ID: 1137612804

View in Genome Browser
Species Human (GRCh38)
Location 16:49830184-49830206
Sequence CAGAAGAAGGAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1365
Summary {0: 1, 1: 1, 2: 9, 3: 178, 4: 1176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137612799_1137612804 9 Left 1137612799 16:49830152-49830174 CCGCGCAGAAGAGGTGACATTGA 0: 1
1: 0
2: 7
3: 49
4: 313
Right 1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG 0: 1
1: 1
2: 9
3: 178
4: 1176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137612804 Original CRISPR CAGAAGAAGGAGAAGGAGCC AGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900123946 1:1061386-1061408 CCGAAGGAGGAGGAGGAGCTGGG + Intergenic
900281521 1:1872650-1872672 CTGAAGGATGAGAAGGAACCAGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900667875 1:3827821-3827843 CAGACGAGGGAGAAAGACCCAGG - Intronic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903075903 1:20765994-20766016 CAAAACAAGAAAAAGGAGCCAGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903680462 1:25093040-25093062 CAGAAGCAGATGAGGGAGCCTGG + Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904475637 1:30762946-30762968 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905028817 1:34868172-34868194 CAGAAGAGGGAGATTCAGCCAGG - Intronic
905199917 1:36308313-36308335 CATAAGAAGGAGTGGGACCCCGG + Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906066510 1:42984849-42984871 GGGAAGAAGGAGGAGGAGCGGGG + Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906339498 1:44966452-44966474 AAAAAGAAGAAGAAGAAGCCTGG + Intronic
906577340 1:46902678-46902700 CAGAAGAAGCAGAAGTACACTGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908083761 1:60608656-60608678 CAGGAGGATGAGAAAGAGCCTGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908623678 1:66015289-66015311 CAGAAGTAGGAGGAGCAGCTAGG - Intronic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
908806480 1:67937920-67937942 CAGAAGGACAGGAAGGAGCCAGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
910009222 1:82439876-82439898 AAGAAGTATGAGAAGGAGCAGGG + Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910798724 1:91123901-91123923 AGGAAGAAGGAAAAAGAGCCTGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911427798 1:97742268-97742290 CAAAAGAATGACAAGGAGACTGG - Intronic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911749856 1:101483602-101483624 CACCAGAATGAGAAAGAGCCTGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912639854 1:111334495-111334517 CACAAGAAAGAGAAGCAGACAGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913447193 1:118962012-118962034 CAGAAGAACTACAAGAAGCCAGG + Intronic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
913667030 1:121058032-121058054 CAAAAGAAAGAGAAAGGGCCGGG + Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914912678 1:151800180-151800202 AAGCAGAAAGAGAAGGAGCTGGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915557779 1:156669890-156669912 CAGGAGGAGGGGAGGGAGCCAGG - Exonic
915659419 1:157389831-157389853 CAGCAGAATTAGAAGGATCCAGG + Intergenic
915725123 1:158011770-158011792 CAGCAGTGGGGGAAGGAGCCTGG + Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916267331 1:162903891-162903913 CAGAAGAAAGTGAAGGAACTGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920262781 1:204700878-204700900 AAGAAGAAGAAGAAGGATCAGGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920968452 1:210721648-210721670 CAGAAGCCGTAGAAGGAGCGGGG + Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923016514 1:230130637-230130659 GAGCAGAAGGACAAGCAGCCCGG + Intronic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923489007 1:234466565-234466587 AAAAAGAAGAAGAAGAAGCCAGG + Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924375895 1:243408493-243408515 AAGAAGAAGGAGAACTAGCTTGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1062964750 10:1598678-1598700 CAGAAGATGCAGAAGGCCCCAGG + Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064322255 10:14316528-14316550 AAGAAGAAGAAGAAGAAACCAGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067513826 10:46919468-46919490 AAAAAGAAGGAGAAGAAGCATGG - Intronic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1067648428 10:48132366-48132388 AAAAAGAAGGAGAAGAAGCATGG + Intergenic
