ID: 1137609818

View in Genome Browser
Species Human (GRCh38)
Location 16:49810827-49810849
Sequence CCTTCAACACAAATGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137609813_1137609818 13 Left 1137609813 16:49810791-49810813 CCTACCGGACACTTTCTGTGCAT 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1137609818 16:49810827-49810849 CCTTCAACACAAATGGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1137609814_1137609818 9 Left 1137609814 16:49810795-49810817 CCGGACACTTTCTGTGCATTTAC 0: 1
1: 0
2: 3
3: 21
4: 255
Right 1137609818 16:49810827-49810849 CCTTCAACACAAATGGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1137609812_1137609818 14 Left 1137609812 16:49810790-49810812 CCCTACCGGACACTTTCTGTGCA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1137609818 16:49810827-49810849 CCTTCAACACAAATGGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137609818 Original CRISPR CCTTCAACACAAATGGGACC TGG Intronic
901609365 1:10485001-10485023 CCTTCTACTCAAATGTGGCCAGG - Intronic
913595716 1:120374367-120374389 CCTTGAACAAAACTGGGTCCAGG + Intergenic
914091559 1:144504609-144504631 CCTTGAACAAAACTGGGTCCAGG - Intergenic
914307041 1:146429566-146429588 CCTTGAACAAAACTGGGTCCAGG + Intergenic
914595065 1:149143545-149143567 CCTTGAACAAAACTGGGTCCAGG - Intergenic
917460542 1:175225465-175225487 CCTTCAATCTAGATGGGACCTGG - Intergenic
919262802 1:195218992-195219014 CCCTCAACAGGAATGGGATCTGG + Intergenic
920307629 1:205029355-205029377 GCTTGAATACAAATGGGATCTGG - Intergenic
921522928 1:216179059-216179081 ACTTTCAAACAAATGGGACCTGG - Intronic
924811742 1:247408834-247408856 CCTTCAACAAACGTGGCACCAGG - Intergenic
1063718424 10:8553621-8553643 CCTTCAATTTAAATGAGACCTGG - Intergenic
1068504521 10:57882939-57882961 CCTTCAACTTAATTGGGACTGGG - Intergenic
1069621192 10:69838182-69838204 GCTTTGACACAAGTGGGACCGGG - Intronic
1071795634 10:89002104-89002126 CCTTCAAAACAAATGGATACTGG - Intronic
1072871297 10:99124032-99124054 CCTTCAGCAAAAAGGGGACATGG + Intronic
1080212343 11:29800882-29800904 CATTCCACACAAATGGGAAAAGG + Intergenic
1081767362 11:45621030-45621052 CCTTCAGCAGAAAGGAGACCTGG + Intergenic
1085474589 11:76781939-76781961 GCTTCCACACATATGAGACCAGG + Intergenic
1090586904 11:128222866-128222888 CCCTCAGCACAAATGAGAACTGG + Intergenic
1091164982 11:133467682-133467704 CATTCAGGACATATGGGACCAGG - Intronic
1092639936 12:10494726-10494748 CCTCCAAGAAAAATGGGACTAGG + Intergenic
1095323871 12:40863816-40863838 TCTTCCACAAAACTGGGACCTGG + Intronic
1095953307 12:47793358-47793380 CCTTCACCACAGGTGAGACCGGG - Exonic
1097901022 12:64873983-64874005 CATTCAACACACATGGTCCCAGG - Intronic
1103884329 12:124189517-124189539 CCCTCAGCAGAAATGGGAGCTGG - Intronic
1106558309 13:30828654-30828676 CCTTCAACAGAGCAGGGACCAGG + Intergenic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1128992684 15:72273536-72273558 CCATCAACACTAATGGGAAAAGG + Intronic
1130096854 15:80862482-80862504 CATTCAACACACATAGGACCTGG - Intronic
1133487703 16:6236296-6236318 CCTGTTTCACAAATGGGACCAGG - Intronic
1135173842 16:20210548-20210570 CCGACAACACAAATGGAACTTGG - Intergenic
1135953713 16:26938441-26938463 CCTCCAACTTAAATGGGGCCAGG + Intergenic
1137609818 16:49810827-49810849 CCTTCAACACAAATGGGACCTGG + Intronic
1139579690 16:67865080-67865102 CCTGCAAGACCAATGAGACCAGG - Exonic
1140618888 16:76702902-76702924 CCTTCAAAACCAATGGTCCCAGG + Intergenic
1143099246 17:4496379-4496401 GCTTCAAAACAAATGGGGGCCGG - Intergenic
1160138990 18:76302435-76302457 CCTTCTTCACAAAAGGCACCAGG + Intergenic
1160662338 19:306894-306916 CATTCTCCACAAATGGGAGCAGG - Intronic
1162921333 19:13905147-13905169 CCTGAAAGACAAATGGGCCCTGG + Intronic
1164824352 19:31273517-31273539 CCTTCAAGCCACATGGGCCCTGG + Intergenic
1166980620 19:46630064-46630086 CCTCCACCGCAAATGGGCCCTGG + Intergenic
925604404 2:5643720-5643742 CCTTGAACAAAACTGGGTCCAGG + Intergenic
928234781 2:29530016-29530038 CCTTCAAGACAAATGAGCCCTGG - Intronic
930230981 2:48843624-48843646 CCTTCAAATCAAGTGGGTCCTGG - Intergenic
