ID: 1137597274

View in Genome Browser
Species Human (GRCh38)
Location 16:49733175-49733197
Sequence AAACGAGGAATTTCGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137597274_1137597279 18 Left 1137597274 16:49733175-49733197 CCCGTCTCCGAAATTCCTCGTTT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1137597279 16:49733216-49733238 AAAAAAAATGTTCTGTAGAAAGG 0: 1
1: 0
2: 6
3: 110
4: 1039
1137597274_1137597280 19 Left 1137597274 16:49733175-49733197 CCCGTCTCCGAAATTCCTCGTTT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1137597280 16:49733217-49733239 AAAAAAATGTTCTGTAGAAAGGG 0: 1
1: 1
2: 29
3: 308
4: 1908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137597274 Original CRISPR AAACGAGGAATTTCGGAGAC GGG (reversed) Intronic
903400244 1:23039191-23039213 AAATGGGAAATTTGGGAGACTGG - Intronic
906517890 1:46450325-46450347 AAACAAGGAAATTCTAAGACAGG + Intergenic
908153742 1:61330725-61330747 AAATGAGGAATTTCAAAGATTGG + Intronic
908661452 1:66440095-66440117 AATTGAGGAACTTCAGAGACTGG - Intergenic
910450066 1:87335278-87335300 AGAGGAGGAAGTTCGGAGACCGG + Intronic
911178326 1:94839713-94839735 ATACTAGGACTTTCAGAGACAGG + Intronic
913678093 1:121161336-121161358 AAAAGATGAATTTGGGAGAATGG + Intergenic
914029929 1:143948965-143948987 AAAAGATGAATTTGGGAGAATGG + Intronic
914159520 1:145118985-145119007 AAAAGATGAATTTGGGAGAATGG - Intergenic
920465393 1:206179850-206179872 AAAAGATGAATTTGGGAGAATGG + Intergenic
923939725 1:238808492-238808514 AATAGAGGAATTTAGGAGCCAGG - Intergenic
1073364003 10:102922532-102922554 AAATGAGGAATTTAGGAGAGAGG - Intronic
1075911086 10:126126330-126126352 ACACGAGGAATTCCGCAGAAGGG - Intronic
1078450505 11:11437336-11437358 AAACAAGGCATTTCTGAGAGGGG + Intronic
1078578985 11:12524512-12524534 AAAGGAGGAATTTGGGGGCCTGG - Intronic
1079623501 11:22585053-22585075 ATGCGAGGAATTTCAGAGGCTGG - Intergenic
1082811744 11:57482759-57482781 GAACGAGGAATTTCGAAGCCTGG - Intergenic
1086504536 11:87491089-87491111 AAATGAGGAATTTGGGAGTTGGG + Intergenic
1087134289 11:94699840-94699862 AAAAGAGGAAATTTGGACACAGG + Intergenic
1090199794 11:124846011-124846033 AGACGAGGAATTTAGGGGAGAGG - Intergenic
1093792406 12:23267582-23267604 AAACAAGGAATTTCCAAGCCTGG - Intergenic
1096223479 12:49848036-49848058 AAACGAGGAATTTAGAATAGGGG - Intergenic
1098985117 12:77003935-77003957 AAAAGTGGAATTTAGGAGAAAGG + Intergenic
1112248600 13:97757095-97757117 AAAAGGGGAATTTGGGGGACAGG - Intergenic
1113651967 13:112039879-112039901 AAACCAGGAGTTATGGAGACTGG - Intergenic
1113715059 13:112498315-112498337 TAACGAGGTATCTCGGAGAGGGG + Intronic
1117917277 14:60691039-60691061 AAATGAGCAGTTTCGGAGCCAGG + Intergenic
1123186582 14:106523555-106523577 AAACGACAAATATCTGAGACAGG + Intergenic
1123789714 15:23708769-23708791 AGACCAGAAATTTAGGAGACAGG + Intergenic
1128355635 15:66924532-66924554 AAAGGAGGAAATTCTGACACAGG - Intergenic
1130813494 15:87406326-87406348 AAATGAGTAATTTCAGAGAATGG - Intergenic
1136606329 16:31336578-31336600 AAGCGAGCAACTTCGGAGCCAGG + Intergenic
1137597274 16:49733175-49733197 AAACGAGGAATTTCGGAGACGGG - Intronic
1138226979 16:55304324-55304346 TAAAAAGGAATATCGGAGACTGG + Intergenic
1142887873 17:2924508-2924530 AGAGGAGGAATTTGGGAGAAAGG + Intronic
1143310650 17:5985706-5985728 AAAAGAGGAAATTCGGACACAGG + Intronic
1148078895 17:44956443-44956465 AAACTAGGACTTTCTGAGAAAGG - Intergenic
1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG + Intergenic
1158827774 18:61242771-61242793 ACACGAGGGATTTCGCAGATAGG + Intergenic
1165313629 19:35042128-35042150 AAAGGAGGAATTTGGGGGCCAGG - Exonic
