ID: 1137601973

View in Genome Browser
Species Human (GRCh38)
Location 16:49762410-49762432
Sequence GCCTGTGGCCAGCCCTTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137601966_1137601973 10 Left 1137601966 16:49762377-49762399 CCATGATGCCCAGACAGAATGCC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
1137601968_1137601973 1 Left 1137601968 16:49762386-49762408 CCAGACAGAATGCCCCACACAGA 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
1137601965_1137601973 11 Left 1137601965 16:49762376-49762398 CCCATGATGCCCAGACAGAATGC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
1137601964_1137601973 30 Left 1137601964 16:49762357-49762379 CCATCTCTGGCTATAGGAGCCCA 0: 1
1: 0
2: 4
3: 19
4: 139
Right 1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
1137601967_1137601973 2 Left 1137601967 16:49762385-49762407 CCCAGACAGAATGCCCCACACAG 0: 1
1: 0
2: 0
3: 17
4: 206
Right 1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137601973 Original CRISPR GCCTGTGGCCAGCCCTTCGC AGG Intronic
900338766 1:2177858-2177880 GTCGGTGGCAAGCCCTTCGCAGG - Intronic
900572056 1:3363484-3363506 GCCTCTGCCAAGCCCTTCTCAGG + Intronic
900594087 1:3472558-3472580 GCCTGGGGCCACCCCTTCCAAGG - Intronic
901735529 1:11309929-11309951 TCCTGTGGGCAGCCCTAGGCAGG - Intergenic
904957364 1:34296234-34296256 GCCTGAGGACAGCCCTGCTCTGG + Intergenic
905932645 1:41800443-41800465 GCCTGGTGCCAGCTCTTGGCTGG - Intronic
906324035 1:44833159-44833181 GCCTGTGGCCAGCATAACGCAGG - Intronic
906534741 1:46545161-46545183 GACTGTGCCCAGCCCTAGGCTGG - Intergenic
906649528 1:47502952-47502974 GCCCCTGACCTGCCCTTCGCTGG + Intergenic
907430559 1:54408836-54408858 CTCTGTGGTCAGCCCTTTGCTGG + Intronic
907572620 1:55497967-55497989 GCCTTCAGCCAGCCCTTCACTGG + Intergenic
913218856 1:116643550-116643572 GCCTGTGGCCAGCCTGTCCCAGG + Intronic
916628358 1:166584182-166584204 GCCTGAGGCTGGCCCTGCGCTGG + Intergenic
920513195 1:206565777-206565799 GCCTGTTCCCAGCCCCTCGTGGG - Intronic
921313815 1:213871798-213871820 GTCTGTGTCCAGCCCGTCACAGG - Intergenic
922215569 1:223516830-223516852 GCCTGTGGGCAGCCCTGGGGTGG + Intergenic
922749098 1:228062466-228062488 GCCTGGGGCTGGCCCTTCTCTGG - Intergenic
1063927714 10:10996838-10996860 GCCTGTGGGCAGCACCTCCCAGG - Intergenic
1067696957 10:48542618-48542640 GCCTGTGGTCAGGCCTCCACTGG - Intronic
1067803930 10:49380350-49380372 GCCTGTGGCCAGCACTTCTCCGG + Intronic
1068958276 10:62841012-62841034 GTCTGTGGCCAGCCATTCAGAGG + Intronic
1069414340 10:68184797-68184819 GCCTGTGCCCTGTCCTTGGCTGG + Intronic
1072734146 10:97867667-97867689 GCCTGTGCCCAGCCCTCCCATGG - Exonic
1073147660 10:101291517-101291539 GACAGTGGCCAGCCCTGGGCCGG + Intergenic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1073425805 10:103454951-103454973 CCCTCTGCCCAGCCCTTCCCAGG - Exonic
1073786709 10:106897945-106897967 GCCACTGGCCATTCCTTCGCTGG + Intronic
1074188077 10:111114049-111114071 GCCAGTGCCCAGCCCTGCGCTGG - Intergenic
1075222952 10:120600554-120600576 GCCTGAGGCCAGCCCGAGGCCGG + Intergenic