934868108 2:97832427-97832449 CCTTCCTCACTAGTGGGACCGGG - Intronic
937587250 2:123567487-123567509 CCTTCAATACAAATGGCATTGGG + Intergenic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
947387865 2:229610105-229610127 TCGTCAAAACAAATGGTACCAGG - Intronic
1172486883 20:35303788-35303810 AACTCAACACAAATGGGGCCAGG + Exonic
1175014373 20:55773232-55773254 CATTAAACACAAATGAGTCCAGG - Intergenic
1175507043 20:59493525-59493547 CCTTCCACACACATGGGTCTTGG - Intergenic
1177386620 21:20417855-20417877 CATTCAAAACAAATGGGGCTGGG + Intergenic
1178773132 21:35524118-35524140 TTTTCAAAACAAATGGGGCCGGG - Intronic
1179680076 21:43013443-43013465 CCTTCCATAAACATGGGACCGGG - Intronic
1179919241 21:44498705-44498727 TCTGCAACACAAATCGGAACAGG - Exonic
1181518131 22:23428399-23428421 CCTGCACCACAAATGGCCCCAGG - Intergenic
1181972120 22:26698801-26698823 TATTCAACAAAAATGGAACCAGG - Intergenic
1182394065 22:30022587-30022609 TCTGCAAAACAGATGGGACCAGG - Exonic
1183819378 22:40332980-40333002 CCTCCAACACAAATGCAAACCGG - Exonic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
950497864 3:13344979-13345001 CCATCAACACTGATGGCACCCGG - Intronic
952517707 3:34122470-34122492 CCTTCACCAAAGATGGTACCTGG - Intergenic
954620322 3:51991711-51991733 CCTGCATCACTAGTGGGACCCGG - Intergenic
957415199 3:79893040-79893062 CTTTCCAAACAAATGGGACTTGG + Intergenic
959246024 3:103868958-103868980 TCTCCAACATAAATTGGACCTGG + Intergenic
963352033 3:144163766-144163788 CCTTCCTCACGAATGGGATCAGG + Intergenic
965118739 3:164522646-164522668 CCTTCAACTCAGAGGGGGCCAGG + Intergenic
971792856 4:31190967-31190989 TCTTTGTCACAAATGGGACCAGG + Intergenic
976713145 4:88094659-88094681 CCTATAACACAAGTGGGAGCAGG + Exonic
977415824 4:96732111-96732133 CCTATAACACACATGGCACCTGG + Intergenic
982375313 4:154683775-154683797 CCTTCAACCAAAATGGGAGAAGG - Intronic
990593621 5:57291680-57291702 TCTTCAGCACAAATAGCACCTGG - Intergenic
992664743 5:78996293-78996315 CCTTCAACACAACTTGGCCATGG - Intergenic
998496139 5:142591077-142591099 CCTTCAAAACAGATGGTTCCTGG + Intergenic
999609275 5:153351644-153351666 ACTTTAAGAAAAATGGGACCAGG - Intergenic
1012071063 6:94617149-94617171 CATTCTACATAAATGGAACCAGG + Intergenic
1013948640 6:115752857-115752879 CCAACAACAAAAATGGTACCTGG + Intergenic
1020700363 7:11474420-11474442 CCTTCAACACAACTACGACTTGG - Exonic
1024392529 7:48831778-48831800 GCTTCACCAAGAATGGGACCAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028753648 7:94410444-94410466 CCTTCTTCACCACTGGGACCAGG - Exonic
1032667230 7:134048699-134048721 CCTTCAGGTCAAATGTGACCTGG - Intronic
1036652495 8:10654290-10654312 TCTTCTGCACAAATGGGCCCAGG + Intronic
1037837806 8:22224485-22224507 CCTTAAACTCAGATGGGAACAGG + Intronic
1039613360 8:38936619-38936641 CCTTCTGTACAAATGGGACGGGG - Intronic
1042508908 8:69590940-69590962 GATTCAACAGAAATGGGAACAGG - Intronic
1043555158 8:81421733-81421755 ACTTCAACAGAAATGGCACCAGG - Intergenic
1047630968 8:126707762-126707784 ACTGTAACACAAATGTGACCTGG - Intergenic
1052195924 9:25714752-25714774 CCTACAACACAAATAGGAACTGG + Intergenic
1052492194 9:29184196-29184218 TCTTCAACATAAAAGGGACGTGG - Intergenic
1055590776 9:77811649-77811671 CTCTCAACAGAAATAGGACCTGG - Intronic
1056937492 9:90927523-90927545 CCCTGAACACAGACGGGACCTGG - Intergenic
1057880285 9:98787984-98788006 CCTTCTCCACAAATGGGTGCTGG - Intronic
1061552258 9:131344042-131344064 CCTCCAAGAAATATGGGACCAGG - Intergenic
1061883343 9:133578822-133578844 CATTGAACACAAATGTGTCCTGG - Exonic
1061900456 9:133669536-133669558 CCTGCAACCCAAGTGGGACTCGG + Intronic
1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG + Intergenic
1186126310 X:6418241-6418263 CATTCAACACAAATCAGAACTGG + Intergenic
1196236192 X:113283510-113283532 ACTTCAACATAAATGTGTCCTGG - Intergenic
1196769046 X:119274462-119274484 CCTTCAGCACAGAGGAGACCAGG + Intergenic
1199269343 X:145864645-145864667 TCTTCTACGGAAATGGGACCCGG - Intergenic
1199502342 X:148521178-148521200 GCCTCCACACAAATGGTACCTGG - Intronic
1200001696 X:153065450-153065472 CGTTCAACACACATAGCACCTGG + Intergenic