ID: 1137613622

View in Genome Browser
Species Human (GRCh38)
Location 16:49834869-49834891
Sequence GAGGAAGGAGGGGGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1510
Summary {0: 1, 1: 0, 2: 12, 3: 157, 4: 1340}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137613610_1137613622 7 Left 1137613610 16:49834839-49834861 CCCAGCAACAGGGGACTAAAGTG 0: 1
1: 0
2: 2
3: 14
4: 135
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613605_1137613622 14 Left 1137613605 16:49834832-49834854 CCCCTCCCCCAGCAACAGGGGAC 0: 1
1: 0
2: 5
3: 72
4: 511
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613609_1137613622 8 Left 1137613609 16:49834838-49834860 CCCCAGCAACAGGGGACTAAAGT 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613608_1137613622 9 Left 1137613608 16:49834837-49834859 CCCCCAGCAACAGGGGACTAAAG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613611_1137613622 6 Left 1137613611 16:49834840-49834862 CCAGCAACAGGGGACTAAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613607_1137613622 12 Left 1137613607 16:49834834-49834856 CCTCCCCCAGCAACAGGGGACTA 0: 1
1: 1
2: 0
3: 14
4: 216
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613601_1137613622 27 Left 1137613601 16:49834819-49834841 CCGGCTGTGCGCTCCCCTCCCCC 0: 1
1: 0
2: 3
3: 61
4: 741
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613606_1137613622 13 Left 1137613606 16:49834833-49834855 CCCTCCCCCAGCAACAGGGGACT 0: 1
1: 0
2: 2
3: 25
4: 473
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340
1137613600_1137613622 30 Left 1137613600 16:49834816-49834838 CCGCCGGCTGTGCGCTCCCCTCC 0: 1
1: 0
2: 0
3: 37
4: 304
Right 1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG 0: 1
1: 0
2: 12
3: 157
4: 1340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137613622 Original CRISPR GAGGAAGGAGGGGGCCCAGG AGG Intronic
900089175 1:912124-912146 AAGAAAGGAGGGGACCCAGGAGG - Intergenic
900188255 1:1342891-1342913 GAGGAAGGACGGTTCCCAAGAGG - Intronic
900262359 1:1738292-1738314 GCGGAGGGGTGGGGCCCAGGGGG + Intronic
900514822 1:3076635-3076657 CAGGAAGGAAAGGGCTCAGGAGG + Intronic
900611511 1:3546505-3546527 CAGGAAGGAGGGTGCCAGGGAGG + Intronic
900808113 1:4781205-4781227 TGGGGAGGAGGGGCCCCAGGTGG - Intronic
901126444 1:6932175-6932197 GAGGAGGGGGGAGGCCCTGGAGG - Intronic
901322091 1:8346129-8346151 GAGGGAGGCTGTGGCCCAGGTGG - Intergenic
901492127 1:9602005-9602027 AAGGAAGGCGTGGACCCAGGAGG + Intronic
901770978 1:11530250-11530272 GAGGAAGGGGGAGGGCAAGGAGG - Intronic
901781603 1:11598168-11598190 GGGGAACCAGGGGGCCCAGAGGG + Intergenic
902275029 1:15333326-15333348 GAGGAAGGATGGGGAGGAGGAGG + Intronic
902334376 1:15746723-15746745 GAGCAGGGATGGGGACCAGGAGG + Intronic
902417647 1:16250945-16250967 GTGGAGGGTGGTGGCCCAGGCGG + Exonic
902447112 1:16474437-16474459 GAAGCTGGAGGAGGCCCAGGGGG - Intergenic
902653833 1:17854042-17854064 GAGGAAGGAGGAGGAAGAGGAGG - Intergenic
902711075 1:18240189-18240211 GAGGATGGATTGAGCCCAGGAGG + Intronic
902783763 1:18720293-18720315 GAGAAAGGAAGGGGCCTGGGAGG + Intronic
902806724 1:18865617-18865639 GATGGAGGATGGGGCACAGGGGG + Intronic
902925576 1:19693803-19693825 GAGCAAGCAGGGGACACAGGTGG - Intronic
903029241 1:20451051-20451073 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
903136587 1:21313362-21313384 GGGGATGGAGGGAGCCCGGGAGG + Intronic
903172220 1:21561302-21561324 GGGCATGGAGGGGGCTCAGGGGG - Intronic
903178790 1:21595239-21595261 GAGGGAGGAGGGGACCAACGAGG - Intergenic
903239733 1:21974820-21974842 GAAGGAGGGAGGGGCCCAGGAGG - Intergenic
903243539 1:21999750-21999772 GAAGGAGGGAGGGGCCCAGGAGG - Intergenic
903340039 1:22647946-22647968 GAGGAAGGAGAGAACCCATGGGG - Exonic
903421475 1:23220413-23220435 GAGGTAGCAGGGGGCCCACGGGG + Intergenic
903639864 1:24851468-24851490 GAGGACTGACGGAGCCCAGGAGG - Intergenic
903926468 1:26834098-26834120 GAGGAAGAACGGGGCACAGCTGG - Intronic
904014570 1:27409814-27409836 GGGGGAGGAGGGGGCCCCGGAGG + Exonic
904038597 1:27571673-27571695 GGTGAAGTAGGGGGCCGAGGAGG - Intronic
904311335 1:29631564-29631586 GAGAAAGGAGGGGGTGGAGGTGG + Intergenic
904312097 1:29635543-29635565 CAGCAAGGAGGGGTCCCAGAAGG + Intergenic
904379392 1:30101066-30101088 GAGGAAGGAGGGGGAAAAAGAGG - Intergenic
904392954 1:30197765-30197787 GAGAAAGGAGGGGGCTGAGGTGG + Intergenic
904494755 1:30880334-30880356 GAGGACTGAGGGAGGCCAGGGGG + Intronic
904605221 1:31694511-31694533 GAGGGAGCAGGGAGCCTAGGAGG + Intronic
904605646 1:31696305-31696327 GGGGAAGGAGGGGGACCTGTTGG - Intronic
