ID: 1137610129

View in Genome Browser
Species Human (GRCh38)
Location 16:49812345-49812367
Sequence TGCCTGGCTGGCTATGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137610119_1137610129 19 Left 1137610119 16:49812303-49812325 CCCCATCTACCTGGTTGTTTTCT 0: 1
1: 0
2: 1
3: 36
4: 341
Right 1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1137610120_1137610129 18 Left 1137610120 16:49812304-49812326 CCCATCTACCTGGTTGTTTTCTA 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1137610118_1137610129 26 Left 1137610118 16:49812296-49812318 CCACATTCCCCATCTACCTGGTT 0: 1
1: 0
2: 2
3: 27
4: 276
Right 1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1137610122_1137610129 10 Left 1137610122 16:49812312-49812334 CCTGGTTGTTTTCTAGAAGCTAC 0: 1
1: 0
2: 2
3: 12
4: 106
Right 1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1137610121_1137610129 17 Left 1137610121 16:49812305-49812327 CCATCTACCTGGTTGTTTTCTAG 0: 1
1: 0
2: 0
3: 20
4: 253
Right 1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137610129 Original CRISPR TGCCTGGCTGGCTATGAGAG GGG Intronic
902778065 1:18687210-18687232 TCCCTGGATGGCTTTGAGAATGG - Intronic
902858158 1:19224428-19224450 TGACTGGCTGGGGAGGAGAGAGG - Intronic
903302517 1:22389573-22389595 TGCATCTCTGGCTATGAGAGGGG - Intergenic
903558580 1:24211038-24211060 TGCCTGTCTGGTTAAGAAAGAGG - Intergenic
903784986 1:25854639-25854661 TGCCTGGCTGGATTTCAGACTGG - Intronic
905307111 1:37027465-37027487 TGCATGACTGACCATGAGAGGGG - Intronic
906154462 1:43605981-43606003 TGCCACACTGGCTATGAGAAAGG - Intronic
906948381 1:50315133-50315155 TGCATGGCTAGCTATGAAGGTGG + Intergenic
908317864 1:62951600-62951622 TGGCTGGCTGGCTGGGAAAGGGG + Intergenic
909731729 1:78900179-78900201 TTCCTTGCTGGCTGTGAGACGGG - Intronic
910032938 1:82753397-82753419 TGCCTGTATGGCTTTGAAAGTGG + Intergenic
910386822 1:86692957-86692979 TGCCGGCCTGGCTCTAAGAGCGG + Intergenic
911670755 1:100604698-100604720 AGACTGGTTGGCTTTGAGAGTGG + Intergenic
912495072 1:110086276-110086298 TGCCTGGCAGGCTGGGACAGAGG - Intergenic
913707003 1:121434958-121434980 AGCCTGGCTGGCTTTGACACTGG + Intergenic
915087596 1:153398690-153398712 TGCCTGGCTGGCTCCATGAGCGG - Intergenic
917964212 1:180168250-180168272 TGCCTGGCTGGCTGTGGGAGGGG + Intronic
920120057 1:203649860-203649882 TGCCTGGCCGGGTACGAGTGGGG - Intronic
1063879854 10:10519984-10520006 TCCCTGGCTGGCAATAAGGGAGG - Intergenic
1064194361 10:13233450-13233472 TGCCCGGCTGACTGTGGGAGAGG + Intronic
1065204162 10:23342428-23342450 TGCCTGGGTGTGAATGAGAGAGG - Intronic
1066550233 10:36547802-36547824 TGCCTGGCTGTGTGGGAGAGAGG - Intergenic
1070130014 10:73649207-73649229 TTCCTGACTGGCAATGGGAGGGG + Intronic
1077059289 11:610663-610685 TGACTGGCTGGCTCTGAGGCTGG - Exonic