1068113469 10:52709511-52709533 AAGAAGAAGAAGAAGAAACCAGG - Intergenic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069219081 10:65860709-65860731 CAGAAGAAGAAGAAAGAAACAGG + Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1071982146 10:91014228-91014250 AAGAAGAAAGGGCAGGAGCCTGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072725670 10:97811818-97811840 AAGAAGAAGTAGAAGCATCCTGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074112272 10:110431083-110431105 CAGAAGGAGGAGCAGGGGCTAGG - Intergenic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075151544 10:119937173-119937195 CATAAGAAAGAAAAGGACCCTGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075708417 10:124517106-124517128 CAAAAAAAGATGAAGGAGCCCGG + Intronic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077076199 11:703297-703319 CAGGAGTGGGAGCAGGAGCCAGG + Exonic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079152408 11:17912170-17912192 GAGAAGATGGTGAAGGAGACAGG + Intronic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080325019 11:31061565-31061587 AAGAAGAAGAAGAAGGCACCTGG + Intronic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1081877866 11:46422571-46422593 GAAAAGAATGAGAGGGAGCCAGG + Intronic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1084063502 11:66690388-66690410 AAGAAGCAGGGGGAGGAGCCAGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086286112 11:85253479-85253501 TAGAAGCAGGTGCAGGAGCCAGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088412240 11:109547352-109547374 CATAAGAAAGAGAGGGAGACAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088960933 11:114663535-114663557 CAGGAGATGGTGAAGGGGCCTGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090083942 11:123634259-123634281 CACAAGATGGGGAAGGAGCAGGG + Intronic
1090274045 11:125407273-125407295 CACAAGGTGGAGAAGCAGCCAGG + Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092203532 12:6602036-6602058 AAGAAGAAGAAGAAGAAGCTTGG - Exonic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092948369 12:13477142-13477164 ATGAAGATTGAGAAGGAGCCAGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093246975 12:16750831-16750853 CATAAGAAGGAGAAAAAGCAAGG - Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095259591 12:40082928-40082950 CAGAAGAAGGATACAGACCCCGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095943649 12:47741399-47741421 GAGAAGAGGGAGGAGGGGCCTGG - Intronic
1095945981 12:47753625-47753647 AATGAGAAGGAGGAGGAGCCAGG + Intronic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096707079 12:53429095-53429117 CAAAAGAGGGAGGAAGAGCCGGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099813818 12:87620057-87620079 CAGAAGAGAGAGAAGGATCTGGG - Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100320624 12:93488263-93488285 CAAAAGAAGAAAAAAGAGCCAGG - Intronic
1100428926 12:94512993-94513015 CAGAAGACGAAGGAGGAGCAAGG + Intergenic
1100670571 12:96807792-96807814 CCAAAGAAGGGTAAGGAGCCAGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102329009 12:112013500-112013522 CAGGAGAAGGGGAAGCAGCGGGG - Exonic
1102461055 12:113099887-113099909 CGGAAGGAGGAGCAAGAGCCAGG - Exonic
1102508780 12:113400310-113400332 AAGAAGAAAGAGAATTAGCCAGG + Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1103034680 12:117646954-117646976 GAGGAGAGGGAGAAAGAGCCAGG + Intronic
1103119451 12:118369025-118369047 AAGAAGAAGAAGAAAAAGCCAGG + Intronic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103438380 12:120944742-120944764 TGGAAGAAGGAGAAGGCGCACGG - Intergenic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103904247 12:124319374-124319396 CAGATGGAAGCGAAGGAGCCAGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1105602784 13:21901978-21902000 GAGAAGCTTGAGAAGGAGCCAGG - Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106017793 13:25885449-25885471 CAAAAGAAGGAGAGAGGGCCAGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107483790 13:40807385-40807407 CCGAAGAAGAAGAAATAGCCTGG - Exonic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1111716767 13:91888140-91888162 CAGAAGATGTAGGAGGAGCAAGG + Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112744840 13:102514894-102514916 AAGAAGAAGGAAGAGGAGCAAGG + Intergenic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113647861 13:112011640-112011662 AAAAAGAAGGAGAAGAGGCCGGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114519112 14:23321755-23321777 CAAGAGGAGGAGGAGGAGCCGGG + Exonic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118916059 14:70107303-70107325 CAGTAGATGTATAAGGAGCCTGG - Intronic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1119196098 14:72717762-72717784 CAGCAGAAGGAGCAGGACCTAGG + Intronic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119829160 14:77685566-77685588 CAGAAGTTGGAGAACCAGCCTGG + Intronic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120246788 14:82016136-82016158 CTGATGAACGAAAAGGAGCCAGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120469498 14:84904240-84904262 CACATGTTGGAGAAGGAGCCTGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122662161 14:103303714-103303736 AAGAAGAAGAAGAAGCAGCTAGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122671969 14:103379487-103379509 CAGGACAAGGACAAGGACCCTGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126049662 15:44674392-44674414 CAGGAGAGGGAGAGGGATCCTGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1130610253 15:85354741-85354763 CAGAAGAAGCAGAAGTCACCGGG + Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132121486 15:99179733-99179755 CAGAAGCAGGTGGAGGGGCCTGG + Intronic
1132227208 15:100151641-100151663 CAGAAGTAGGGGAACCAGCCAGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG + Intergenic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135582574 16:23641102-23641124 GAGGAGAAGGAAAAGGTGCCGGG - Exonic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1136612213 16:31373117-31373139 AAGAAGAAGAAGAAGAACCCAGG + Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138649363 16:58450296-58450318 AGGATGGAGGAGAAGGAGCCTGG + Intergenic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139458876 16:67106607-67106629 CAATAGAAGCAGAAGGTGCCTGG - Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1139988568 16:70920682-70920704 GGGAAGAAGGAGAAGGACCTGGG - Exonic
1140088320 16:71816189-71816211 CAGAAGAAGGAGAGGTTGCTGGG + Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1140899590 16:79355485-79355507 GAGAAGTGAGAGAAGGAGCCTGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141158621 16:81613995-81614017 CAGAAGAAGGACAACTAGACAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142876933 17:2856802-2856824 CAGAAGAACGGGATGAAGCCAGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143591844 17:7889729-7889751 AAGCAGAAGGAGAACAAGCCAGG + Exonic
1143638859 17:8183845-8183867 GAGGAGGAGGAGACGGAGCCGGG - Intergenic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143808818 17:9453786-9453808 CATAAGAAAGACAAGTAGCCAGG - Intronic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1144035033 17:11357214-11357236 AAGAAGAAGAAGAAGAAGCAGGG + Intronic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1145372701 17:22320412-22320434 TTTAAGAAGGACAAGGAGCCGGG + Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147864475 17:43543645-43543667 CAGAAGAAGGATGGGGAGACGGG + Intronic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1147954597 17:44125298-44125320 CAAAAGAAGAAGAAGAGGCCAGG + Intergenic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1150142534 17:62742434-62742456 CACAAAATGGAGTAGGAGCCAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150482501 17:65521423-65521445 AGGAAGAAGAAGAAGAAGCCAGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150667255 17:67152829-67152851 CAGAAGCTGGGAAAGGAGCCTGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150765305 17:67997364-67997386 GAAAAGAAAGAGGAGGAGCCAGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153443507 18:5147201-5147223 CAGAAGGAAAAGAAGGAGCTTGG + Intronic
1153643391 18:7174443-7174465 AAGAAGAAGAAGAAGGACCGTGG + Intergenic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1154315507 18:13300549-13300571 CAGGAGAAGGAGAGGGTTCCGGG - Intronic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1155635264 18:27945598-27945620 CATGAGAGGGAAAAGGAGCCTGG + Intergenic
1156286835 18:35705038-35705060 ACGAAGAAGGAGAGAGAGCCAGG - Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157702129 18:49768077-49768099 AGGAAGAGAGAGAAGGAGCCAGG - Intergenic
1158134995 18:54198335-54198357 TAAAAGCAGGAGAAGGAGCTTGG - Intronic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158555642 18:58472549-58472571 TGGAAGAAGGATAAAGAGCCTGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159200934 18:65183221-65183243 CACAAGAAGAAGAAGAGGCCAGG + Intergenic
1159355491 18:67334161-67334183 CAGAAGAAGAAGAAGATGCCAGG + Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160073130 18:75645664-75645686 CAGAAGAATGAGGAGGATTCCGG + Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161299943 19:3537714-3537736 GAGAAGAGGGTGAAGGAGCTGGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162570983 19:11472767-11472789 GAGAAGGAGAAGAAGAAGCCAGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163632457 19:18424418-18424440 CAGATGGAGGAGACGGAGCAGGG + Intronic
