ID: 1137601767

View in Genome Browser
Species Human (GRCh38)
Location 16:49761092-49761114
Sequence CACTGTGTTTGGGAGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137601767_1137601777 26 Left 1137601767 16:49761092-49761114 CCCTTTGCCTCCCAAACACAGTG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1137601777 16:49761141-49761163 TACTTGCCCTCTCTGTGACCTGG 0: 1
1: 0
2: 1
3: 41
4: 302
1137601767_1137601773 2 Left 1137601767 16:49761092-49761114 CCCTTTGCCTCCCAAACACAGTG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1137601773 16:49761117-49761139 ACCTGAGAGAGGTTCAGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1137601767_1137601778 27 Left 1137601767 16:49761092-49761114 CCCTTTGCCTCCCAAACACAGTG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1137601778 16:49761142-49761164 ACTTGCCCTCTCTGTGACCTGGG 0: 1
1: 2
2: 15
3: 136
4: 898
1137601767_1137601772 -9 Left 1137601767 16:49761092-49761114 CCCTTTGCCTCCCAAACACAGTG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1137601772 16:49761106-49761128 AACACAGTGTGACCTGAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137601767 Original CRISPR CACTGTGTTTGGGAGGCAAA GGG (reversed) Intronic
900949284 1:5848832-5848854 CAATGTGTTTGGGAAGGAATTGG + Intergenic
901633211 1:10657871-10657893 CACTGCCTTTGGGATGGAAAGGG + Intronic
904147879 1:28409260-28409282 CACTGTGTTTGGATGGTAAGGGG + Intronic
904148309 1:28413949-28413971 CACTGTGTTTGGATGGTAAGGGG + Intronic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904476375 1:30767499-30767521 CACTGTGTTGGTGAGGCTATGGG - Intergenic
906247499 1:44287220-44287242 GACTGAGTGTGGGAGGCAGAAGG + Intronic
906525555 1:46491209-46491231 CACTCGGTTTGGGAGGCAGTGGG + Intergenic
908760072 1:67503569-67503591 GACTGTCTTTTGGAGGCCAAGGG + Intergenic
909908177 1:81224674-81224696 CACTGTGTTGGCTAGGCAATAGG - Intergenic
910072738 1:83238642-83238664 CACTGATTGTGGAAGGCAAAGGG - Intergenic
915624515 1:157106537-157106559 CTCTGTGTTGGGGGGACAAAGGG - Intergenic
917654907 1:177116677-177116699 CACTGGGTTAGGTAGTCAAAAGG - Intronic
919135677 1:193505761-193505783 GGCTTTGTTTGGGAGCCAAAGGG + Intergenic
919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920290493 1:204919631-204919653 CACTTTTTTTGGGGGGCAGATGG + Intronic
920351790 1:205342885-205342907 CTCTGAGATTGGGAGGCAGAGGG + Intronic
921360124 1:214323835-214323857 CTCTCTGTTAGGGAGGCAGAGGG - Intronic
924010755 1:239663069-239663091 TGCTGTGTTTGGGAAGCAGAAGG + Intronic
1063773258 10:9228777-9228799 CACTGTGTTTCTAAGACAAAAGG - Intergenic
1064711503 10:18130887-18130909 ATCTGTGTTTGGGAGGAAAATGG + Intergenic
1066115614 10:32236730-32236752 CACTTTGGTTGGGAGGCCGAGGG - Intergenic
1066317091 10:34258871-34258893 CACTGTGTTTTGTAGACATAGGG - Intronic
1067993272 10:51239999-51240021 GAATGTGTTTCTGAGGCAAAGGG + Intronic
1069248586 10:66241562-66241584 CACTGTGTTTGTGAATCTAATGG - Intronic