1078467540 11:11561285-11561307 TGCCTGGGTGGCGTTGCGAGTGG - Intronic
1080481236 11:32652152-32652174 TGCCTAGCTGGCTGTGGTAGTGG + Intronic
1082178431 11:49088814-49088836 TGGCTGTCTTGCTCTGAGAGGGG + Intergenic
1082785988 11:57316969-57316991 TGTCTGCCTGGCAGTGAGAGAGG - Intronic
1083185951 11:61018037-61018059 AGCCAGGCTGGCTATGGGATGGG - Intronic
1083886092 11:65574200-65574222 TGCCTGGCTGGCTCTGGGGCGGG + Intergenic
1085711402 11:78832106-78832128 AGACTGGCTGGGAATGAGAGCGG - Intronic
1085730235 11:78991671-78991693 TCCCTGCATGGCTGTGAGAGAGG - Intronic
1086686640 11:89741022-89741044 TGGCTGTCTTGCTCTGAGAGGGG - Intergenic
1089611379 11:119671401-119671423 TCCCTGGCTGGCCAAGACAGTGG + Intronic
1089916343 11:122160762-122160784 TCCCTGCCTCGCTATGATAGTGG + Intergenic
1090309387 11:125721341-125721363 TGCCTGTCTGGCTGAGAGGGAGG + Intergenic
1091389483 12:117433-117455 AGCCTGGGAGGCTATGAGGGAGG + Intronic
1091919457 12:4292788-4292810 TGCCTGGGTAGGTTTGAGAGGGG + Intronic
1096235696 12:49924753-49924775 TGACTGGCTGGGAATGACAGGGG + Intergenic
1097184707 12:57190367-57190389 TGCCTCGCAGGATGTGAGAGTGG - Intronic
1097818687 12:64104491-64104513 TTCCTAGCTGGCTCTGAGTGTGG - Intronic
1099033217 12:77554791-77554813 TCCCTGGGTGGCTATGTGAGTGG - Intergenic
1103507980 12:121454238-121454260 TGCCAGGCTGGCTCGTAGAGAGG - Intronic
1103888361 12:124220108-124220130 TGGCTGGCTGGCAATCAGTGAGG - Intronic
1105969105 13:25412119-25412141 TGCCTGCCTGTCTCTGAGAGGGG - Intronic
1107769997 13:43779344-43779366 TGTCTAGCTGGCTATGACTGTGG + Intronic
1108019268 13:46109988-46110010 TGCCTGGCTGACTTTGAGCTGGG + Intergenic
1109257111 13:60096982-60097004 TGCCTGCCTGTCTATATGAGAGG - Intronic
1111639667 13:90951663-90951685 TTCCTGGCTGTATATGAAAGAGG + Intergenic
1112236021 13:97637454-97637476 TGTCTGGGTGGCTGTGACAGAGG - Intergenic
1113618527 13:111697468-111697490 CTCCTGGCTGGCTGTGAGATGGG + Intergenic
1113624056 13:111782729-111782751 CTCCTGGCTGGCTGTGAGATGGG + Intergenic
1114184337 14:20388810-20388832 TGCCTGGATGGCTGTAAAAGAGG + Intronic
1117120487 14:52563222-52563244 TGCCTGTCTTGCCATCAGAGAGG + Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1117852676 14:59991707-59991729 TGCTTGGCTAGCAATGAGTGAGG - Intronic
1119543986 14:75458851-75458873 GGCCTGGCTGGCTTGGAGAAGGG + Intronic
1120435917 14:84482101-84482123 TGCTTGTCTGACTACGAGAGAGG + Intergenic
1120827355 14:88967980-88968002 TGCATTGCTGGGTATGAGGGTGG - Intergenic
1121847060 14:97181025-97181047 TGACTGGCTGGCTCTGCGGGAGG - Intergenic
1127647671 15:60974433-60974455 TACCTGGCTGGCTGTGTGAAGGG - Intronic
1128781092 15:70359168-70359190 TGCCTGCCTGGCTTTCAGATAGG - Intergenic
1129272926 15:74428875-74428897 GGCCTGGCTGGCTAGGGAAGGGG + Intronic
1134038366 16:11049339-11049361 AGCCTGGGTGGCTATGAGGTAGG - Intronic
1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG + Intronic