1163764193 19:19153328-19153350 CAGAAGGAAGAGCAGGTGCCAGG + Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164595020 19:29526733-29526755 AAGAAGAAAGAGAACGAACCGGG + Intronic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164741298 19:30577577-30577599 CAGAAGAACTAGAATGACCCAGG - Intronic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1165050290 19:33137089-33137111 AAGAAGAAAGAAAATGAGCCAGG - Intronic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165726579 19:38117109-38117131 CAGAAGCAGGAGAGGTAACCAGG - Intronic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1165836866 19:38763136-38763158 AAAAAGAAGAAGAAGAAGCCAGG + Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166073094 19:40397924-40397946 AAGAAGAAGAAGATGGTGCCTGG - Exonic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166168266 19:41007920-41007942 CAGAAGAACCAGAAGCAGTCTGG - Intronic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1166453439 19:42919930-42919952 CAGAAGAGGGAGCAGCAGCGTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166937822 19:46345570-46345592 CATAAGAAGGTGACAGAGCCAGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167270187 19:48501971-48501993 CAGGAGAGGGAAGAGGAGCCAGG - Intronic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167539090 19:50074086-50074108 AAGAAGAAGAAGAAGAAGCTGGG + Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168531131 19:57130186-57130208 CAGATGAATGATAAGGACCCTGG - Exonic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
926213587 2:10889822-10889844 CAGAAGCTGTAGGAGGAGCCAGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927107035 2:19836628-19836650 TAAAAGAAGTAGAAGAAGCCCGG - Intergenic
927292828 2:21421467-21421489 AGGAAGAAGAAGAAGGAGCTTGG + Intergenic
927338208 2:21950039-21950061 GAAAAGAAAGAGAAGGAGACAGG - Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
927951826 2:27175611-27175633 TAGAACGGGGAGAAGGAGCCAGG - Intergenic
928124349 2:28605535-28605557 CAGATGAAGGAGTGGGATCCTGG - Intronic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929462997 2:42118307-42118329 CAGAAGCAGGAGAAAGACCTAGG - Intergenic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931223703 2:60310989-60311011 AAAAAGAAGAAGAAGAAGCCTGG + Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932169306 2:69539145-69539167 GAGAAGAAAGCCAAGGAGCCTGG + Intronic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932442917 2:71749220-71749242 CAGGAGAAGGAAAAGCAGCTGGG + Intergenic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
933652711 2:84862189-84862211 AGGAAGAAGGGCAAGGAGCCAGG - Intronic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
933998740 2:87688910-87688932 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
934107899 2:88712854-88712876 AAGAAGAAGAAGAAGAAGCAAGG - Intronic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935104087 2:100023525-100023547 CAGAAGAGGGAGAAACAGCAAGG + Intronic
935646216 2:105337450-105337472 CAGCAGCGAGAGAAGGAGCCCGG + Exonic
935723042 2:105996698-105996720 CAGATGAAGGGCAAGGAGCAGGG - Intergenic
936295110 2:111261968-111261990 AAGAAGAAGAAGAAGAAGCATGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936517307 2:113190210-113190232 CACAAGAAGGAGAATGACACTGG - Intronic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937868711 2:126772499-126772521 CAGAAGGAGAAGGGGGAGCCAGG + Intergenic
937911504 2:127077879-127077901 CACAAGAATGAGAAGGAAACGGG + Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938899432 2:135787405-135787427 CAGACGAAGGAGAATCTGCCTGG + Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
943188135 2:184640183-184640205 AAGAAGTAGGAGGAGGAGCAGGG + Intronic
943262069 2:185678756-185678778 AAGAAAATGGAGAAGGCGCCAGG - Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944198608 2:197081671-197081693 CAGAAGAACTTGAAAGAGCCAGG - Intronic
944641129 2:201727154-201727176 CACAAGAGGCAGAAAGAGCCAGG + Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
945414791 2:209557655-209557677 CTGAAGAGTGAGAATGAGCCAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945916902 2:215713910-215713932 CAGAAGAAAGTGGAGGAACCTGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946579904 2:221117152-221117174 CTGAAGTACGAGAAGGAACCAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947357835 2:229315699-229315721 CAGAAGTGAGGGAAGGAGCCAGG + Intergenic
