGG + Intronic