904631664 1:31847360-31847382 GAGGAGGGAGGGGGACTGGGAGG + Intergenic
904634242 1:31867383-31867405 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
904940833 1:34164301-34164323 GAGCTAGGAGGGGGTTCAGGTGG - Intronic
905016597 1:34782293-34782315 GTAGAAGATGGGGGCCCAGGAGG + Intronic
905136957 1:35807768-35807790 GAGGGAGGAGGGAGGCGAGGTGG + Intergenic
905149656 1:35917835-35917857 GAGGAGGGAAGGGGCCAGGGAGG - Intronic
905244020 1:36600021-36600043 GAGGAAGAGGGAGGCCCAAGAGG + Intergenic
905457797 1:38100502-38100524 AAGGAAGGGGTGGACCCAGGAGG - Intergenic
905548790 1:38819461-38819483 GGGGAAGGTGGGAGCCCGGGGGG + Intergenic
905632949 1:39529054-39529076 GAGGAAGGAACGGGCACAGCAGG - Intergenic
905864368 1:41368650-41368672 GAGGTGGGAGGGGGGCCAGGTGG + Intronic
905911580 1:41658629-41658651 GAGGAAGCAGGGGCTCAAGGGGG + Intronic
906495035 1:46299488-46299510 GAGGATGGCTGGAGCCCAGGAGG + Intronic
906516718 1:46443349-46443371 GAAGAAGGAGGGGGAGAAGGAGG - Intergenic
907260767 1:53216911-53216933 CAGGAAGGAGAGGGGCCATGGGG - Intronic
907313326 1:53552270-53552292 CCGGTAGGAGGGGGACCAGGCGG + Intronic
907872357 1:58454651-58454673 GAGGAGGGAGGGTCCCCAGGTGG - Intronic
907892876 1:58651942-58651964 GAGGATGGAGGGGGACCTGTTGG + Intergenic
908079017 1:60554633-60554655 GAGGGTGGAGGGGGCTGAGGTGG + Intergenic
908142306 1:61198911-61198933 GATGAAGGAGGGGGGCAAGCCGG - Intronic
908418779 1:63938906-63938928 GAGGATTGCTGGGGCCCAGGAGG + Intronic
908477727 1:64505748-64505770 GGGGAAGGAGGGCGCCCGGAAGG - Intronic
908573487 1:65434778-65434800 GAGGGAGGATGGAGCCCAGTGGG - Exonic
910160287 1:84265035-84265057 GAGGAAGGATGGTGGGCAGGAGG + Intergenic
910449066 1:87328776-87328798 GAGGAAGGCGGCGGCGGAGGAGG + Exonic
910851353 1:91652162-91652184 AAGGGAGGTGGGGGCCCAGTAGG + Intergenic
911053954 1:93695127-93695149 AAGGAAGAAGGAAGCCCAGGAGG - Intronic
911552667 1:99303232-99303254 GTGGAAGGTGGGGGAACAGGAGG + Intronic
913474889 1:119227666-119227688 GAGGAAGGAGGAGGCCCGCAGGG - Intergenic
913500727 1:119470427-119470449 GAGGATGGATGGGTCCCAGGAGG - Intergenic
913508606 1:119542131-119542153 GAGGATGGATGGAGCCCAGGAGG - Intergenic
913511544 1:119567225-119567247 GAGGATGAATGGGGCCCAGGAGG - Intergenic
913515779 1:119604551-119604573 GAGGATGAATGGGGCCCAGGAGG - Intergenic
914260705 1:145996820-145996842 GAGGAAGGAGGGGAAGGAGGGGG + Intergenic
914468027 1:147949444-147949466 GAGGGAGGTGGGGGGTCAGGGGG - Intronic
914803053 1:150974460-150974482 GAGGAGGGAGGCGGCGCTGGCGG - Intronic
914829226 1:151158535-151158557 GAGGACTGAGGGGCCCCAGGGGG + Intronic
914991324 1:152501852-152501874 GTGGAAGGAGGAGGCCCACAAGG - Intergenic
915206393 1:154273394-154273416 GAAGAAGAAGGGGGCTCATGGGG + Exonic
915310157 1:155002526-155002548 GCGGAGGGAGGGGGCCTGGGGGG + Intergenic
915355277 1:155251956-155251978 GAGGAGTTTGGGGGCCCAGGAGG - Intronic
915459299 1:156060312-156060334 AAGGAATGAGGAGCCCCAGGAGG - Intergenic
915459540 1:156061546-156061568 AAGGAATGAGGAGCCCCAGGAGG - Intronic
915838000 1:159193374-159193396 TAGGAAGGAGAGGCCCCATGGGG - Intronic
916045727 1:160998740-160998762 GAAGAAGTAGGGGGCCCTGTGGG + Exonic
916332069 1:163628326-163628348 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
916332078 1:163628345-163628367 GAGGATGGAGGGGGAGGAGGAGG - Intergenic
916787637 1:168098014-168098036 TAGGTAGGAGGTGGGCCAGGAGG + Intronic
916890772 1:169110243-169110265 GTGGTAGGAGGGGGCCAGGGAGG - Intronic
917092532 1:171368031-171368053 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
917211151 1:172633172-172633194 AAGGAAGAAGGGGCCCCAGGTGG - Intergenic
917755603 1:178094462-178094484 GAGGCGGGAGGGGGACGAGGCGG - Exonic
918379889 1:183943443-183943465 GAGAAAGGAGGAGGCAGAGGAGG + Intronic
919765917 1:201127283-201127305 GAGGGAGGAGGGGCGGCAGGGGG + Intergenic
919780015 1:201215660-201215682 GAGGAAGGACGGGGCTGAGGTGG + Exonic
919813189 1:201421811-201421833 GAGGGAGGAGGGGCAGCAGGAGG - Intronic
919887363 1:201944662-201944684 GAGGAAGGAGGGAAGCCAGGAGG - Intronic
920110400 1:203583306-203583328 CAGGAAGTAGGGGGCCTGGGGGG - Intergenic
920431029 1:205919292-205919314 GAGGAAGGATGGGTCCTTGGGGG - Intronic
920660070 1:207908217-207908239 AGGGAATGAGGAGGCCCAGGAGG + Intronic
920802467 1:209202288-209202310 GGAGAAGGAGGATGCCCAGGAGG - Intergenic
921039555 1:211416732-211416754 CAGGAAGGAGAGGGCCACGGTGG - Intergenic
921046650 1:211482532-211482554 GATGGAGAAGGGGTCCCAGGTGG + Intronic
921551164 1:216537131-216537153 TAGGAAGGAGGGTGTCTAGGAGG + Intronic
921575576 1:216831001-216831023 GAGGAAGGAAAGGGGCAAGGTGG + Intronic