947502415 2:230681022-230681044 CTGAAGAACGAGCAGAAGCCAGG + Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169940037 20:10927033-10927055 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170477446 20:16730013-16730035 CAAAAGCAGGAAACGGAGCCAGG - Exonic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170916908 20:20635133-20635155 GAGGAGAATGAGGAGGAGCCAGG + Intronic
1170930235 20:20762855-20762877 CAGGAGATGGAGAAGCACCCAGG - Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171427583 20:25058243-25058265 CAGAAGAAGGGGTGGGACCCGGG - Intronic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172336223 20:34118248-34118270 CAGAAGGAGAAGAATAAGCCAGG + Intergenic
1172502543 20:35437471-35437493 CTGAAGAAGGCCAGGGAGCCCGG - Exonic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172849113 20:37947811-37947833 CAAAAGAAGAAGAAGGTGCCTGG + Intergenic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175200512 20:57273797-57273819 CAGAAGAAGGAGAAAAGGCAGGG - Intergenic
1175471618 20:59233975-59233997 CAGAAGTAGAAGAAGCAGACAGG - Intronic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1181622589 22:24101136-24101158 CAGCAGTGGGAGAGGGAGCCAGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182318775 22:29464860-29464882 CGGGAGAAGGGGAAGGGGCCTGG - Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183015762 22:34985182-34985204 CACAAGAAAGTGAAGGAACCAGG - Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183971219 22:41478974-41478996 CTGCAGAAGGTCAAGGAGCCCGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1184899424 22:47435233-47435255 CACAAGGAGGAGACAGAGCCAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
950606515 3:14086116-14086138 TAAAAGAAGGAAAAAGAGCCAGG - Intergenic
950665940 3:14494997-14495019 CAGAAGGAGGAGGAGGTTCCTGG + Intronic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954317965 3:49811548-49811570 CAGAAGAGGAAGCAGAAGCCTGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955034727 3:55256224-55256246 CCGAAGGATGAGAAAGAGCCAGG + Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956007675 3:64798140-64798162 CAGACCAAGTAGAAGGACCCAGG - Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957325109 3:78681607-78681629 CTTAAGACGGAGAAGCAGCCAGG + Intronic
957621535 3:82599337-82599359 CAGAAGAATGAAAAAGACCCTGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960051450 3:113242556-113242578 AAGCAGAAAGGGAAGGAGCCAGG - Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961241119 3:125412502-125412524 AAAAAGAAGAAGAAGAAGCCAGG + Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965157533 3:165083509-165083531 CAGAAGAAGGTGAACGATCTAGG - Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967275423 3:187769450-187769472 CAGGAGAATGAGAAATAGCCAGG + Intergenic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971280203 4:25236726-25236748 CAGAAGATGAAGAAAGAACCAGG - Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971448690 4:26779516-26779538 GAAAAGAAAGAGAAGGACCCGGG - Intergenic
971793432 4:31198094-31198116 GAGGAGAAGGAGAAGGTACCAGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972696290 4:41449900-41449922 CTGAAGAAGGCCAAGAAGCCTGG - Intronic
973894256 4:55396230-55396252 CAGAAAGAGCAGAAGCAGCCGGG - Exonic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978562979 4:110053220-110053242 CAGAAGAAGAAGAAGAACCAGGG - Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978853688 4:113368800-113368822 AGGAAGAAGGAGAAGGACCAAGG + Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982410146 4:155066198-155066220 CGTAAGAAGGAGAATGAGCAAGG - Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983252550 4:165361258-165361280 AAGGAGAGGGAGAAGTAGCCAGG + Intronic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983637493 4:169912825-169912847 CGGAAGGTGGGGAAGGAGCCAGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
984523346 4:180826616-180826638 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985648509 5:1096620-1096642 AAGATGAAGGACCAGGAGCCTGG + Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985781558 5:1874333-1874355 CAGAAGGCAGAGAAGCAGCCAGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988134753 5:27156856-27156878 CACATGATGGAGAAGCAGCCTGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989262359 5:39432509-39432531 CCAGAGAAGGACAAGGAGCCTGG - Intronic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991189329 5:63851032-63851054 AAGAAGAAGTAGGAGGAGCAGGG + Intergenic