1075355126 10:121765204-121765226 GCCTGTGGCCAGCACTACCTGGG - Intronic
1075425995 10:122342090-122342112 GCCTGTGGCCAGGCCTGAGCTGG - Intergenic
1076064951 10:127441598-127441620 GCCAGTGACCAGCCATGCGCAGG + Intronic
1076256017 10:129025477-129025499 GCCTTTTGCCAGCCCCTGGCTGG - Intergenic
1076590405 10:131578456-131578478 GCCTGGGCCCAGCCCTCCGTGGG + Intergenic
1076694709 10:132241759-132241781 GCTTGTGGACAGCCCGTCGAGGG - Intronic
1076855895 10:133115510-133115532 GCCTGGGGGCTGCCCTTCTCGGG - Intronic
1077260727 11:1618566-1618588 GCCTGCCGCCAGCCATTCGTTGG - Intergenic
1077499133 11:2901449-2901471 GCCTGTGCCCAGCCCTTGCCTGG + Intronic
1079101876 11:17547111-17547133 GCCTGTGGCCACACCTCCCCAGG - Intergenic
1083264125 11:61538270-61538292 GCCTGTGGGCTGCCCTCCCCGGG - Intronic
1083268422 11:61557958-61557980 GCCTTTGCCCATCCCTTCCCTGG - Intronic
1083962209 11:66020793-66020815 GCCTGGGGCCTGCCCTACCCTGG + Exonic
1084647297 11:70465882-70465904 GCCCGAGGCCAGTCCTTCCCAGG - Intergenic
1084746147 11:71171258-71171280 GCCTGCAGACAGCCCGTCGCAGG - Intronic
1085761828 11:79247947-79247969 GCCTGTGGCCAGATCTTTGTAGG + Intronic
1085791619 11:79501770-79501792 GCCTGTGGCCAGTCCTGTTCAGG - Intergenic
1088774702 11:113070964-113070986 GCATGTGGCAAGCCCTGTGCTGG + Intronic
1091085782 11:132720286-132720308 GGCTGTGGCCAGGTCTTGGCCGG - Intronic
1091389913 12:119781-119803 GCGTGTGGACAGCCCTTGGAAGG + Intronic
1091792974 12:3282032-3282054 GCCTGTGGCCAGGCCCAGGCTGG + Intronic
1092077287 12:5684327-5684349 GCCTGTGTCAAGCCCATGGCAGG - Intronic
1095702978 12:45209432-45209454 GCCTGTGGAGAGGCCTTCGCAGG + Intergenic
1101745399 12:107537885-107537907 GGCTGTGGGCAGCCCTAAGCTGG - Intronic
1102534124 12:113568267-113568289 GCCTTTGGCCATCCCTTGGCTGG + Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1108945650 13:56019682-56019704 GCCTGGGGCCAGCCCAGTGCTGG + Intergenic
1112760443 13:102688784-102688806 CCCTGCGGCCAGCCCCTCACAGG - Intronic
1113374592 13:109752612-109752634 GCCTGTGGCTATCCCATCACAGG + Intergenic
1116872874 14:50084420-50084442 CCCTCTGGCCAGGCCTTCCCAGG + Intronic
1117635119 14:57734897-57734919 GCCTGTGATCAGCACTTCTCTGG + Intronic
1119652398 14:76392962-76392984 GCCTGTGGCCAGCCCTGGGAGGG + Intronic
1122264747 14:100541353-100541375 GACTGTGGCCAGCCCTTGCCAGG - Intronic
1122987388 14:105218807-105218829 GCCTGTGGCCAGCACGGGGCAGG + Intronic
1123895365 15:24823645-24823667 GGCTGCGGCCAGCCCTTGGTGGG - Exonic
1124558021 15:30745909-30745931 GCCCGTGGCCCTCCCCTCGCTGG + Intronic
1124952413 15:34336470-34336492 GTCTGGGGCCACCACTTCGCTGG - Exonic
1127618770 15:60713064-60713086 GACTGTGGCCAGGGCTTCCCTGG + Intronic
1128104015 15:65029624-65029646 GCCGGCGGCCGGCCCTGCGCAGG + Exonic
1129332886 15:74836809-74836831 GCCCCTGGCCTGCCCTTCCCGGG - Exonic
1132038523 15:98505684-98505706 GGCTGTGGCCAGACCCTCTCTGG - Intronic
1132747814 16:1444269-1444291 ACCTGTGGCAAGCCCCTCCCTGG + Intronic
1132945148 16:2528273-2528295 GCCTGCGGGCAGCCGGTCGCTGG - Exonic
1133224842 16:4336093-4336115 CCCTGTGGCCAGGCCCACGCTGG + Intronic
1133279316 16:4656081-4656103 GCCTGTGGCCAGGGCTCCACAGG - Intronic