921779857 1:219149938-219149960 GAGGAAGGAGGAGGAACAGAAGG - Intergenic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
922507250 1:226133649-226133671 GAGCAGGGAGGGGGCCTGGGAGG + Intergenic
922675213 1:227545251-227545273 GTGGAGTGAGGAGGCCCAGGTGG - Intergenic
922723326 1:227909907-227909929 GAGGAAGGAGGGGAGAAAGGAGG + Intergenic
922724329 1:227915417-227915439 GTAGAAGGAGGTGGCCCAGGAGG - Intergenic
922794980 1:228335414-228335436 GAGGAAGGAGGGGGTCCCACAGG - Intronic
922800608 1:228363072-228363094 CAGGGAGGAGGGGGAGCAGGGGG + Intronic
922909668 1:229205011-229205033 GAGGAAGGAGTGGGTGGAGGGGG + Intergenic
923043536 1:230337251-230337273 AAGGAAGGTGGGGGCCCAGATGG - Exonic
923126823 1:231040405-231040427 GAGGGAGGAGGAGACCCGGGTGG - Intergenic
923957471 1:239039330-239039352 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
924052666 1:240093195-240093217 GGGGGAGGAGTGGGCCCCGGAGG + Exonic
924742853 1:246806941-246806963 CAGGAAGGAGGGAGCTGAGGGGG + Intergenic
1063369840 10:5514070-5514092 GAGGGAGGAGAGGGGGCAGGGGG - Intergenic
1063938549 10:11104590-11104612 GAGGATGGATTGCGCCCAGGAGG + Intronic
1064119347 10:12605665-12605687 GAGGAAGGAGGGGAGCCCTGGGG + Intronic
1064251229 10:13707839-13707861 GTGGAATGAAGGGGCCCTGGCGG + Intronic
1064321487 10:14309659-14309681 GAGGCAGGAGGGGGGCCTGGAGG - Intronic
1064344982 10:14523954-14523976 GAGGATCGCTGGGGCCCAGGAGG - Intronic
1064587209 10:16851571-16851593 AGGAAAGGAGGGAGCCCAGGAGG - Intronic
1065188426 10:23191005-23191027 GAAAAAGGAAGCGGCCCAGGAGG + Intergenic
1065576797 10:27128817-27128839 GAGGATGGCTGGAGCCCAGGAGG + Intronic
1065968476 10:30787206-30787228 CAGGATGGAGGGGACCCAGCAGG - Intergenic
1066221860 10:33343053-33343075 GAGGAAGGAGGAGGAAGAGGAGG + Intergenic
1066429830 10:35340984-35341006 GTGGAAGCAGGGAGACCAGGTGG - Intronic
1067144186 10:43681851-43681873 GAGGAAGGAAGGAGCCCAGTGGG + Intergenic
1067346977 10:45444037-45444059 CGGGGAGGACGGGGCCCAGGGGG + Intronic
1067738493 10:48877752-48877774 GAGGCAGGCTGGGGACCAGGTGG + Intronic
1067908605 10:50320746-50320768 GAGGGAGGAAGGGTTCCAGGTGG - Intronic
1068104159 10:52592448-52592470 GAGGAAAGAGGCGGGACAGGTGG + Intergenic
1069038113 10:63666499-63666521 GAGGAAGGCTTGGGCCCAGGAGG + Intergenic
1069573053 10:69506216-69506238 GGGGAAGCAGGATGCCCAGGAGG - Exonic
1069573135 10:69506632-69506654 AAGGGGAGAGGGGGCCCAGGTGG + Intronic
1069622771 10:69847994-69848016 GAGGAAGGAGGTGGGCCAGGGGG - Intronic
1069680821 10:70283955-70283977 GGGGAAGGAGGGGGCTCGTGAGG + Intergenic
1069749541 10:70736485-70736507 GAGAAAGGAGGGGTCCCTGGAGG + Intronic
1069795923 10:71051668-71051690 GAGGAAGGAGAGTCCCCAGCAGG + Intergenic
1070094146 10:73320411-73320433 GAGGATGGATGGAGCCAAGGAGG - Intronic
1070126108 10:73623294-73623316 GAGGAAAGCTTGGGCCCAGGAGG + Intronic
1070288632 10:75100664-75100686 GAGGCAGGAAGGGGGCGAGGAGG - Intronic
1070490522 10:76971625-76971647 GAGGAAGCAGGTGGTACAGGGGG - Intronic
1070611612 10:77937235-77937257 GAGGCAGAAGTGGGCCCTGGGGG - Intergenic
1070658359 10:78286514-78286536 GAGTGAGGTGGGGGCCTAGGAGG + Intergenic
1070789672 10:79181680-79181702 GAGGCAGGATGAGGCCCAGAGGG - Intronic
1071877810 10:89861489-89861511 GAAGAAGGAGGGGGAGGAGGAGG - Intergenic
1071941414 10:90595513-90595535 GAGATAGGAGAGGCCCCAGGAGG - Intergenic
1071958375 10:90783495-90783517 GAGAAAGCAAGGGGCCCAAGAGG - Intronic
1072638370 10:97192425-97192447 GAGCAAGAGGGGGACCCAGGTGG - Intronic
1072641003 10:97211340-97211362 GAGGCGGGCAGGGGCCCAGGAGG - Intronic
1072656768 10:97335019-97335041 GAGGGAGGCCGCGGCCCAGGAGG - Intergenic
1072664149 10:97381675-97381697 GAGGAAGCAGAGAGCACAGGGGG - Intronic
1072699578 10:97630938-97630960 GAGGATGGCTTGGGCCCAGGAGG - Intronic
1072701384 10:97643972-97643994 GAGGCAGGATTGGGCCAAGGCGG + Intronic
1073053375 10:100683886-100683908 GAGGGAGGGGGCTGCCCAGGGGG - Intergenic
1073056935 10:100709272-100709294 TGGGAAGGAGGGGGCCCACCAGG - Intergenic
1073076027 10:100826427-100826449 GGGGATGGAGGCGGCGCAGGTGG - Intronic
1073327490 10:102651086-102651108 GAGGAAGGAGGCTGGCCAGGGGG - Intronic
1073371657 10:102995187-102995209 GAGGAAGGAGGAGGAAGAGGGGG - Intronic
1073429409 10:103476559-103476581 GAGGAAGGAGGGGGGTCAAGGGG + Intronic
1073480745 10:103784764-103784786 GAGGAAGGAAGGGGAGAAGGGGG + Intronic
1073490058 10:103847401-103847423 GAGGATGGCTGGAGCCCAGGAGG - Intronic
1073509818 10:104035718-104035740 GAGGAACGGAGGGGCCCACGGGG + Intronic
1073594782 10:104788994-104789016 GAGGAAGCTAGGAGCCCAGGTGG - Intronic