1070568398 10:77621066-77621088 CACGGGGTTTGGCAGGCACACGG + Intronic
1071273874 10:84034915-84034937 CACTGTGGCAGGGAGGCAATAGG + Intergenic
1072195784 10:93116266-93116288 CACTGTCTTTGAGGGGCACAAGG - Intergenic
1072521275 10:96232037-96232059 AAATGTGTTTTGGAGGGAAAGGG - Intronic
1072660584 10:97361271-97361293 CACTGTGTTAGGCAGTCCAAGGG + Intronic
1073734838 10:106334111-106334133 CTCTGTGTTTAAGAGGAAAAAGG - Intergenic
1075192043 10:120318202-120318224 CACTGTGTTTTGGAACCAAAAGG + Intergenic
1076020309 10:127066930-127066952 CACTGTCTCTAGGAGCCAAATGG - Intronic
1076820298 10:132935358-132935380 CAGTGTGTTTGGGTGCCAAGGGG - Intronic
1080304597 11:30822572-30822594 CACTGAGTTTGGGGGGTAATTGG + Intergenic
1082990666 11:59205043-59205065 CACTGTGGTTGGGAGGGATGAGG - Exonic
1085808047 11:79654700-79654722 CACTGTGTTTGGGAAGCACTTGG + Intergenic
1085825587 11:79843644-79843666 CACTGTGATGGGGAGACAATGGG + Intergenic
1087146402 11:94816801-94816823 AACTGTGTTTGTGAGACACAGGG + Intronic
1088335620 11:108700225-108700247 TATTGAGTTTGGGAAGCAAAAGG - Intronic
1088637306 11:111835260-111835282 CACTGTCTTTGTGACCCAAAAGG + Intronic
1088757659 11:112899586-112899608 GACTGTGTTTGGGATAGAAATGG - Intergenic
1089496240 11:118909934-118909956 CACTGTGTGTGGGAGCCATGAGG - Exonic
1089635220 11:119807615-119807637 AACTGGGTTTTGGAGGCCAAGGG + Intergenic
1093303768 12:17486171-17486193 CAGTGTATTTCAGAGGCAAATGG - Intergenic
1095695844 12:45143127-45143149 CACTTTATTCTGGAGGCAAATGG - Intergenic
1095933044 12:47648597-47648619 AGCTGTGTTTGGAAGGCTAACGG + Intergenic
1097400509 12:59122996-59123018 CAGTGTTTTTGTAAGGCAAAAGG - Intergenic
1099259377 12:80358050-80358072 CACTGTGCTTGGAAAGCATAAGG + Intronic
1099445459 12:82746538-82746560 CAATGTGTTTTGGAGGCAGATGG - Intronic
1100021237 12:90071806-90071828 CACAGTGTTTTTAAGGCAAAAGG + Intergenic
1100540923 12:95556627-95556649 CATTGTGATTGGGAGGGAGAGGG + Intergenic
1100662072 12:96710349-96710371 TACTGTGTTTGCTATGCAAATGG + Intronic
1101540385 12:105659604-105659626 CATTGTGGTAGGGAGGCAAGAGG + Intergenic
1102213509 12:111144193-111144215 AACTGTGTTTGGGACACAGAAGG + Intronic
1103065279 12:117892367-117892389 CTCTTTGTTTGAGAGGCATAAGG - Intronic
1107400078 13:40060992-40061014 AACTGAGTCTGGGAGGCAAAAGG + Intergenic
1108354380 13:49617139-49617161 GACTGAGTTTGGGAGGCAGAGGG + Intergenic
1109846577 13:68000155-68000177 GACTGTGTTTGCAAGGGAAAGGG + Intergenic
1110114844 13:71800176-71800198 CACAGTGTTTGAGAGCCGAATGG - Intronic
1114776464 14:25487848-25487870 CAATTTGCTTGGGAGGTAAAAGG - Intergenic
1115465483 14:33709889-33709911 CACAGTGTGTGGGAGGGTAAGGG - Intronic
1118359889 14:65046692-65046714 TACTGACTTTGGGAGTCAAAAGG + Intronic
1118561112 14:67084004-67084026 CACAGTGTTTGGTATGTAAAAGG - Intronic
1119104374 14:71910266-71910288 TTCTGTCTTTGGGAAGCAAAGGG - Intergenic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1121006209 14:90492122-90492144 CACTGTGTCTGGGAGAGAAGAGG - Intergenic