1134759986 16:16705725-16705747 TCCTGTGGCCAACCCTCCCCTGG - Intergenic
1134986085 16:18653480-18653502 TCCTGTGGCCAACCCTCCCCTGG + Intergenic
1135305001 16:21360228-21360250 GCCTCTGGGCTGCCCTTGGCAGG + Intergenic
1136063969 16:27746543-27746565 GCCAGTGTCCATCCCTTCACTGG + Intronic
1136145338 16:28313168-28313190 GCCTGTGGCCCCACCTTCTCAGG + Intronic
1136228263 16:28873034-28873056 GCCTTGGGCCTGCCCTTCCCGGG + Intronic
1136301748 16:29339421-29339443 GCCTCTGGGCTGCCCTTGGCAGG + Intergenic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1139335060 16:66225862-66225884 GCCTGAGGGCAGCCCTCTGCTGG + Intergenic
1139429616 16:66904172-66904194 GCCTGAGCCCTGCCCTTCACTGG + Intergenic
1145939273 17:28733998-28734020 GCTTCTGGTCAGCCTTTCGCAGG - Exonic
1147263424 17:39221906-39221928 GGATGTGGCCAGGCCATCGCAGG - Intronic
1148760512 17:49997340-49997362 GCGTGGGGCGAGCCCTTCTCAGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1152554159 17:81044841-81044863 GCCTGTGGCCAGCACTGAGCTGG - Intronic
1152649817 17:81487738-81487760 GGCCGGGGCCTGCCCTTCGCAGG - Intergenic
1152700246 17:81815045-81815067 GCCTGTGGTCAGCCCCCCGGGGG + Intergenic
1155446748 18:25921046-25921068 GTCTGTGGTCAGACCTCCGCTGG - Intergenic
1160471014 18:79133827-79133849 GCCTTTGAACAGCCCTTAGCTGG + Intronic
1160513081 18:79463376-79463398 GCCTGTGGCTGGCCGTTCCCAGG - Intronic
1160856416 19:1219964-1219986 GCCTGCTTCCAGCCCATCGCTGG + Intronic
1161264893 19:3359609-3359631 GCCTGCGGCCCCCCCCTCGCCGG + Intronic
1163104478 19:15115565-15115587 GCCTGTGGCCTGGCCTACACTGG - Exonic
1163607784 19:18284834-18284856 ACCTGTAGCCAGCCCTGCCCTGG + Intergenic
1165994877 19:39836893-39836915 CTCTGTGGCCAGCCCTGGGCCGG + Intronic
1166213180 19:41320237-41320259 TCCTGTGCCCAGCCTTGCGCTGG - Intronic
1166765986 19:45252174-45252196 GCCTGTGGGCAGCCCCTGGCAGG + Intronic
927236507 2:20880195-20880217 GCCTGTAGGCACCCCTCCGCAGG - Intergenic
927454033 2:23233879-23233901 GCCTGTCGCCAGCTCTCAGCAGG + Intergenic
928333055 2:30372344-30372366 GCCTGTGCCCACCACTTAGCTGG + Intergenic
929539663 2:42810182-42810204 GCCTGGGCCCTGCCCCTCGCGGG + Intergenic
929588390 2:43130279-43130301 GCCTGTGCTCAGCCCCTCCCTGG + Intergenic
936061615 2:109298658-109298680 CCCTCTGGCCAGGCCTTCCCTGG + Intronic
937923076 2:127146113-127146135 GCCTGGGACCAGCCCTGGGCAGG + Intergenic
940979419 2:159984861-159984883 CCCTGTGGCCAGCCCTCACCAGG + Intronic
943607862 2:189997440-189997462 GGCTGTGGCAAGCCCTGCCCAGG - Intronic
943923376 2:193738919-193738941 GCCTGTGTCCATCCCTTCAGGGG - Intergenic
946458385 2:219848339-219848361 GCCAGTGCCCATCCCTTCCCTGG - Intergenic
947913317 2:233816719-233816741 TCCTGGGGCCAGCCCTTTCCTGG - Intronic
948756801 2:240164817-240164839 CCCTGTGCCCAGCCCTGTGCTGG - Intergenic
1169347085 20:4837149-4837171 TCCTGTGGCCAGCCCTGACCTGG + Intergenic
1170663248 20:18363051-18363073 CCCTGTGTCCTGCCCTTCTCTGG - Intergenic
1171382251 20:24742697-24742719 GCCTGTGGCAAGACCTGCCCAGG + Intergenic
1173978655 20:47206317-47206339 GCATGTGGCCAGCCCCCAGCTGG - Intergenic