1074160028 10:110829539-110829561 AGGGAAGGAGGGAGCCCAGGAGG - Intronic
1074719059 10:116248962-116248984 GGGGAAGGAGTGGGGCCATGTGG - Intronic
1074768328 10:116716770-116716792 GAGGGAGAAGGGGGCACAGAGGG - Intronic
1074776815 10:116773182-116773204 GAGGCAAGAGCAGGCCCAGGTGG + Intergenic
1074969722 10:118526170-118526192 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1075076300 10:119352924-119352946 GAGGGAGGACGGAGCCCGGGTGG - Intronic
1075107832 10:119553882-119553904 GAGGAACGCTGGAGCCCAGGAGG - Intergenic
1075172499 10:120128389-120128411 CAGGAAGGGCGGGGCCAAGGTGG - Intergenic
1075401629 10:122164930-122164952 TAGGAGGGATGGGGCCCCGGGGG + Intronic
1075421979 10:122308619-122308641 GAGAAAGGAGAGGGCCAAGCAGG - Intronic
1075715801 10:124554636-124554658 GCTGAAGGGGTGGGCCCAGGTGG + Intronic
1076124156 10:127961491-127961513 AGGGAAGGAGGGCCCCCAGGAGG + Intronic
1076148430 10:128143686-128143708 CAGGAAGGAAGAAGCCCAGGGGG - Intergenic
1076222555 10:128746097-128746119 GAGGATGGAAGGAGCCCAGCCGG + Intergenic
1076365326 10:129918076-129918098 CAGTTAGGAAGGGGCCCAGGTGG + Intronic
1076367979 10:129934495-129934517 GAAGCAGGAGGGGGACCTGGGGG - Intronic
1076545239 10:131240767-131240789 GGGGAAGGAGGGGGCGCGGAGGG + Intronic
1076614538 10:131747013-131747035 GAAGCAGGAGGGGGAGCAGGGGG - Intergenic
1076631209 10:131853302-131853324 GAGGCAGGTGGAGACCCAGGCGG + Intergenic
1076747332 10:132521077-132521099 CAGTGAGGACGGGGCCCAGGAGG - Intergenic
1076762705 10:132613277-132613299 CGGGAAGGAGGGGGCCCTGCGGG - Intronic
1076762719 10:132613306-132613328 CGGGAAGGAGGGGGCCCTGCGGG - Intronic
1076892092 10:133289920-133289942 GCGGAAGGAGAGGATCCAGGAGG - Exonic
1077016016 11:399471-399493 GGTGGAGGAGGGGGGCCAGGTGG - Intronic
1077094885 11:795088-795110 GAGGGAGGGTGGGACCCAGGGGG + Exonic
1077197604 11:1289102-1289124 GAGCAAGGATGGGGCCCCGAGGG - Intronic
1077221723 11:1420918-1420940 GAGGGCCGAGGGGGCCCTGGGGG - Intronic
1077266737 11:1654683-1654705 GAGGGAGGAGGAGGCCAAGGAGG - Intergenic
1077311613 11:1891322-1891344 GGGGAAGGAGGGAGTCCTGGGGG + Intronic
1077318644 11:1930178-1930200 GAGGAAGGAGGGAGGAGAGGTGG + Intronic
1077424336 11:2467293-2467315 CAGGGAGGCAGGGGCCCAGGAGG + Intronic
1077536981 11:3129178-3129200 AAGGAAGGAGGGGCAGCAGGAGG + Intronic
1077630574 11:3808604-3808626 GCGGAACCCGGGGGCCCAGGTGG - Exonic
1077921865 11:6647351-6647373 GAAGGAGGAGGGGGCTCAGGAGG + Intronic
1078240990 11:9530744-9530766 GAGGATAGCTGGGGCCCAGGAGG - Intergenic
1078797250 11:14604705-14604727 GAGGAAGGAGGGAGGGAAGGGGG - Intronic
1079103850 11:17558247-17558269 GAGGAAGTTGTGGGCCCTGGAGG - Exonic
1079336833 11:19577485-19577507 GAGCATCTAGGGGGCCCAGGAGG - Intronic
1079445573 11:20553707-20553729 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1080022418 11:27576754-27576776 GAGAAAGGAGGGGGACAGGGAGG - Intergenic
1080061620 11:27962378-27962400 CAGGAAGGAGGGGAGCCAGGTGG - Intergenic
1080315121 11:30938849-30938871 AAGGAAGGAGGGAGCCAACGTGG - Intronic
1080668727 11:34357673-34357695 GAGGAAGGAGGGTGGCCCGGAGG - Exonic
1081289397 11:41305994-41306016 AAGAAATAAGGGGGCCCAGGGGG - Intronic
1081492715 11:43580152-43580174 GATGGAGGAGGGGGCCGAGCGGG + Intronic
1081680200 11:44997137-44997159 GAGGAGGGAGGGGGCAAAAGAGG + Intergenic
1081734608 11:45394232-45394254 GAGGCAGGAGGCCGGCCAGGAGG + Intergenic
1081815318 11:45936186-45936208 GAGGATCGACTGGGCCCAGGAGG + Intronic
1081869815 11:46378241-46378263 CAGAAAGGAGGGGCCCCAGAGGG - Intronic
1081955271 11:47086498-47086520 GAGGAAGTAGGGGGTAAAGGGGG + Intronic
1082017683 11:47504083-47504105 GAGGAGTGACTGGGCCCAGGAGG + Intronic
1082881390 11:58041424-58041446 GAGGAAGCTGAGGGCCAAGGAGG + Intronic
1083064920 11:59914593-59914615 GAGCCAGGAGGGGATCCAGGAGG - Intergenic
1083235361 11:61347447-61347469 GAGGATGGCTTGGGCCCAGGAGG + Exonic
1083265827 11:61546488-61546510 GAGGAGAGAGGGGGACCGGGCGG + Intronic
1083412536 11:62504348-62504370 CAGGAGGGAGGAGCCCCAGGTGG - Intronic
1083589562 11:63885447-63885469 GAGGATGGATTGAGCCCAGGAGG + Intronic
1083608782 11:63995122-63995144 GAGGACTGTGTGGGCCCAGGAGG - Intronic
1083650758 11:64203245-64203267 GAGGCAGGGGGGGCCCCTGGAGG - Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1083670431 11:64297063-64297085 GGAGACGGAGGGGTCCCAGGTGG + Intronic
1083712953 11:64560004-64560026 GAGGCAGGAGGGGGAGCGGGAGG - Intronic
1083719734 11:64598345-64598367 GGGGAAGGAGGGTGCCCAAGAGG + Intronic
1083757972 11:64801658-64801680 GAGGGAGGAGGAGGCCCTCGGGG - Intronic