991965433 5:72086019-72086041 CACTAGAAAGAGAAAGAGCCTGG + Intergenic
992342816 5:75843781-75843803 AAGAAGAGGAAGAAGGACCCTGG + Intergenic
992554273 5:77888229-77888251 CAGAAGAAGGAGAACCTGCTAGG - Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996694045 5:126373794-126373816 CATAAGACTGAGAAGGAGCGTGG + Intronic
997180617 5:131825037-131825059 AAGAAGAAGAAGAAGAAGCTGGG + Intronic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997757917 5:136417566-136417588 CAGAAGAAAGAGTGTGAGCCAGG + Intergenic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998785834 5:145707864-145707886 GACAAGAAGGAGAGAGAGCCTGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999089170 5:148920563-148920585 CAGATGGAAGAGAGGGAGCCAGG + Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999473232 5:151874762-151874784 CTGAAGGGTGAGAAGGAGCCAGG + Intronic
999697306 5:154198525-154198547 CAGAAGAACTGGAAGAAGCCAGG + Intronic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1001073125 5:168604153-168604175 CAGAAGTAGACCAAGGAGCCGGG + Intergenic
1001174235 5:169450515-169450537 CAGAAGAAAGAGAAAATGCCAGG + Intergenic
1001440897 5:171742009-171742031 CAAAAGAATGAGGAGGGGCCAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002434884 5:179225154-179225176 CATGAGAGGGAGGAGGAGCCTGG - Intronic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004169341 6:13283787-13283809 CAGGAGGAGGAGCAGCAGCCTGG + Intronic
1004347610 6:14863117-14863139 CAAAAGTAGGAAAGGGAGCCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007317900 6:41004109-41004131 CAGCAGGAGAAGAAGCAGCCTGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397471 6:41585943-41585965 AAGAAGAAGGGGAAGAAGCTGGG - Intronic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008253584 6:49270419-49270441 CAGAAGATAGAGAAGGTTCCTGG - Intergenic
1008810688 6:55494031-55494053 CTAAAGAATGAGAAGGGGCCAGG - Intronic
1009512392 6:64569444-64569466 AAAAAGAATGAAAAGGAGCCGGG + Intronic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011082743 6:83507715-83507737 TATAAGAAAGAGAAGGAGCTGGG + Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011179077 6:84598851-84598873 CATAACAAGGAGCAGGAGCTGGG - Intergenic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012413469 6:98987042-98987064 CAGAAGAAGGACAAGAATCTGGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1013012378 6:106132367-106132389 TAAAAGAAAGAGAAGGAACCGGG + Intergenic
1013290869 6:108717635-108717657 CCCAAGACGGAGAAGGAGCGGGG - Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013649273 6:112177635-112177657 CAGAAGAAAAGGAAGGAGCGGGG - Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016454604 6:144217357-144217379 CGGAAGAAGCCGAAGGAGACAGG - Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017081554 6:150674118-150674140 AAGAAGAAGGTGGAGGAGCTGGG - Intronic
1017201428 6:151758776-151758798 AAGAAGAAGGAGAGGAAGCTGGG + Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017397263 6:154016817-154016839 CAGCAGAAAGAGACGGAGTCTGG + Intronic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020998982 7:15303687-15303709 CAGAAGAAGGAAGTGGAGCATGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021645787 7:22788285-22788307 CAGAACAAGCAAAAAGAGCCAGG + Intergenic
1021751887 7:23809089-23809111 AAGAAGAAGGTGAAGTAGCTAGG - Intronic
1021934540 7:25616738-25616760 CACAAGAAGGAAAAGGAGAAAGG + Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022193957 7:28045330-28045352 CAAAAGAAGGGGAAGCTGCCAGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022605999 7:31814829-31814851 CAGTAGAAGGTTAAGTAGCCTGG + Intronic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1023854678 7:44175481-44175503 CAGGAGAATGAGAGGGGGCCAGG + Intronic
1023909938 7:44546691-44546713 AAGAAGAAGAAGAAGCCGCCAGG + Intergenic
1024219367 7:47275964-47275986 CATCAGAAGGATAAGGAACCTGG + Exonic
1024222539 7:47299755-47299777 CAGAAGTAGGCTGAGGAGCCTGG + Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024522180 7:50315073-50315095 CAGAAGCCGGACTAGGAGCCGGG - Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1025823097 7:64989776-64989798 AAGAAGAAGAAGAATAAGCCAGG + Intronic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026675699 7:72426183-72426205 CAGAAGAAGGTGAGGGGCCCAGG + Intronic