1174157404 20:48524739-48524761 ACCCCTGGCCAGCCCTTTGCAGG - Intergenic
1175554162 20:59835949-59835971 GCCTGTGCCCAGCCCAGCACAGG - Intronic
1176429472 21:6567151-6567173 GCCTTTGGCTAGGCCTTGGCAGG + Intergenic
1178427894 21:32493473-32493495 GCCTGTGGCCAGCCCCTGCAGGG + Intronic
1178518179 21:33266267-33266289 GCCTGTGCCCCGCGCCTCGCGGG + Intronic
1178761513 21:35406857-35406879 GCCTGTTGCCTGCCCTTCTGTGG - Intronic
1179704866 21:43174613-43174635 GCCTTTGGCTAGGCCTTGGCAGG + Intergenic
1180001340 21:44996853-44996875 GCCTGTGTCCAGTCCTGGGCAGG - Intergenic
1181066277 22:20307546-20307568 GCCTGTGGACAGCCCTATGGGGG - Intergenic
1181127411 22:20710181-20710203 GCGTGTGGGCAGCCCTTGCCTGG - Intronic
1181315032 22:21965285-21965307 GCGTGTGGCCAGCTCTTCTCTGG - Exonic
1183737995 22:39654442-39654464 GCCTGGGGTCAGCCCTACCCAGG - Intronic
1184363078 22:44030440-44030462 GGCTGTGGCCAGCCCTGGTCGGG + Intronic
1184741481 22:46431219-46431241 GCCTGTGGCCGCCCCTTTCCGGG - Intronic
1184761825 22:46549241-46549263 GCCTGTGCCCAGCCCTGTGCTGG + Intergenic
952902127 3:38117430-38117452 GCCTCGGGCCAGCCTTTCCCTGG - Intronic
954146252 3:48635702-48635724 GACTGCGGCCAGCCCGGCGCGGG - Intergenic
959243502 3:103831030-103831052 CCCTCTCGCCAGCCCTTCACTGG + Intergenic
959611574 3:108300715-108300737 GCCTCTGGCCAGCTCTACCCAGG - Intronic
961281064 3:125766318-125766340 GCCTGTGGCCAGGCCCGCTCTGG - Intergenic
962315252 3:134355243-134355265 GCATGTGGCCAGCAGTTAGCTGG - Intergenic
962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG + Intronic
962951455 3:140223425-140223447 GCTTGTTGCCAGCCCTTGGAGGG + Intronic
964081396 3:152762958-152762980 GCCTGTGGCCAGCTCTGAGTAGG - Intergenic
964414088 3:156429375-156429397 CCCTGAGGCCAGCCCTAAGCAGG - Intronic
968488652 4:877631-877653 GCGTGTGGCCAGCACCTCCCAGG - Exonic
968701498 4:2060024-2060046 GCCCATAGCCAGCCCTGCGCGGG - Intronic
968964009 4:3760347-3760369 GCCTGGGGCCTGCCCGTTGCTGG - Intergenic
968968563 4:3781738-3781760 GCCTGTAGCCAGCCCTCTGGGGG + Intergenic
970407689 4:15778941-15778963 CCCTGAGCCCAGCCCCTCGCCGG + Intronic
991224298 5:64251632-64251654 GCCTGAGGCCAGACCATCCCGGG - Intronic
994399108 5:99256870-99256892 GCCTGGGGCAAGCTCTTAGCAGG - Intergenic
997367798 5:133336902-133336924 GGCTGTGTCCACCCCTTCCCAGG + Intronic
997585504 5:135040754-135040776 GGCTGTGGCCTGCCTTTCTCAGG + Intronic
1001027532 5:168236675-168236697 GCCTGTGGCCTGCCCCTCTAGGG + Intronic
1002445382 5:179287255-179287277 CCATGTGGCCAGCCCTGGGCGGG - Intronic
1002523351 5:179803276-179803298 GCCTCTGGACAGCCCCTGGCGGG + Intronic
1002638801 5:180620862-180620884 GCCTGAGGCCAGACCTTCCACGG + Exonic
1002784629 6:392053-392075 GCTTGTGGCGACCCCGTCGCAGG - Intronic
1006809313 6:36809830-36809852 GCCTGTGGACATCCCTGCTCAGG + Intronic
1010725587 6:79328962-79328984 CACTGTGCCCAGCCCTTAGCAGG + Intergenic
1016894335 6:149037600-149037622 GGCTGTGGCCAGGCCGCCGCAGG - Intronic
1018859026 6:167697892-167697914 GCCTGTGCCCATCCCTACCCAGG + Intergenic
1019299134 7:294811-294833 GCCTGTGCCAAGCCCTGTGCTGG + Intergenic
1019334409 7:476228-476250 TCCTGTGGCCAGCCCTGATCCGG - Intergenic
1026982763 7:74536302-74536324 GCCCGCGGCCAGCCCTGCTCTGG + Intronic
1030081505 7:105782594-105782616 GACTGTGGCCAGCCCTGGGCGGG + Intronic
1035366997 7:158355529-158355551 GCTGGTGGCCAGCCCATTGCAGG - Intronic
1035924377 8:3711349-3711371 CCCTCTGGCCAGCCCTTCCTTGG - Intronic
1036359123 8:8065319-8065341 GCCTGTGGCCAGACCCGCTCTGG - Intergenic
1036830305 8:12015309-12015331 GCCTGTGGCCAGGCCCGCTCTGG + Intronic
1036891835 8:12601633-12601655 GCCTGTGGCCAGACCCGCTCTGG + Intergenic
1037878640 8:22561884-22561906 GCCTGTGGGCAGGTCTTTGCTGG - Exonic
1041187304 8:55314404-55314426 GCCTGAGGCCCCCCCATCGCTGG + Intronic
1041691663 8:60693549-60693571 GCCTGTGGCCTGTCCTTCCCTGG + Intronic
1046785780 8:118264934-118264956 ACCTGAGCCCTGCCCTTCGCAGG - Intronic
1049003532 8:139840890-139840912 TCCTGTAGCCAGCCCTTCTAGGG + Intronic
1049180985 8:141222080-141222102 CCCTGTGTCCAGCCCTGGGCGGG - Intronic
1049531626 8:143158262-143158284 GCCTGGGGCCTGCCCTCCTCTGG - Exonic
1049578517 8:143400441-143400463 ACCTGTGCCCACCCCATCGCAGG - Intergenic
1049820349 8:144629702-144629724 GCCTGGGGCCAGACCTGTGCTGG + Intergenic
1060939527 9:127535573-127535595 GCCTGTGGGCAGCACTGCGCTGG - Intronic
1061215818 9:129221479-129221501 GCCTGTGGCGTGACCTTCGGTGG - Intergenic
1061398866 9:130357715-130357737 GCCTTTGGCCAGCCCTTCAAGGG + Intronic
1062076805 9:134594161-134594183 CTCTGTGGCCAGCCCTGCACTGG - Intergenic
1062247614 9:135577357-135577379 GACTGTGGCACGCCCTGCGCTGG + Intergenic
1062384534 9:136303944-136303966 GGCAGTGGCCAGCCCATCCCGGG - Exonic
1062457629 9:136646929-136646951 GCCTGTGGCTAGGCCTGTGCAGG - Intergenic
1187434785 X:19257640-19257662 GCCTGTGGCCAGTTCTTCCAAGG - Intergenic
1192370151 X:70506457-70506479 GCCTATGGCCAGTCCTGCCCAGG + Intergenic
1194058171 X:89163626-89163648 GACTGTGGCCACCCCTCCCCTGG + Intergenic
1194815795 X:98439927-98439949 GGCTGTGGCAAGCCCTGCCCAGG + Intergenic
1199489990 X:148387487-148387509 ATCTGTGGCCACCCCTTTGCTGG - Intergenic
1200090275 X:153632757-153632779 GCCTGTGGCCAGCCTGGCCCTGG + Intergenic
1200685971 Y:6259192-6259214 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1200688337 Y:6277814-6277836 GCCTGTGGCCACGACTTCTCAGG - Intergenic
1200979825 Y:9252417-9252439 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1200991503 Y:9350439-9350461 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1200994159 Y:9370715-9370737 GCCTGTGGCCATGACTTCTCAGG - Intronic
1200996823 Y:9391050-9391072 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1201001991 Y:9479913-9479935 GCCTGTGGCCATGACTTCTCAGG - Intronic
1201004658 Y:9500199-9500221 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1201007311 Y:9520525-9520547 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1201009950 Y:9540874-9540896 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1201012521 Y:9561560-9561582 GCCTGTGGCCATGACTTCTCAGG - Intergenic
1201046932 Y:9896878-9896900 GCCTGTGGCCATGACTTCTCAGG + Intergenic
1202131544 Y:21616828-21616850 GCCTGTGGCCATGACTTCTCAGG + Intergenic