1083936860 11:65873742-65873764 AAGGAAGGGCGGGCCCCAGGCGG - Intergenic
1084104912 11:66975054-66975076 GAGGAGGGAGGGGGGAGAGGAGG + Intergenic
1084151243 11:67289003-67289025 GAGGAAGGCGGGGCCGGAGGGGG - Intronic
1084185113 11:67467424-67467446 GTGGAGGGAGGGGGTGCAGGAGG + Intronic
1084275489 11:68049206-68049228 GAGGATGCTGGGGGCCGAGGCGG - Exonic
1084288394 11:68146477-68146499 GCGGAAGCATGGAGCCCAGGAGG - Intergenic
1084345111 11:68541821-68541843 CAGGAAGGAGGGGGGACAGTGGG + Intronic
1084363090 11:68681810-68681832 GAAGAAGGAGGAGGACGAGGAGG - Intergenic
1084399701 11:68936514-68936536 GCGGCAGGAGGGAGGCCAGGAGG + Exonic
1084420613 11:69058726-69058748 CAGGAAGGAGGTGGCCACGGAGG - Intronic
1084457128 11:69274316-69274338 GAGGAAGGAGGGAGGGAAGGAGG + Intergenic
1084478021 11:69399995-69400017 CAGGAAGCTGGAGGCCCAGGAGG + Intergenic
1084558478 11:69889397-69889419 GAGGAAGGCTGAGGACCAGGTGG - Intergenic
1084563067 11:69914915-69914937 GAGGTACCAGGAGGCCCAGGTGG + Intergenic
1084572886 11:69970150-69970172 GAGGAAGGGGAGGGCAAAGGAGG + Intergenic
1084751657 11:71208188-71208210 GTGGCAGGAGGGTGCCCTGGAGG + Intronic
1084900438 11:72306207-72306229 GAAGCAGAAGGGGGCTCAGGAGG + Intronic
1085052310 11:73386223-73386245 TGGGGAGGAGGGGCCCCAGGGGG - Intronic
1085053352 11:73390856-73390878 GAGGAGGCTGGAGGCCCAGGTGG + Exonic
1085187722 11:74590667-74590689 GAGGATGGATTGAGCCCAGGAGG - Intronic
1085231194 11:74972445-74972467 GAGGAGGGGGCGGGCCCAGGAGG - Intronic
1085458310 11:76678224-76678246 GAGGAGAGAGGAGGGCCAGGAGG - Intergenic
1085464641 11:76715478-76715500 GGGAGAGGAGGGGTCCCAGGTGG + Intergenic
1085502721 11:77038124-77038146 GAGGGAGGAGGGGGAGGAGGAGG + Intronic
1085784329 11:79437811-79437833 GAAGAAGGAGGGCGCCCCGGAGG - Intronic
1086473424 11:87142687-87142709 GAGGAAGGAGGAGGAGGAGGAGG - Intronic
1086888314 11:92227023-92227045 GACTAGGGAGGGCGCCCAGGGGG + Intergenic
1087527157 11:99330175-99330197 GAGGGAGGAGGGAGGCAAGGAGG + Intronic
1087796724 11:102461775-102461797 GAAGAAGAATGGGGCCAAGGAGG + Intronic
1088765438 11:112971141-112971163 GAGGAAGGAGGGAGAGAAGGAGG + Intronic
1088817252 11:113430068-113430090 TAGGAGGCAGTGGGCCCAGGAGG - Intronic
1089070137 11:115693343-115693365 GAAAGGGGAGGGGGCCCAGGAGG + Intergenic
1089211466 11:116806639-116806661 GAGGATCGCGTGGGCCCAGGAGG - Intergenic
1089222889 11:116889805-116889827 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1089530277 11:119123630-119123652 GAGGAAGGCTTGAGCCCAGGAGG - Intronic
1089617334 11:119702253-119702275 GAGGGAGGTGGAGGCCCTGGTGG - Intronic
1089643623 11:119863975-119863997 GAGGAAGGCAGGGGGCCTGGCGG - Intergenic
1089868311 11:121651108-121651130 GAGGCAGGTGGGGGTGCAGGCGG - Intergenic
1090206360 11:124886699-124886721 GAGGAGGGGTGGGGCCCAAGGGG - Exonic
1090218222 11:124990205-124990227 GAGGTAGGGGGGTGGCCAGGTGG + Intronic
1090333394 11:125947813-125947835 GGGGAACCAGGGAGCCCAGGGGG - Intergenic
1090409987 11:126501420-126501442 GGGGAGCGAGGGTGCCCAGGTGG + Intronic
1090750934 11:129745854-129745876 GAGGAAGGAGGGGGAGGAGAAGG + Intergenic
1090823220 11:130363740-130363762 GAGGAAGTAGGAGGCAAAGGAGG - Intergenic
1090828382 11:130403866-130403888 GAGGACAAAGGGGGCACAGGTGG + Intergenic
1091011674 11:132006999-132007021 GAGGAAAGAGAGTGCCCAGGAGG - Intronic
1091277574 11:134362760-134362782 GAGGAGGGGATGGGCCCAGGTGG + Intronic
1091284134 11:134398728-134398750 TAGGCAGGAGGGGGCCCGGGAGG - Intronic
1091387329 12:103496-103518 GGGGTAGGTGGGGGCTCAGGAGG + Intronic
1091387357 12:103571-103593 GGGGGAGGTGGGGGCTCAGGAGG + Intronic
1091387399 12:103684-103706 GGGGTAGGTGGGGGCTCAGGAGG + Intronic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1091800723 12:3323065-3323087 GAAGAAGGAAGGGGCAGAGGAGG + Intergenic
1092165297 12:6338716-6338738 GAGGACGGCTTGGGCCCAGGAGG - Intronic
1092172989 12:6384853-6384875 AAGGAAAGAGGAGGCCCAGTGGG - Intronic
1092216791 12:6689162-6689184 GGGAAAGGAGGGAGCCGAGGAGG + Intronic
1093666109 12:21815091-21815113 GAGGATGGCTGGAGCCCAGGAGG + Intronic
1094799084 12:34009486-34009508 GAGGAAGGCTTGAGCCCAGGAGG - Intergenic
1095687195 12:45050350-45050372 TCGGGAGTAGGGGGCCCAGGCGG - Intronic
1095812211 12:46383353-46383375 GAGGAGGGAGGGGGAAAAGGAGG + Intergenic
1095958597 12:47819897-47819919 GAGGAAGGGAGGGGGCCGGGAGG + Intronic
1096050202 12:48600801-48600823 GAGGGAGAAGGGGGTGCAGGAGG - Intergenic
1096438817 12:51620895-51620917 GAGGATGGATTGAGCCCAGGAGG + Intronic
1096481382 12:51943562-51943584 CTGGAAGGAGGGTGACCAGGAGG + Intergenic
1096715216 12:53487114-53487136 CAGGATGCAGGGGGCCCAGGGGG - Exonic
1096738853 12:53677159-53677181 CGGGAAGGACGGGGCCAAGGAGG - Intronic
1096865710 12:54561485-54561507 GAGGAAGGCAGGGGCCAAAGAGG + Intronic
1096976998 12:55705136-55705158 GAGGAGGGGAGGGGCCCATGTGG + Intronic
1097290970 12:57914661-57914683 GGGGAAGGAGAGGACCCAGATGG + Intergenic
1098337629 12:69420259-69420281 GAGGAGGCAGGGAGACCAGGTGG + Intergenic
1098942461 12:76553214-76553236 AAGGAAGGCTGGGGCCCATGTGG - Intronic
1098950912 12:76639749-76639771 GAGGTAGGTGGGGGCCTGGGAGG - Intergenic
1098991130 12:77065742-77065764 GAAGGGGGAGGGGGCCGAGGCGG - Intergenic
1099197276 12:79632446-79632468 GAGGATGGATTGAGCCCAGGAGG - Intronic
1099279723 12:80628829-80628851 GAAGAAGGAGGGGGAGGAGGAGG + Intronic
1099487642 12:83248361-83248383 AAGGAAGGAGAGGGCAAAGGTGG - Intergenic
1099951678 12:89310875-89310897 GAGGATGGCTGGAGCCCAGGAGG + Intergenic
1100434642 12:94560672-94560694 GAAGAGGCAGGAGGCCCAGGTGG + Intergenic
1100550687 12:95644202-95644224 GGGGAAGGAGGGGGAGGAGGGGG - Intergenic
1100575903 12:95891433-95891455 GAGGATGGATTGAGCCCAGGAGG - Intronic
1100613186 12:96209038-96209060 GGGGAGGAAGGGGTCCCAGGTGG - Intronic
1100738499 12:97564712-97564734 AAGGAAGGAGAGGGCAGAGGAGG - Intergenic
1101396821 12:104355978-104356000 GTGGAAGGTGGGAGCCCAGCAGG + Intergenic
1101650630 12:106674126-106674148 GAAGAATGAGGAGGCCCATGTGG - Intronic
1101876169 12:108598110-108598132 GAGGAAGGAGGAGGGACGGGAGG - Exonic
1101951385 12:109178876-109178898 GAGGAGAAAGGGGCCCCAGGTGG - Intronic
1102230230 12:111257201-111257223 GAGGAAGGAGAGGGAGGAGGAGG - Intronic
1102457227 12:113078103-113078125 GGGGTAAGACGGGGCCCAGGGGG + Exonic
1102495662 12:113317187-113317209 GAGGATTGAGTGAGCCCAGGAGG - Intronic
1102496205 12:113320998-113321020 ATGGGAGGAGGGGTCCCAGGAGG - Intronic
1102636954 12:114332946-114332968 GAGGATAGATTGGGCCCAGGAGG - Intergenic
1102776599 12:115524999-115525021 GAGGGAGGAGGGAGTCCAGATGG + Intergenic
1102888386 12:116538789-116538811 GAGGAGGGAGGTGGTCCCGGTGG - Intergenic
1102942372 12:116954852-116954874 GAGGAAGGAAGAGGGGCAGGAGG - Intronic
1103004956 12:117413787-117413809 GAGGCTGGAGGGGGCTGAGGAGG - Intronic
1103061574 12:117862817-117862839 GAGAATGGAGGGAACCCAGGAGG - Intronic
1103260601 12:119585171-119585193 CAGAAAGGAGGGGGCCAAGGAGG + Intergenic
1103395153 12:120601495-120601517 GAGGATCGATGGAGCCCAGGAGG - Intergenic
1103728756 12:123012455-123012477 GAGCAAGCATGGGGCCCATGGGG - Intronic
1103974258 12:124691892-124691914 GAGGAAGGTGGGGGCAGAGTGGG + Intergenic
1104379203 12:128291995-128292017 GAGGAACAATGGGTCCCAGGGGG - Intronic
1104390985 12:128390462-128390484 GAGGAGGGAGGTGGCAGAGGAGG - Intronic
1104616353 12:130273298-130273320 GAGGAAGGAGGAGGGGAAGGAGG - Intergenic
1104981515 12:132574993-132575015 GAGGAAGGCGGGAGCCCCGCGGG + Intronic
1105045795 12:133002222-133002244 GAGACAGAAGGGGGGCCAGGAGG - Intronic
1105575806 13:21650563-21650585 GAAGAAGGAGGGGGCTGGGGAGG - Intergenic
1105683270 13:22751924-22751946 GGGGAATGAGGGTGGCCAGGAGG - Intergenic
1105937924 13:25119062-25119084 GAGGCAGGAGGAGTCCCCGGAGG - Intergenic
1106097403 13:26660325-26660347 GAGGGAGCAGAGGGCCCACGAGG + Intronic
1106160075 13:27193543-27193565 AAGGCAGGAGGGAACCCAGGAGG + Intergenic
1106406304 13:29477563-29477585 GAGGAAGGGGAGGACCCTGGGGG + Intronic
1106794368 13:33189407-33189429 GAGGAAGGAGGGAAAGCAGGAGG - Intronic
1106794381 13:33189436-33189458 GAGGAAGGAGGGAAAGCAGGAGG + Intronic
1107338873 13:39384941-39384963 GAGGAAGGTGGGAACCAAGGTGG + Intronic
1107529008 13:41263814-41263836 GAGGGAGGGAGGGGCCAAGGTGG + Intergenic
1107549227 13:41458834-41458856 GTGGAATGAGGGGGCACAGTGGG + Intronic
1107851382 13:44576456-44576478 GCGGGAGGAGGGGGCTGAGGCGG - Exonic
1107852525 13:44585515-44585537 TGGGAAGGAGGGGGTCCTGGAGG + Intergenic
1107999451 13:45892783-45892805 GAGGAGGGAGGAGGCAGAGGAGG + Intergenic
1108524216 13:51272212-51272234 AAGGAAGTTGGGGGCACAGGAGG + Intronic
1108555219 13:51584741-51584763 GCGGATGGAGGGGTCCCAGGAGG + Exonic
1108625945 13:52228851-52228873 GGGGAAAGAGAGAGCCCAGGGGG + Intergenic
1108660121 13:52577629-52577651 GGGGAAAGAGAGAGCCCAGGGGG - Intergenic
1108876181 13:55053884-55053906 TAGGAAGGAGGGGACCCAAAGGG - Intergenic
1109636478 13:65124522-65124544 GAACAAGGAGGGGGCCAAGCAGG + Intergenic
1110474654 13:75899977-75899999 GAGGAAGGCTTGAGCCCAGGAGG + Intergenic
1111602613 13:90494122-90494144 GGGGAAGGGGGAAGCCCAGGTGG + Intergenic
1112146977 13:96710711-96710733 GGGGCAGGAGGTGGCCTAGGAGG - Intronic
1112484255 13:99805570-99805592 GAGGAAGGAGGGGGTGGGGGAGG + Intronic
1112494794 13:99896118-99896140 GAGGAGTGTGGCGGCCCAGGAGG + Exonic
1112549323 13:100404719-100404741 GGTGAAGCAGGGGGCCTAGGGGG + Intronic
1113091275 13:106619383-106619405 GAGGAAGGAAGGAGACCAGGAGG - Intergenic
1113340619 13:109421417-109421439 GAGCAATGAGGCGGGCCAGGGGG - Intergenic
1113420768 13:110170049-110170071 GAGGAAGGAGGGGAGGGAGGAGG + Intronic
1113608859 13:111629176-111629198 AAGGCTGGAGGGTGCCCAGGAGG + Intronic
1113655619 13:112066709-112066731 GAGGGGGGAGGAGGCCCGGGAGG - Intergenic
1113697378 13:112355657-112355679 GAGGCAGCAGGGGTTCCAGGAGG - Intergenic
1113836150 13:113329914-113329936 GAGGGAGCTGGGCGCCCAGGTGG + Intronic
1113841144 13:113362544-113362566 GAGGATGGCTGGAGCCCAGGAGG + Intronic
1113843109 13:113371470-113371492 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843209 13:113371709-113371731 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843232 13:113371768-113371790 GAGGAGGGAGGGGTCTCAGGAGG - Intergenic
1113843240 13:113371787-113371809 GAGGATGGAGGGGCCTCAGGAGG - Intergenic
1113843247 13:113371806-113371828 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843279 13:113371886-113371908 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113946681 13:114048448-114048470 GAGGAAGGTGGAGGCCTAGCGGG + Intronic
1113983486 13:114295574-114295596 CAGGAAGAGGAGGGCCCAGGAGG - Intronic
1114038955 14:18658422-18658444 GAGGATGGATGGAGCCCAGATGG + Intergenic
1114050862 14:18919136-18919158 GGGGAAAGAGGGTGACCAGGAGG - Intergenic
1114111697 14:19482786-19482808 GGGGAAAGAGGGTGACCAGGAGG + Intergenic
1114437910 14:22723528-22723550 GAGGCAGGAGGGGTTCCTGGGGG + Intergenic
1115215352 14:31008416-31008438 GAGGATCGAGTGAGCCCAGGAGG + Intronic
1117072422 14:52068976-52068998 GAGCATGGAGGGGGACCGGGTGG - Exonic
1117426058 14:55598343-55598365 GAGAATGGCGGGAGCCCAGGAGG + Intronic
1117450112 14:55841766-55841788 GAGGCAAGAGCAGGCCCAGGGGG - Intergenic
1118277616 14:64399863-64399885 GAGGATGGCTGGAGCCCAGGAGG - Intronic
1118315335 14:64722587-64722609 GAGCAAGGAGGGTCCCCATGGGG - Intronic
1118341717 14:64899354-64899376 GAGGATCGCTGGGGCCCAGGAGG + Intergenic
1118389310 14:65282779-65282801 GAGGAAGGAGCAAGCCCTGGTGG + Intergenic
1118389860 14:65287167-65287189 GGGAAAGGAGGAGGCCCAGGGGG - Intergenic
1118453088 14:65921830-65921852 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
1118467498 14:66044218-66044240 GAGAAAGGAGGAAGGCCAGGAGG + Intergenic
1118591081 14:67401420-67401442 GAGGATTGCTGGGGCCCAGGAGG + Intronic
1118883732 14:69850022-69850044 GAGAAAGGAGGGGGTGAAGGTGG + Intergenic
1118979108 14:70701731-70701753 GAGGAAGGAGGAGGAAGAGGAGG + Intergenic
1118993159 14:70813773-70813795 AAGGAAGGAGGGAGGGCAGGAGG + Intergenic
1119319515 14:73721398-73721420 CAGGAAGGAGGGGGAGGAGGAGG - Exonic
1119437806 14:74609620-74609642 GTGGCAGGAGGGGGGCCTGGAGG - Intronic
1120884480 14:89441176-89441198 GAGGAGGGAAAGGGCCCAGCAGG - Intronic
1121355158 14:93207612-93207634 CAGGCTGAAGGGGGCCCAGGAGG - Intronic
1121638327 14:95468631-95468653 GAGGAAGGAGCAGGGTCAGGAGG - Intronic
1121735728 14:96216745-96216767 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
1121735734 14:96216764-96216786 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
1121739077 14:96238826-96238848 GAGGGTGGAGGGTGCCCTGGAGG - Intronic
1121782539 14:96631224-96631246 GAGGATGGATGTAGCCCAGGTGG + Intergenic
1121944445 14:98105390-98105412 GAGGTAGGAGAGGCCCCTGGAGG + Intergenic
1122075902 14:99234361-99234383 GAGGAAGGATGGGGGCTGGGAGG - Intronic
1122076109 14:99235715-99235737 GGGGAAGGAGGTGGCGCTGGTGG + Intronic
1122082430 14:99274752-99274774 GGGGAAGGAGGGGGAGAAGGAGG - Intergenic
1122155157 14:99746373-99746395 GAGGAGGGAGAGGTCTCAGGGGG + Intronic
1122263246 14:100535030-100535052 GAGGAAGGAGAGGGTCCACATGG - Intergenic
1122382854 14:101322066-101322088 GAGGGAGAAGGGGGTGCAGGAGG - Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122556020 14:102580517-102580539 GGGGCAGGAGGGAGCCCAAGGGG + Intergenic
1122574199 14:102731562-102731584 GAGGAAGGTTGAGGCCAAGGTGG + Intergenic
1122805572 14:104254835-104254857 GAGAACTGAGGGGCCCCAGGGGG + Intergenic
1122825246 14:104367553-104367575 GAGGTGGAAGTGGGCCCAGGTGG - Intergenic
1122873139 14:104650605-104650627 AGGGACAGAGGGGGCCCAGGGGG + Intergenic
1122941718 14:104984489-104984511 CAGGAAGGAGCGGGGACAGGAGG + Intergenic
1122960028 14:105090047-105090069 GAGGCAAGCTGGGGCCCAGGAGG + Intergenic
1123713994 15:23013354-23013376 GAGGCAGGAGAGAACCCAGGAGG + Intronic