1137820293 16:51437871-51437893 TGCATGGTTGTCTATGAGTGTGG - Intergenic
1138146890 16:54620680-54620702 TGTCTGGCTTTCTCTGAGAGGGG - Intergenic
1142160519 16:88555055-88555077 GGCCTGGTTGGCTTTGAGGGAGG + Intergenic
1142789362 17:2251767-2251789 TACCTGGCTGGCTCTCAGAAAGG + Intronic
1143023392 17:3928058-3928080 TGCCAGGTGGGCTCTGAGAGTGG - Intronic
1143770031 17:9162690-9162712 TGCCTGCCTGGCTCTGCTAGTGG + Intronic
1144411652 17:15007439-15007461 TGCCTGGATGGCCAAGAGTGAGG + Intergenic
1144760446 17:17704110-17704132 TGCCTGGCTTGCCAGGAAAGTGG + Intronic
1144768574 17:17746362-17746384 TGCCTGCCTCGCTCTGAAAGAGG - Intronic
1146591934 17:34134768-34134790 TGCATGTCTGTCTACGAGAGTGG - Intronic
1147120169 17:38330998-38331020 GGCCTGGCTGGCCATGAGCAAGG + Exonic
1147943664 17:44067780-44067802 TGCCTGGCTTTCTGGGAGAGAGG - Intergenic
1149868050 17:60161541-60161563 TCCCTCGCTGGCTGTGGGAGGGG + Intronic
1150387610 17:64773943-64773965 TCCCTGGCTGGCCCTGAGTGGGG + Intergenic
1151733269 17:75923338-75923360 AGCCTGGCTGGCTTTGGCAGGGG + Exonic
1152023252 17:77792827-77792849 TACCTGGCAGGCCGTGAGAGTGG - Intergenic
1152360584 17:79831509-79831531 TGCCTGGCTGGGTCTGGGGGTGG - Intergenic
1152784247 17:82239801-82239823 TGCCTGGCTGGCAGTGTGCGTGG + Exonic
1152876030 17:82786636-82786658 GGCCAGGCTGGCTGTGGGAGAGG + Intronic
1154022045 18:10672684-10672706 TTCCTGGCTGGCTATGGGTAAGG - Exonic
1156714432 18:39990012-39990034 GGCTTGGCTGGCTAGGGGAGAGG + Intergenic
1157244630 18:46042273-46042295 TGCCTTCCTGGCTAAGACAGAGG - Intronic
1158890057 18:61864256-61864278 TGACTGACTGGCTATCAGTGGGG + Intronic
1161907537 19:7168235-7168257 TGCCTGGCTGAGTATGAATGGGG + Intronic
1163691124 19:18739049-18739071 TGGCTGCCTGGCTGTGAGAGTGG - Intronic
1164540922 19:29121003-29121025 TACCTGGCTGCCCATGAGAATGG + Intergenic
1164686662 19:30170721-30170743 GCCCTGGCTGACTATGAAAGTGG + Intergenic
1164725397 19:30462507-30462529 TGGCTGTCTTGGTATGAGAGAGG + Intronic
1165262517 19:34632852-34632874 TGGTTGGCTGTATATGAGAGAGG - Intronic
1165488724 19:36111053-36111075 TTCCTGGCTGGCCCTGGGAGTGG - Intergenic
1167177980 19:47879077-47879099 TGGCTGGATGCCCATGAGAGAGG - Exonic
1167486624 19:49766851-49766873 TGCTTGGCGGCCAATGAGAGAGG + Intergenic
925051829 2:821628-821650 TGCCATGCTGGCTTTGAGTGAGG - Intergenic
927867025 2:26595751-26595773 TCCCTGGCTGGCTATGCGCTTGG - Intronic
927878235 2:26673023-26673045 GGCCTGGCTGACTTTGACAGAGG + Intergenic
930492419 2:52092748-52092770 AGCCTGGCTGGCTTTGCCAGTGG - Intergenic
930621745 2:53651417-53651439 TGCATGGCTGGCAAAGAGAAGGG - Intronic
931946343 2:67312801-67312823 TCCCTTGCTGGATATGAGACTGG - Intergenic
932966602 2:76482877-76482899 TGCCTAGGTGACTATGTGAGTGG - Intergenic
933011245 2:77066889-77066911 TGCATGGCTGGCAGAGAGAGCGG + Intronic
933628721 2:84632354-84632376 TGCCTGGCTGAGGAGGAGAGTGG - Intronic
940009261 2:149037905-149037927 TGCCTGGCTGGCAGTGGGTGGGG + Intergenic
942073957 2:172339725-172339747 TGCCTGCCTGGCTGCGAAAGAGG - Intergenic
942665850 2:178316437-178316459 TCACTGTGTGGCTATGAGAGAGG - Intronic
943788120 2:191901242-191901264 TGCCTGGCTTGTGATGGGAGGGG - Intergenic
944492162 2:200268700-200268722 GGGCTGGCTTGCTATTAGAGTGG - Intergenic
944896649 2:204172217-204172239 TGCCAGGCTGCCTATGTGACTGG + Intergenic
945891716 2:215436735-215436757 TGCCTGTCTGGCTCTGAGAAAGG + Intergenic
946020920 2:216639414-216639436 TGCCTGGCAGGATAGGACAGGGG + Intronic
947581596 2:231322999-231323021 TGCCAGGCTTGCATTGAGAGAGG + Intronic
947949120 2:234132608-234132630 TGCCTGGATGGGGATGGGAGTGG - Intergenic
948365039 2:237449250-237449272 TTCCTGGCTGGGTCTGAGGGAGG - Intergenic
948380736 2:237548281-237548303 TGCCTGGCTGGGTTTGTGGGCGG - Intronic
948643584 2:239390236-239390258 TACCTGGCTGGCTTCGAGGGAGG - Intronic
948659209 2:239496842-239496864 TGATTGGCTGGCTTTCAGAGGGG - Intergenic
948659251 2:239497117-239497139 TGATTGGCTGGCTTTCAGAGGGG - Intergenic
948821708 2:240553134-240553156 TGCCTGGTTGGCAATGAATGGGG + Intronic
1170169851 20:13398446-13398468 TGCCTGTCTGGCTCTAAGAAGGG - Intronic
1170542748 20:17405467-17405489 TGAATGGCTGGTGATGAGAGAGG - Intronic
1171814936 20:29777800-29777822 CGCCTGGCTGGGCAAGAGAGGGG + Intergenic
1173311974 20:41904818-41904840 AGCATGGCTGGATATGAAAGAGG + Intergenic
1175133370 20:56806041-56806063 TGCCTGGCTTGCTCTGGGAGAGG + Intergenic
1177765637 21:25453958-25453980 TGCCTGAGTGCCTTTGAGAGGGG - Intergenic
1178671554 21:34595763-34595785 TGCCTGGATGGCTCTGATGGGGG + Intronic
1178942010 21:36914227-36914249 TGCAGGGCTGGATGTGAGAGGGG - Intronic
1179063053 21:37997552-37997574 TTCCTTGCTGGCTTTGAGACAGG + Intronic
1180318375 22:11298350-11298372 CGCCTGGCTGGGGAAGAGAGTGG + Intergenic
1182789816 22:32941839-32941861 TGCCGAGCTGGCAATGAGCGAGG - Intronic
1185164844 22:49255288-49255310 AGCCTGGCTGGGTATAAGAGGGG - Intergenic
950254490 3:11493261-11493283 TGGCTGGATGGCAAAGAGAGGGG - Intronic
950275461 3:11656685-11656707 TACCTGGCTTGCTATGCGAGTGG - Intronic
950545004 3:13633159-13633181 TGCCTGGCTAGCCACTAGAGAGG + Intronic
952901377 3:38114161-38114183 TGCCTGGCTGGGAGGGAGAGTGG + Intronic
952976857 3:38704073-38704095 TGCATGAGTGGCTATGAGGGAGG + Intronic
958004201 3:87792284-87792306 TGGGTGGCTAGCAATGAGAGAGG - Intergenic
959600860 3:108183492-108183514 TGACTGGCTGGTTAAGGGAGGGG - Intronic
960449412 3:117788303-117788325 AGCCTTGCTGCCTCTGAGAGAGG - Intergenic
961661228 3:128469840-128469862 TGAGTGGCTGGGTATGTGAGTGG - Intergenic
963225830 3:142860759-142860781 TGCCTGGCCGGTATTGAGAGGGG - Intronic
967070132 3:185955722-185955744 TGCATGGCTGGCAAAGAGAAGGG + Intergenic
968113501 3:196070142-196070164 TGCCTGGCTGCCTATAAGCCAGG - Intronic
968234493 3:197023672-197023694 AGTCTGGCTGGCGATGAGCGTGG - Intronic
968577627 4:1375311-1375333 TGCCTGGCGGGTTGTGGGAGTGG + Intronic
969672388 4:8596989-8597011 TGCCCGGCTGGCACTGAGCGTGG - Intronic
969672814 4:8598950-8598972 TGCGTGGCTGACTCTGGGAGGGG + Intronic
975668037 4:76753455-76753477 TCCCTGACTGGCTATGTGAGTGG - Intronic
975882526 4:78927548-78927570 TGGCTGACTGGCTGTGTGAGAGG + Intronic
977030344 4:91875296-91875318 TTCCTGGCTTGTGATGAGAGAGG - Intergenic
977580861 4:98723656-98723678 TGCCGTGCTAGCAATGAGAGAGG - Intergenic
977741279 4:100486671-100486693 AGCCTGGCAGGCTCTGAGATTGG + Intronic
982591751 4:157322849-157322871 TGCATGACTGTCTATGAGATTGG + Intronic
985560679 5:584450-584472 TCGCTGGCTGGCTAGGAGGGTGG + Intergenic
985965073 5:3333323-3333345 TGCATGGCTGGCTTTGTGGGAGG - Intergenic
986365624 5:7027523-7027545 TGTGTAGCTGGCCATGAGAGAGG + Intergenic
986870054 5:12035467-12035489 TGACTGGCTGGCTATGAGGTGGG + Intergenic
988589623 5:32537553-32537575 AGCCTGGCTGATTGTGAGAGAGG + Intronic
988675357 5:33427843-33427865 GGCCTGTCTGGCTATGGGAGGGG + Intergenic
989970664 5:50520940-50520962 AGCCTGGCTGGCTCTGACACTGG - Intergenic
991315846 5:65305364-65305386 TGAGTAGCTGTCTATGAGAGGGG + Intronic
992664762 5:78996368-78996390 TGACTGGCTGGGTATGAGTGGGG + Intergenic
993167928 5:84382390-84382412 TGCCTGGCTGGGTCTGATTGAGG - Intronic
995690877 5:114824889-114824911 TGCCTTGCTGGATTTGGGAGTGG - Intergenic
997586680 5:135047673-135047695 TGCCTGGCAGGCTAGGAGGTTGG + Intronic
998983181 5:147726670-147726692 TGCCAGGCTGGCTTTAACAGTGG - Intronic
999101147 5:149027296-149027318 GGCCTGGCTGGCTAAGAGATAGG + Exonic
999434649 5:151553897-151553919 TGCTTGGCTAGCAATGAGACTGG + Intronic
1000610589 5:163369261-163369283 TGTCTGGCTGGGTTTGACAGGGG - Intergenic
1001524821 5:172421353-172421375 TGCCTGGCTCCCTATAAGACTGG + Intronic
1001640868 5:173243347-173243369 TGCCTGGGTGGCTGGGGGAGAGG - Intergenic
1002130710 5:177079890-177079912 GGCCTGGCTTGCTAGGACAGGGG - Intronic
1006079970 6:31559423-31559445 AGCCTGGCTGGCTTTGGGTGTGG - Intergenic
1010999348 6:82570340-82570362 TGCCTGTCTGTCTGTGAGTGGGG + Intergenic
1012594628 6:101024931-101024953 TGCCAGGCTGGCTTGAAGAGTGG - Intergenic
1014880589 6:126719224-126719246 TTGCTGGCTGGCTGTGTGAGAGG + Intergenic
1017841656 6:158227248-158227270 TGCCTGGCTGGCTGTGACTATGG + Intergenic
1018983300 6:168616406-168616428 TGCGAGGCTGTCTGTGAGAGAGG + Intronic
1019023768 6:168941258-168941280 TGCCTGGCTGGACGTGAGAGTGG + Intergenic
1021013075 7:15495746-15495768 TGGCTGGCTGTCTATGAGCCAGG - Intronic
1022130676 7:27401727-27401749 TGGCTGGAGGGCTATGAGAGAGG - Intergenic
1023512771 7:40970756-40970778 TGCCTGGCTGGGTGGGAGTGGGG + Intergenic
1024061886 7:45704227-45704249 TGCCTGGCTGGCTGTCGGGGTGG - Intronic
1025114735 7:56247989-56248011 TGACAGGCTTGCAATGAGAGAGG + Intergenic
1029536579 7:101160967-101160989 TGCCTGGCTGGCTAGGGGGAGGG - Exonic
1030507673 7:110445340-110445362 TGCTTGGCTGAGTCTGAGAGTGG - Intergenic
1030761326 7:113356096-113356118 TCTGTGGCTGGCTCTGAGAGTGG + Intergenic
1032475017 7:132205651-132205673 TGCCTGGATGGCTCTGAGCAGGG + Intronic
1032934905 7:136717546-136717568 TGACTGTCTGGCTGTGGGAGAGG + Intergenic
1034020893 7:147641113-147641135 TGCCGGCCTGGCTCTAAGAGCGG + Intronic
1034393394 7:150802344-150802366 TGCTTGACTGCCTGTGAGAGGGG + Intronic
1034932346 7:155172417-155172439 AGCCTGGCTGGAAATGTGAGGGG + Intergenic
1035247150 7:157570388-157570410 TGCATTCCTGTCTATGAGAGAGG - Intronic
1035259318 7:157651597-157651619 TGCCTGGCTGGCTCTGAGTGAGG - Intronic
1036658581 8:10693110-10693132 TGCCTGGCTGGAGATGAGGCTGG - Intronic
1040415801 8:47194335-47194357 TGACTGACTGGCTATGACAGTGG + Intergenic
1040549439 8:48427305-48427327 CACATGGCTGGCTGTGAGAGCGG - Intergenic
1042424585 8:68632614-68632636 TGCCAGGCTTGCGATGGGAGGGG - Intronic
1043278323 8:78430387-78430409 TGCCTGGGTGGCTAAAAGATGGG - Intergenic
1044615614 8:94137353-94137375 TGGCAGCCTGGCTAGGAGAGGGG - Intronic
1046867430 8:119166209-119166231 TGTGTGGCTGGCTCTGAAAGAGG + Intronic
1047839701 8:128737915-128737937 TGCCTGGCTGTGGATGAGGGAGG + Intergenic
1048954891 8:139527509-139527531 TGACTGGCTGGCTATGTGTGTGG + Intergenic
1049446218 8:142632729-142632751 TGCCTCACTGGCTATGAGTGTGG - Intergenic
1052746950 9:32450185-32450207 TCCCTGGCTGCCTCTGGGAGGGG + Exonic
1055385989 9:75762773-75762795 TGCTTTGCTAGCAATGAGAGAGG + Intergenic
1055723287 9:79199624-79199646 TGCCTGGCAGGAGAGGAGAGAGG - Intergenic
1056924185 9:90818916-90818938 TGCCTGGTTTCCTATTAGAGGGG - Intronic
1057283033 9:93726391-93726413 TGCGTGGCTTGATCTGAGAGTGG + Intergenic
1060348521 9:122837628-122837650 TGCCTGGCCGGTCAGGAGAGAGG + Intergenic
1060396796 9:123321949-123321971 TACCTGGCTGGAGATGAGGGTGG - Intergenic
1060481690 9:124019951-124019973 TGCCTGGCTGGCATTGGGGGTGG - Intronic
1060918448 9:127404733-127404755 GGCCTGGATGCCTCTGAGAGGGG - Intronic
1061033523 9:128100937-128100959 TGCCATGGTGGCTCTGAGAGTGG + Intronic
1061080634 9:128367737-128367759 TGACTGTTTGGATATGAGAGAGG + Intergenic
1062514643 9:136926461-136926483 GGCCAGGCTGGCTGTGGGAGAGG + Exonic
1189260637 X:39676204-39676226 TGTCTGGCTGGCGATCACAGGGG + Intergenic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1192229524 X:69255561-69255583 TCCCTGACTGGCTATGATGGGGG - Intergenic
1195322031 X:103728231-103728253 AGCCTGGCTGCCAATGTGAGAGG + Exonic
1201072076 Y:10156115-10156137 CGCCTGGCTGGGGAAGAGAGTGG - Intergenic
1202047991 Y:20753330-20753352 TGCCTGGCTGCCTCCCAGAGGGG + Intergenic