1026941853 7:74291686-74291708 CTGAAGAAGGACAAACAGCCTGG - Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027575138 7:79922135-79922157 AACAAGCAGGAGAGGGAGCCTGG + Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029271174 7:99377606-99377628 AAGAAGAAGAAGAAGAAGCTGGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031065383 7:117099075-117099097 AAGAAGAAGAAGAAGGTGCTTGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032561182 7:132894465-132894487 CAAAAGTAGGAGAAGCAGCTAGG - Intronic
1032817577 7:135492934-135492956 TAGAAGAATGACAATGAGCCAGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033644161 7:143288198-143288220 CAAAAGGAGGGGAAGGAGCGGGG - Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1036663709 8:10725689-10725711 CACAAGAAGGAGAGGGCGCGAGG + Exonic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037697059 8:21232871-21232893 CCAAAGAAGAAGAAGGAGCAAGG + Intergenic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1040957663 8:52995960-52995982 CAAAAGAAAGAGAAAGGGCCTGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044857712 8:96493716-96493738 GAGGAGAAGGAGGAGGACCCGGG + Exonic
1044950651 8:97432577-97432599 CAGAAGGATGTGAAGGAGCTAGG + Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045330402 8:101151159-101151181 CTGAAGAATGAGAACAAGCCAGG - Intergenic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045815394 8:106271232-106271254 TAGTAGACGGAGGAGGAGCCAGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046584049 8:116129678-116129700 GAGAAGAGGGAGAAGGGGCTGGG + Intergenic
1047035911 8:120938165-120938187 TTCAAAAAGGAGAAGGAGCCTGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048468726 8:134688558-134688580 CAAAAGGAAGAAAAGGAGCCAGG + Intronic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049343827 8:142128037-142128059 CACAGGAAGGAGGAGCAGCCTGG - Intergenic
1049439259 8:142601770-142601792 CAGACGAACTAGCAGGAGCCCGG + Intergenic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1051011467 9:12419370-12419392 CACAAGAAAAAGAAGGGGCCAGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053440212 9:38109800-38109822 CAGAAGAAGCGCAAGGGGCCAGG + Intergenic
1054584436 9:66950768-66950790 AAAAAGAAGAAGAAGAAGCCTGG - Intergenic
1054736168 9:68752538-68752560 AAGAAGGAAGAGAAGGAGCAAGG - Intronic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057778145 9:98027468-98027490 CAGAAGAAGAGGAACCAGCCAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059227244 9:112683256-112683278 CAGGAGTTGGAGAAGCAGCCTGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059409655 9:114124080-114124102 TGGAAGAAGGAGAAGCAGTCAGG - Intergenic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060015574 9:120083496-120083518 CCAAAGAAGGAGGAGGAGCTTGG + Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060458888 9:123828994-123829016 CAGGAGAAGGGAACGGAGCCAGG + Intronic
1060473241 9:123965980-123966002 CAGAAGAAGGGGAAAGATCTGGG - Intergenic
1060481453 9:124018721-124018743 GAAAAGAAAGCGAAGGAGCCAGG - Intronic
1060510778 9:124230380-124230402 AAGAAGGAGGAGAAGGCACCTGG - Intergenic
1060600057 9:124871231-124871253 CAGATGGAGTAGAAGGAACCCGG + Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061267017 9:129512135-129512157 GAGGAGTTGGAGAAGGAGCCAGG - Intergenic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062098936 9:134717982-134718004 CAGCAGCATGAGAAGCAGCCTGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186700713 X:12087104-12087126 CAGAAGATGGTGAAGGTGCTGGG - Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1187333252 X:18359934-18359956 CAAAAGATGCTGAAGGAGCCAGG - Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189066242 X:37812356-37812378 AGGAAGAAGGAGAAAGAGCTGGG + Exonic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189314008 X:40040901-40040923 AAGGAGAAGGAGGAGGGGCCAGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189961973 X:46332742-46332764 CACCAGAAGGAGAGGGAACCTGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190385782 X:49881007-49881029 CAGAAGGAGGTGCAAGAGCCAGG - Exonic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190937887 X:55013039-55013061 GAGGAGAATGAGAAGCAGCCAGG - Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192552317 X:72064355-72064377 CAGCAGAATGAAAAGGAGACAGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1198132213 X:133707210-133707232 CAGAAGGAGGAAAAGGGGCATGG + Intronic
1198193975 X:134341184-134341206 TGGAAGAAGGCAAAGGAGCCTGG - Intergenic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201927406 Y:19302811-19302833 AAGAAGAAGGAAAAGAAGCAAGG - Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic