ID: 1137611864

View in Genome Browser
Species Human (GRCh38)
Location 16:49823598-49823620
Sequence TGCTCTGCAACATTCCGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137611864 Original CRISPR TGCTCTGCAACATTCCGAAA GGG Intronic
900543720 1:3217006-3217028 TGCCCTGCAACATTTGGACATGG - Intronic
903832381 1:26182939-26182961 TTCTCAGCAACATTCCTAAAGGG - Intronic
904045313 1:27604819-27604841 TGCTCAGCAGAATTCGGAAAAGG - Intergenic
909132352 1:71753784-71753806 TGCTCTGTAACATTTCAGAATGG + Intronic
910193638 1:84619744-84619766 TGTTCTACAACATTCAGAAATGG - Intergenic
911403403 1:97405885-97405907 TGCTCTGCCATATTATGAAATGG + Intronic
917578996 1:176355075-176355097 TGCTCTGCAAGATTGGGAATAGG - Intergenic
918043278 1:180926159-180926181 TGCTCTGGAAAATTCCTAGAAGG - Intronic
923004696 1:230037960-230037982 TGCTATGCAATATTCAGGAAAGG - Intergenic
1063013959 10:2055922-2055944 TGTTCTCCGACATTCTGAAATGG - Intergenic
1068495949 10:57785775-57785797 TGCTGGGCAACATTCCCAAGAGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1072301519 10:94066690-94066712 TGCTCTGCAACTTCCCGACTGGG + Intronic
1090968284 11:131617193-131617215 CTCTCTGCAACATTCCCAAGCGG - Intronic
1094046220 12:26169870-26169892 TGCTCTGCAACCCTCAGAAAAGG - Intronic
1095409488 12:41906657-41906679 TGCTCTACAACATTTTTAAAAGG + Intergenic
1095436876 12:42198683-42198705 TGCTCTGTAAAATTCCGAAATGG + Intronic
1096908528 12:54959378-54959400 TGCTCTGCTGCATTTCAAAATGG + Intronic
1098069346 12:66655343-66655365 TTCTCTGCAAAATTGAGAAAAGG + Intronic
1098955459 12:76684854-76684876 TGTACTGGAACATTCCAAAATGG - Intergenic
1099643673 12:85322913-85322935 TGCTTAGCAACGTTCTGAAATGG + Intergenic
1107535721 13:41328583-41328605 TGAACTGCAACATGCCCAAAGGG + Intronic
1116016769 14:39417153-39417175 TGTTCTGCAAGATTGGGAAAAGG - Intronic
1117652130 14:57918108-57918130 TGCTCTGGCACATCCCAAAATGG + Intronic
1119796033 14:77398337-77398359 TGCTCTGCCATATTTCAAAATGG - Intronic
1123986905 15:25654218-25654240 TTCTCTGACACATTCTGAAATGG - Intergenic
1126323128 15:47446694-47446716 TGTCCTGCATCCTTCCGAAAGGG + Intronic
1127885954 15:63201170-63201192 TGGTCTGCAAAATTTTGAAACGG + Intronic
1131034796 15:89215087-89215109 TGCTCTTCAACATTGAGAACTGG - Exonic
1131969898 15:97881516-97881538 TGCTCCGCAGCATCCAGAAATGG + Intergenic
1137611864 16:49823598-49823620 TGCTCTGCAACATTCCGAAAGGG + Intronic
1144226467 17:13153121-13153143 TGCTCTGGCACATTTCAAAATGG + Intergenic
1149893056 17:60407196-60407218 TGCTGTGCAAAATTCCAAAAAGG + Intronic
1151301241 17:73228473-73228495 TACTCTGCAACATTCTGAATAGG + Intronic
1158095133 18:53761847-53761869 TGCTCTGCAACAATTCTACACGG + Intergenic
927037613 2:19195763-19195785 TGCTGTGCCACATTCAGCAAGGG - Intergenic
928453006 2:31395468-31395490 TGCTCTGGCATATTCCAAAATGG + Intronic
946730023 2:222700414-222700436 TTCTCTTAAACATTCAGAAAGGG + Intronic
947406353 2:229781552-229781574 TGATCTTCCACATTCCCAAAAGG + Intronic
1171346136 20:24468308-24468330 TGGTCTGGAACACTCAGAAACGG - Intergenic
1173881869 20:46420716-46420738 TTCTCTGCATCTTTCAGAAATGG + Intronic
1178424974 21:32471929-32471951 TTCTCTGCAATATTAAGAAATGG - Intronic
1182122374 22:27796481-27796503 TACTCTACAAGATTCCCAAAGGG + Intronic
1182290083 22:29269795-29269817 TGCTCTGCAAAAGCCTGAAAAGG + Intronic
1183032934 22:35118916-35118938 TGCTTTGCAGCATTGAGAAAAGG + Intergenic
957360450 3:79149894-79149916 TGCTCTGGCACATTTCAAAATGG + Intronic
957794960 3:84992333-84992355 TGCTATTTAACATTCAGAAAGGG + Intronic
965778756 3:172261154-172261176 TGCCCTGCTACATTGCGGAAGGG + Intronic
969313592 4:6368492-6368514 TGCTCTGCAACATGCGGACAGGG + Intronic
970201098 4:13607175-13607197 TTCTCTTCAACATTCCTAAGGGG + Exonic
970508298 4:16755180-16755202 GGTTCTGCTACATTCCTAAAAGG + Intronic
971774976 4:30951493-30951515 TGCTCTGCATCTTTCCCAGAGGG + Intronic
973812295 4:54583340-54583362 TCCCCTTCAACATTCAGAAACGG - Intergenic
975925974 4:79454089-79454111 TGCTCCCCAACATTCGCAAAAGG + Intergenic
976949395 4:90810757-90810779 TGCTATGGAGCATTCCCAAAGGG + Intronic
977768314 4:100827173-100827195 TGCTCTGCAACCCTCCCACAAGG + Intronic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
981510052 4:145546381-145546403 TGCTCTGTAATATGCAGAAATGG - Intronic
982512271 4:156297898-156297920 TCCTCTGCCACGTTCTGAAACGG + Intergenic
984209419 4:176827185-176827207 TGCTCTGCAAAAATGCTAAAGGG + Intergenic
984866671 4:184286551-184286573 TGCTCAGCAACATTTCTGAAGGG + Intergenic
987181323 5:15371579-15371601 TGCTTTGCTACATTCCTTAAAGG - Intergenic
988176659 5:27735282-27735304 AGATCTGCAAAATTCCTAAAAGG - Intergenic
988648053 5:33117790-33117812 TGCTCTGGCACATTTCAAAATGG + Intergenic
990774789 5:59293902-59293924 AGCTCTGCAACAGTATGAAAAGG + Intronic
996807695 5:127475876-127475898 TGCTCTGGAATATTTCAAAATGG + Intergenic
998970574 5:147586964-147586986 TGCCCTGCCCCATTCTGAAATGG + Intronic
999116276 5:149166470-149166492 TCCTCTTCAGCATTCCAAAATGG + Intronic
1002084700 5:176766527-176766549 TGCTCTGGCACATTTCAAAATGG + Intergenic
1002694258 5:181073657-181073679 TGCTCTGCTGCATTTCCAAATGG - Intergenic
1002815394 6:675558-675580 TACTCTTCAACATTACGGAAAGG + Intronic
1002815410 6:675664-675686 TACTCTTCAACATTACGGAAAGG + Intronic
1002815419 6:675717-675739 TACTCTTCAACATTACGGAAAGG + Intronic
1002815434 6:675825-675847 TACTCTTCAACATTACGGAAAGG + Intronic
1002815441 6:675878-675900 TACTCTTCAACATTACGGAAAGG + Intronic
1002815456 6:675986-676008 TACTCTTCAACATTACGGAAAGG + Intronic
1002815473 6:676092-676114 TACTCTTCAACATTACGGAAAGG + Intronic
1002815482 6:676147-676169 TACTCTTCAACATTACGGAAAGG + Intronic
1002815491 6:676200-676222 TACTCTTCAACATTACGGAAAGG + Intronic
1002815500 6:676253-676275 TACTCTTCAACATTACGGAAAGG + Intronic
1002815509 6:676308-676330 TACTCTTCAACATTACGGAAAGG + Intronic
1002815518 6:676363-676385 TACTCTTCAACATTACGGAAAGG + Intronic
1002815527 6:676418-676440 TACTCTTCAACATTACGGAAAGG + Intronic
1002815536 6:676473-676495 TACTCTTCAACATTACGGAAAGG + Intronic
1002815545 6:676528-676550 TACTCTTCAACATTACGGAAAGG + Intronic
1002815554 6:676583-676605 TACTCTTCAACATTACGGAAAGG + Intronic
1002815563 6:676638-676660 TACTCTTCAACATTACGGAAAGG + Intronic
1002815572 6:676693-676715 TACTCTTCAACATTACGGAAAGG + Intronic
1002815590 6:676801-676823 TACTCTTCAACATTACGGAAAGG + Intronic
1002815599 6:676856-676878 TACTCTTCAACATTACGGAAAGG + Intronic
1002815615 6:676964-676986 TACTCTTCAACATTACGGAAAGG + Intronic
1002815622 6:677017-677039 TACTCTTCAACATTACGGAAAGG + Intronic
1002815629 6:677072-677094 TACTCTTCAACATTACGGAAAGG + Intronic
1002815635 6:677125-677147 TACTCTTCAACATTACGGAAAGG + Intronic
1002815651 6:677233-677255 TACTCTTCAACATTACGGAAAGG + Intronic
1005829417 6:29658647-29658669 TGCTGTGCCACATTCCAAGAGGG + Intronic
1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG + Intronic
1016101445 6:140106029-140106051 TGTTCTGCTACATTTCAAAATGG + Intergenic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1024539920 7:50467917-50467939 CGCTCTGTCACATTCAGAAACGG + Intronic
1026329577 7:69340015-69340037 TCCTCTGCAACATTCCCAGCAGG + Intergenic
1028477551 7:91267215-91267237 TCCTTTGCAATACTCCGAAAAGG - Exonic
1030734862 7:113035827-113035849 TGCATTGCAAGATTCTGAAAAGG - Intergenic
1032540302 7:132697376-132697398 TGCTCTCCCAGATTCAGAAAAGG - Intronic
1035656355 8:1309563-1309585 TGCTCTACAAGAATGCGAAAGGG + Intergenic
1037694459 8:21211173-21211195 GGCTCTGCAAGAGTCAGAAAGGG + Intergenic
1038094899 8:24297408-24297430 TTCTCAGCACCATTCAGAAATGG - Intronic
1042960626 8:74300279-74300301 TGCTCTGCCACATTCCATGAAGG - Intronic
1046502253 8:115093700-115093722 TGCTCTGCTATATTTCTAAATGG + Intergenic
1049123764 8:140766665-140766687 TGCACTGCAACAATCAGTAAAGG + Intronic
1050467122 9:5938675-5938697 TGTTGTGCAACATTTCCAAAAGG + Intronic
1051275335 9:15393022-15393044 TGTTCTGGAAAATTCTGAAATGG + Intergenic
1056453309 9:86737487-86737509 TGCCCTGCAAGCTTCTGAAAGGG + Intergenic
1059502187 9:114764634-114764656 AGCTATGCAACATTCTGGAAAGG + Intergenic
1060141481 9:121214025-121214047 TGCCCTGCACCATTCAGATAAGG - Intronic
1188408988 X:29848482-29848504 TGCTCTGCACAAGTCTGAAAAGG - Intronic
1189399559 X:40654392-40654414 TGGTCAGCAACATTCTGAAGAGG - Exonic
1195352378 X:104007455-104007477 TGCTCTGCGGCATACCAAAAGGG + Intergenic
1198347603 X:135774092-135774114 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198349508 X:135791353-135791375 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198351413 X:135808626-135808648 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198353322 X:135825892-135825914 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198355229 X:135843146-135843168 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198357139 X:135860429-135860451 TGTTCTTCAACATCCTGAAATGG + Intergenic
1198359053 X:135877708-135877730 TGTTCTTCAACATCCTGAAATGG + Intergenic
1202340593 Y:23860962-23860984 AACTCTGCATCATTCTGAAATGG + Intergenic
1202530173 Y:25809120-25809142 AACTCTGCATCATTCTGAAATGG - Intergenic