1165879689 19:39033128-39033150 AAATGAGGAATTCCGGAGCTAGG - Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168136984 19:54358775-54358797 ACATGAGGAATTTGGGACACAGG + Intronic
1168161100 19:54510354-54510376 ACATGAGGAATTTGGGACACAGG - Intronic
929675991 2:43930253-43930275 GAAAGAGGAATTCCGGAGAAAGG + Intronic
929770706 2:44889198-44889220 AAAGGAGGAAGTTCAGAGAGGGG - Intergenic
930930076 2:56871301-56871323 AAACGGGGAAATTTGGACACAGG - Intergenic
934603336 2:95675672-95675694 AAACGATGAGTTTGGGAGTCAGG - Intergenic
935400735 2:102657506-102657528 TATGGAGGAATTTGGGAGACAGG - Intronic
937566511 2:123296548-123296570 AAAAGAGGAAGTTCAGAAACTGG - Intergenic
940568140 2:155395307-155395329 AAAAGTGGTATTTCGGAAACTGG - Intergenic
942115689 2:172726814-172726836 AAACAAGGAAATGCAGAGACAGG - Intergenic
943658532 2:190534291-190534313 AAACGAGGGAATTGGGCGACTGG + Intronic
944063073 2:195590104-195590126 AAAAGAGGAATATGGGAGATTGG - Intronic
948869393 2:240790700-240790722 AAAAGAGGAGATTTGGAGACAGG + Intronic
1169147384 20:3261799-3261821 AAACAAGTCATTTTGGAGACTGG + Intronic
1183660139 22:39215097-39215119 AATTTAGGAATTTAGGAGACGGG - Intergenic
952496046 3:33916562-33916584 AAAAGAGAAATTTAGGAGCCAGG - Intergenic
960552052 3:118986858-118986880 AAAAGAGGAAGTTGTGAGACTGG - Intronic
960704675 3:120470372-120470394 AAAAGGGGAAATTTGGAGACAGG - Intergenic
961130309 3:124460105-124460127 AAAGGAGGAATTTTTGATACAGG - Intronic
964592236 3:158377642-158377664 AAAAAAGGAATATCGGAGACTGG - Intronic
966387104 3:179410579-179410601 AAAGGGGGAAGTTTGGAGACAGG - Intronic
966893997 3:184428570-184428592 AAAAGAGGATTTTGGGAGAAAGG + Intronic
967201883 3:187079178-187079200 AAATGTGGAAATTTGGAGACAGG + Intergenic
969831398 4:9800411-9800433 AAAAGAGGAAATTTGGACACAGG + Intronic
970454007 4:16203584-16203606 AAAAGAGGAAATTTGGACACAGG + Intronic
974496044 4:62629070-62629092 AAACCTGGAATTTCACAGACTGG + Intergenic
977637876 4:99321658-99321680 AAACAAGGAATTCCAGAGGCCGG - Intergenic
977876230 4:102153892-102153914 TAACCATGAATTTAGGAGACAGG - Intergenic
979664570 4:123296290-123296312 AAATAAGGAATATGGGAGACTGG + Intronic
992449064 5:76859390-76859412 AATCGAGGTCTTTTGGAGACAGG + Intronic
994196487 5:96928438-96928460 AAAAGAGGAAGTTTGGACACAGG + Intronic
996512772 5:124335771-124335793 AAAATAGGCATTTAGGAGACAGG + Intergenic
1002664765 5:180814967-180814989 AAACAAGGAATATCTGAAACTGG + Intronic
1007032155 6:38638822-38638844 GAGCGAGGAATATTGGAGACAGG - Intronic
1017160620 6:151362326-151362348 AAATGAGGAATGGCTGAGACAGG - Intergenic
1029297168 7:99550758-99550780 AAATGAGCAATTTCGGACATGGG - Intronic
1034690390 7:153008917-153008939 CAACGAGGAATCTGGGAAACAGG + Intergenic
1036992333 8:13612281-13612303 AAAAGAGAAAATTTGGAGACAGG - Intergenic
1039242620 8:35573230-35573252 AAATGAGGAATTTGGGTGAATGG - Intronic
1044700890 8:94964445-94964467 AAAGGAGGAATACCCGAGACTGG + Intronic
1047640085 8:126809650-126809672 AAAAGAGGAATTTAGGAAAAAGG + Intergenic
1050561820 9:6842189-6842211 GAAGGAGGAGTTTTGGAGACAGG - Intronic
1051321350 9:15908657-15908679 AAAAGAGAAATATCTGAGACTGG + Intronic
1053208364 9:36207020-36207042 GAAAGAGGAAAGTCGGAGACAGG + Intronic
1055512020 9:77004376-77004398 GAACCAGGAATTTAGGAGAGAGG - Intergenic
1056563067 9:87749600-87749622 AAAGGAGGAATTCTGGAGATGGG + Intergenic
1187568924 X:20481175-20481197 AAAGGAGGAATTTCAGAGGGAGG + Intergenic
1193275123 X:79577332-79577354 AGACGAGGTATGTAGGAGACAGG + Intergenic
1197769850 X:130082942-130082964 AAATGAGGAACTTCAGAGAGGGG + Intronic
1198991239 X:142516973-142516995 ATTGGAGGAATTTTGGAGACTGG + Intergenic
1200876816 Y:8164964-8164986 AAACTAGGAATTTCAGATACTGG + Intergenic
1202103784 Y:21339813-21339835 AAACTAGGAATTTCAGGAACTGG + Intergenic