1121617992 14:95326516-95326538 CACAGTGTTTGGGATGCTCAGGG - Intergenic
1121849717 14:97209799-97209821 CATTGTGTTTGGGGGAGAAAAGG + Intergenic
1122046825 14:99029880-99029902 CACTGTGTGTGGAAGGAGAAGGG + Intergenic
1122782033 14:104147753-104147775 CGCTTTGTTTGGGAAGGAAAGGG + Intronic
1123936554 15:25196848-25196870 CTCTGTGTTTGGGAGGTATGCGG + Intergenic
1127304076 15:57684810-57684832 GACTTTGGTTGGGAGGGAAAAGG + Exonic
1128523147 15:68388859-68388881 GACTGTACTTGGGAGGCAATAGG - Intronic
1130968379 15:88714064-88714086 CACTGTGTAAGTGAGGGAAAGGG + Intergenic
1132773659 16:1579623-1579645 CAGTGTGTGTGGGATGCAGACGG + Intronic
1133328862 16:4958838-4958860 CAGGGTGTCTGGGAGGAAAATGG + Intronic
1133983895 16:10653310-10653332 CACAGAGTTTGGGCGGGAAAGGG - Intronic
1136989288 16:35142333-35142355 CCTTGTGTTGGGGAGTCAAACGG + Intergenic
1137031256 16:35526551-35526573 CACTGTGGTGGGGAGGCAGCAGG + Intergenic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1139968116 16:70756704-70756726 CACTGGGTTGGGGAGGCACCGGG + Intronic
1140227880 16:73093284-73093306 CATCGTGTTTGGGTTGCAAAGGG + Intergenic
1140315164 16:73889302-73889324 CCATGTTTTTGGCAGGCAAAGGG + Intergenic
1141141040 16:81497073-81497095 CACTGTGCCTGGGAGGCCCAGGG - Intronic
1141439754 16:84022348-84022370 AACTGTGTGTGGGAGGCAGAGGG - Intronic
1141575239 16:84959252-84959274 CAGTGTGTTTGGGGGGTGAATGG + Intergenic
1141643537 16:85355395-85355417 CCCTGGGTGTGGGAGGCTAAGGG - Intergenic
1142049672 16:87950213-87950235 CCCTGTGTTTGGGAGCTCAAAGG + Intronic
1142480074 17:213698-213720 CACTGAGCTGGGGAGGCAGACGG + Exonic
1145091283 17:19988105-19988127 CACTGTGTGTGGGAGGAACCAGG - Intergenic
1145857732 17:28178341-28178363 CACTTGGTTTGGGAGTGAAAGGG + Intronic
1146994238 17:37304403-37304425 CAGTGCTTTTGGGAGGCAAGCGG - Intronic
1147034121 17:37667381-37667403 TACTCTGTTTTGGAGACAAATGG + Intergenic
1147377804 17:40033229-40033251 GACGGTGTTTGGGGGGCCAAAGG + Intronic
1149003384 17:51779562-51779584 CCCTTTGTTTGGGTGACAAATGG + Intronic
1151169639 17:72235927-72235949 CACTGAATTGGAGAGGCAAAAGG - Intergenic
1151413164 17:73944403-73944425 AAATGTGTGTGGGAAGCAAAGGG - Intergenic
1151841003 17:76617296-76617318 CACAGTGTTTGGGAGGAGAATGG + Intergenic
1152179942 17:78813143-78813165 CACTGTGGTTGAAAGGCAAAGGG - Intronic
1153537408 18:6116861-6116883 CACAGGGTTTGGAAGGCACATGG - Intronic
1153668109 18:7384408-7384430 CTCTGTGTTTGGAAAACAAAAGG - Intergenic
1154388515 18:13916853-13916875 CACTCTGATTGGGAGGGACAGGG + Intergenic
1155876214 18:31091945-31091967 CACAGTGTTTAGAAGGAAAAGGG - Intronic
1156511032 18:37637046-37637068 CTCTGTGTTAGGGATGCAATGGG + Intergenic
1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG + Intergenic
1157512354 18:48285968-48285990 TCCTGTGTTTGGGAAGCCAATGG - Intronic
1157774451 18:50381188-50381210 CATTGTGATTGGGAGCCAGATGG + Intronic
1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG + Intergenic
1158915036 18:62116070-62116092 CACTGGGATTTGGAGGGAAAAGG + Intronic
1159136180 18:64339313-64339335 CACTCTGTTCTGGAGGAAAAAGG + Intergenic
1159987139 18:74856640-74856662 CTCTGTGTTTTGGAGTCAGAGGG - Intronic
1160118249 18:76102546-76102568 CACTGTGGTTGAGAAGCTAATGG - Intergenic
1161745562 19:6057610-6057632 CTCGGTGTTTGGGAGGCACGTGG + Intronic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1162876153 19:13622474-13622496 CTCTGTGTCTTGGAGGAAAATGG + Intronic
1165169912 19:33884614-33884636 CAGGGTTTTTTGGAGGCAAACGG - Intergenic
1166382428 19:42362021-42362043 GACAGTGTCTGGGAGGCAGAAGG + Intronic
1167493891 19:49806967-49806989 CTCTGTGCTTGGGGGGGAAAGGG - Exonic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
929555200 2:42921543-42921565 CACTGGGGTTTGGAGGCAAAGGG + Intergenic
932462693 2:71893592-71893614 CACTGCGTTGGGGAGGCGAGTGG - Intergenic
934541419 2:95178399-95178421 CATTCTGTTTGGGAGACAATTGG - Intronic
935150841 2:100433780-100433802 GAGTGTGTTGGGGAGGCAGAGGG - Intergenic
935216773 2:100981171-100981193 CCCTGTGTCTGGGAGGTCAAAGG + Intronic
935902883 2:107811317-107811339 CATTGTGTTTGAGAGGCCAAGGG - Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937524512 2:122751296-122751318 CACATTGTGTGGGAGCCAAATGG + Intergenic
938710399 2:133971556-133971578 CACTTTGTATGGGTGGAAAAAGG + Intergenic
941188073 2:162342507-162342529 CACTGTGTTTGTTATGCAACTGG + Intronic
941363532 2:164582191-164582213 GACTAGGTTTGGGTGGCAAATGG - Intronic
941919657 2:170837211-170837233 CAATGTGCTTGGGTGGAAAAAGG - Intronic
944134967 2:196389251-196389273 AACTGTCTGTGGCAGGCAAATGG + Intronic
944441575 2:199748920-199748942 CAGAGGGTTTGGGAGGCAATGGG - Intergenic
946288800 2:218727486-218727508 TATTTTGTTTGGGAGGCCAAGGG + Intronic
948078255 2:235183881-235183903 GACTGCATTTGGGAGGCAAGGGG - Intergenic
948990510 2:241551673-241551695 CCCTGTGCCTGGGAGGCAGATGG - Intergenic
1169732016 20:8796373-8796395 TCCTGTGTTTGGGAGAGAAAAGG + Intronic
1170595300 20:17801016-17801038 CAAAGTGGTTGGGAGGCAAGAGG - Intergenic
1170813281 20:19691957-19691979 CAGTGTCTATGGGAGGCAGAGGG - Intronic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1172739939 20:37158427-37158449 CCCTGTGGTTGGGAGGCACATGG - Intronic
1175878973 20:62245663-62245685 CACTGTGTTTTGGTGGCAATGGG - Intronic
1177878865 21:26669050-26669072 CACTCAGTTTGGGTGGCACACGG + Intergenic
1179153238 21:38827519-38827541 CACTGGATTTGGGAGGCCAAAGG - Intergenic
1179925002 21:44529441-44529463 CGCTGTCCTTGGGGGGCAAAAGG + Intronic
1180247708 21:46559402-46559424 CACTGTGATGGGGAGGCACAAGG - Intronic
1180742181 22:18061364-18061386 CAGTGTGTGTGGGAGGAGAACGG + Intergenic
1180996639 22:19969170-19969192 CACTGTGGCTGGGAGGCCAGTGG - Exonic
1181462785 22:23095232-23095254 CTCTGTGTTTGGCAGGTGAAGGG + Exonic
1181581774 22:23832680-23832702 CACTGCATGTGGGAGGCACACGG + Intronic
1184956577 22:47890937-47890959 AACTGTGAGTGGGAGGCAAACGG - Intergenic
949222014 3:1647008-1647030 CACCGGGTTTGGCAGGCAGATGG + Intergenic
951995445 3:28722705-28722727 ATCTGTATCTGGGAGGCAAAGGG + Intergenic
952357158 3:32595003-32595025 CACTGTGCCTGGCTGGCAAATGG + Intergenic
953393596 3:42548875-42548897 CATTGTGTGTGGGAGGAGAAAGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955136407 3:56223089-56223111 CCCTGTTTTTGGGAGGGAAGTGG - Intronic
955316949 3:57947158-57947180 CACTATGTTTGGCATGCAACGGG - Intergenic
955362555 3:58288174-58288196 CAGCGAGCTTGGGAGGCAAAAGG - Intronic
957808096 3:85177892-85177914 CACTGTGTGGGGGAGAAAAAAGG + Intronic
958189573 3:90167570-90167592 CACTGAGTTTGGGAGGAAAATGG + Intergenic
960571488 3:119189102-119189124 AACTGAGCTGGGGAGGCAAAGGG + Intronic
962411854 3:135147660-135147682 TATTGTGTTGGGGAGGCAGATGG + Intronic
964953549 3:162325583-162325605 TACTGCGTTTGGTAGGGAAAGGG - Intergenic
970092298 4:12423823-12423845 AACTGTGTTTGTGAGACACAGGG + Intergenic
972066249 4:34949188-34949210 CACTGTGTTTCCCAGACAAATGG - Intergenic
972609251 4:40641739-40641761 GGCTGTGCTTGGGAGGCTAAGGG + Intergenic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
973659528 4:53088599-53088621 CACTGTATTTTGGAAGCATATGG + Intronic
975019749 4:69471607-69471629 CACAGTTTTTGGATGGCAAATGG + Intergenic
980234672 4:130090257-130090279 CAGGGTCTTTGGGAGGGAAACGG + Intergenic
980390501 4:132139769-132139791 CACTGTGTCTAGGATGGAAACGG + Intergenic
981322700 4:143411091-143411113 CAATGTGGTTGGAAGGCAGAGGG + Intronic
984170570 4:176354004-176354026 AACTGTGTTTGTGAGACACAGGG - Intergenic
985585799 5:733324-733346 GACTGTGTGTGGGAGACAGATGG - Intronic
985768341 5:1793588-1793610 CTCTGTGTGTGGGAGACACATGG + Intergenic
985792664 5:1938858-1938880 CACCGTGTTTGGGAGCCAGGTGG - Intergenic
987225525 5:15836671-15836693 AACTGAGTTCGGGAGGCAATAGG + Intronic
987343964 5:16962560-16962582 CATTCTGCTTGGGAGGCAAAAGG - Intergenic
987535672 5:19184607-19184629 CACTGACTTTGGCAGGCACAGGG + Intergenic
987604653 5:20116832-20116854 AACTGTATTTGGCAGGTAAATGG + Intronic
991291844 5:65040901-65040923 CTATGTGTTTGGGAATCAAATGG + Intergenic
991455458 5:66798895-66798917 CACTGTATTTAGGAACCAAAGGG - Intronic
993027891 5:82667189-82667211 AAATGAGTTAGGGAGGCAAAGGG - Intergenic
993099108 5:83515044-83515066 CAGTGACTTTGTGAGGCAAAGGG - Intronic
993134584 5:83942930-83942952 GACAGTGTTTGGTAGGCACAGGG + Exonic
995439141 5:112170806-112170828 CACTGTGTGTGGCAGGCACATGG - Intronic
995852457 5:116560131-116560153 CTCCGTATTTGGGAGGCAAGGGG - Intronic
996783324 5:127212475-127212497 CCCTATGTTAGAGAGGCAAAAGG - Intergenic
998739733 5:145187021-145187043 CACTGTGCTGGAGAGACAAAGGG - Intergenic
1001178597 5:169496824-169496846 CACTTTGTTTGGGTGGCATAAGG + Intergenic
1002623391 5:180507024-180507046 TTCTGTGTTTGGGAGGGATATGG + Intronic
1003963145 6:11228056-11228078 ATCTGTGTGTGGGAGGCAAGGGG + Intronic
1007210937 6:40192968-40192990 CAATTTGTTGGGGAGGCAATGGG + Intergenic
1007802192 6:44404937-44404959 CACTTTGTGAGGGACGCAAAGGG - Intronic
1008427548 6:51377127-51377149 CCCTGTGTTAGGGAGGTGAATGG + Intergenic
1009403561 6:63285428-63285450 TAATGTGTTTGGGAGGAACAAGG + Intronic
1010483460 6:76381918-76381940 CACTCTGTTTGGGAGGAAATAGG - Intergenic
1012142385 6:95640050-95640072 AACTGTGTTTGTGAGACACAGGG + Intergenic
1019665829 7:2252006-2252028 CACTGTGTCCGGCAGACAAAGGG + Exonic
1019713482 7:2527892-2527914 CCCTGTCCTGGGGAGGCAAAGGG - Exonic
1023611696 7:41978311-41978333 CACGGGGCTTGGAAGGCAAAGGG - Intronic
1027290466 7:76703796-76703818 CACTGATTGTGGAAGGCAAAGGG - Intergenic
1027398623 7:77784925-77784947 CACTGAATTTGGCAGTCAAAAGG - Intergenic
1030328636 7:108249091-108249113 ATGTGTGTTGGGGAGGCAAAAGG + Intronic
1031122701 7:117739515-117739537 CACTGTCTTTGTGAGGCTCAGGG + Intronic
1033518893 7:142139824-142139846 CAATGTGTTTTGGTGTCAAAGGG + Intronic
1035277825 7:157758517-157758539 CACAAGGTTTGGGAGGCTAAAGG + Intronic
1036463940 8:8978900-8978922 CACTGTGGCTTGGAGGCAAATGG - Intergenic
1036637486 8:10561731-10561753 CACTGTGTCTTGGAGGCTGAGGG + Intergenic
1036680624 8:10870266-10870288 CACTGAGTTTTTGAGGCCAAAGG - Intergenic
1037824728 8:22154541-22154563 ATCTGTGTGTGGGAGGGAAAGGG - Exonic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038115248 8:24546545-24546567 CCCTGGGTTTGGGATGCAATAGG + Intergenic
1038218402 8:25584449-25584471 CACTGTGCTTGGAAGGGAAGGGG + Intergenic
1041132029 8:54711259-54711281 CTCTGAGTTTAGGAGGCAGAAGG - Intergenic
1042360539 8:67877756-67877778 CACTGTATTTGGGAGGCACATGG + Intergenic
1044260529 8:90114715-90114737 CACTCTGGTTGGGAGGGAAGGGG + Intergenic
1046640007 8:116719138-116719160 CACTGTCTTTGTGAGGACAACGG + Intronic
1049272381 8:141702803-141702825 CCCTTTGTTGAGGAGGCAAAGGG - Intergenic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1049957210 9:704645-704667 GTCTCTGTTTGGAAGGCAAATGG - Intronic
1050112475 9:2231267-2231289 CACTGTGTTTGGGAGTTATATGG - Intergenic
1050782057 9:9349435-9349457 CAATCTTCTTGGGAGGCAAAAGG - Intronic
1051141085 9:13979481-13979503 CAGTGTGTTGGGGAGACAAGCGG + Intergenic
1052352657 9:27473308-27473330 CAGTGTCTGAGGGAGGCAAAGGG + Intronic
1056105289 9:83341217-83341239 CACTGCATTTGAGAGCCAAAAGG + Intronic
1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG + Intronic
1187075174 X:15927701-15927723 CACTGGATGTGGGAGGAAAAGGG + Intergenic
1189054475 X:37685247-37685269 CACTGTATTTGGAAGACAAAGGG + Intronic
1190198960 X:48344098-48344120 CATTGGGATTGGGAGGCTAAGGG + Intergenic
1192616267 X:72625913-72625935 CACTTAGTTTGGGAGGCCAAGGG - Intronic
1193769468 X:85571902-85571924 CACTGTGCTGGGGAGGCCAAGGG - Intergenic
1195382942 X:104288283-104288305 CACTGTGTCTGGAAGAAAAATGG + Intergenic
1196847987 X:119911890-119911912 CATTTTGTTTGGCAGGCAATGGG + Intronic
1198953459 X:142099785-142099807 AAATGTGTATGGGAGGCAAAGGG - Intergenic