1123996214 15:25719612-25719634 AGGGAAGGAGGGGGCCCTGAAGG - Intronic
1124345357 15:28918442-28918464 GAGGAAGCAGGACTCCCAGGTGG + Intronic
1124645173 15:31433494-31433516 GGGGAAGGGGGGGACCCTGGTGG - Intronic
1124832842 15:33165822-33165844 GAGGAAGGTGGGGACCATGGGGG + Intronic
1125024801 15:35019491-35019513 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
1125024810 15:35019510-35019532 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
1125200598 15:37098214-37098236 GAAGGGGGAGGGGGCGCAGGAGG + Intronic
1125241508 15:37582240-37582262 GAGTCCGGAGGGGGCCGAGGTGG - Intergenic
1125457618 15:39876737-39876759 GAGGATGGTTGGAGCCCAGGAGG + Intronic
1125503486 15:40253377-40253399 CAGGAAGGAGCCAGCCCAGGAGG - Intronic
1125582128 15:40793606-40793628 GAGTAAAGAAGGGGTCCAGGTGG + Intronic
1125605749 15:40938809-40938831 GAGGGAGGAAAGGGCCCAGGCGG - Exonic
1125609946 15:40963243-40963265 GAGGCAGAAGGGGTCGCAGGTGG - Intergenic
1125672354 15:41483268-41483290 GAGGGAGGAGGGGCCCAATGAGG - Exonic
1125797398 15:42413074-42413096 GGGAAAGGAGGGGGTCAAGGAGG - Exonic
1126048859 15:44669081-44669103 GAGGAAGGGGAAGGCCCTGGTGG - Exonic
1126315157 15:47362186-47362208 AAGGAAGGACAGGGCCCAGCTGG + Intronic
1126778511 15:52119315-52119337 GAGGGAGGAGGGGTGACAGGAGG + Exonic
1126932350 15:53668922-53668944 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
1127298978 15:57634204-57634226 GAGGAAGGCGGGAGCTCAGCTGG + Intronic
1127310398 15:57747028-57747050 AAGGGAGGATGGGACCCAGGGGG + Intronic
1127353028 15:58171480-58171502 GAGGGAGGAGGGGGCACACAGGG - Intronic
1127397164 15:58552168-58552190 GAGGAGGGAAGGGGCCCTCGGGG + Intronic
1127504546 15:59584973-59584995 GAGGATGGCTTGGGCCCAGGTGG + Intergenic
1127660738 15:61098077-61098099 GAGGAAGGAGGGGGAGAAGGAGG - Intronic
1127696206 15:61450335-61450357 AAGGAAGGAGGGGGCGATGGAGG - Intergenic
1127815984 15:62609102-62609124 GACAAGGGAGGAGGCCCAGGGGG - Intronic
1128064492 15:64755885-64755907 GAGGAAGGGGTGAGCCGAGGGGG - Intronic
1128166829 15:65472946-65472968 GAGGAAGGCTTGAGCCCAGGAGG + Intronic
1128246826 15:66138712-66138734 GAGGAAGCTGGGAGCCCGGGAGG - Intronic
1128249550 15:66154819-66154841 GGGGAAGGGAAGGGCCCAGGTGG + Intronic
1128338773 15:66805337-66805359 GAGGAAGCATGGGGCACATGAGG - Intergenic
1128512059 15:68319424-68319446 GAGGAGAGAGGAGTCCCAGGTGG + Intronic
1128519569 15:68366550-68366572 GAGGAAGGAGAGGGGCAGGGTGG - Intronic
1128720099 15:69941749-69941771 TAGGCAGGAGAGGGCCCAGCGGG - Intergenic
1128726323 15:69991158-69991180 GAGGGAGGGAGGGGCCCAGCTGG - Intergenic
1128743271 15:70097319-70097341 GAGGAAGGAGGCGGGCTACGAGG + Exonic
1128803998 15:70517335-70517357 GTGGCAGGAGCGGGCACAGGTGG - Intergenic
1128818176 15:70629536-70629558 GAGGAGGGAGAGGGCTCGGGGGG - Intergenic
1129440712 15:75579161-75579183 GAGGAAGCGGGGCGCCGAGGGGG - Exonic
1129667479 15:77587658-77587680 TAGGAGGGAGGGAGGCCAGGAGG + Intergenic
1129916950 15:79282677-79282699 GAGGAAGGAGGGGGCCGCGGGGG - Intergenic
1130229361 15:82085029-82085051 GAAGAAGGAGGAGGCGAAGGAGG + Intergenic
1130553778 15:84908866-84908888 GGGCATGGTGGGGGCCCAGGTGG + Intronic
1131131383 15:89902949-89902971 TAGGAAGGAGGGGGTGCAGAGGG - Intronic
1131185094 15:90267119-90267141 GAGGATGGCTTGGGCCCAGGAGG - Intronic
1131312612 15:91304581-91304603 GAGGAAGGACGGGGGAGAGGCGG + Intergenic
1131510101 15:93045027-93045049 GCGGGACGAGGGCGCCCAGGAGG + Exonic
1131517383 15:93088517-93088539 GCGGGAGGCGGGGGCCCGGGCGG + Intronic
1132047300 15:98575183-98575205 GAGGGAGGAGGGGGAGGAGGAGG - Intergenic
1132318164 15:100905570-100905592 GAAGAAGGAAGGGGCCAAGCTGG + Exonic
1132742901 16:1424489-1424511 GAGGATGGTGGGAGCCCAGGAGG - Intergenic
1132833605 16:1941810-1941832 GAGAAAGGAGAGGGACCAGGTGG - Intronic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1133058630 16:3160085-3160107 GAGGACGGAGGAGGACCTGGGGG + Intergenic
1133442929 16:5835960-5835982 GAGGAAGAAGAGAGCTCAGGAGG + Intergenic
1133773834 16:8883218-8883240 TAGGGAGGAGGGGGACCAGCAGG - Intergenic
1133973081 16:10580750-10580772 GCGAAAGGAGGGGGCCCTGGAGG + Intergenic
1134015966 16:10888664-10888686 GTGGAAGGTGGTGGCCCAGGGGG + Intronic
1134149094 16:11791670-11791692 GAAGAAGGAGGGTGCCCAGCAGG + Intronic
1134385738 16:13770629-13770651 GAGGAAGGAGAGGGAGGAGGAGG + Intergenic
1134689686 16:16182985-16183007 GAGGAAGGATGAGCCCCAGACGG + Intronic
1134898937 16:17916867-17916889 AAGGAATGAGAGGGCCTAGGTGG - Intergenic
1135032611 16:19050576-19050598 GAGGATGGATTGAGCCCAGGAGG - Intronic
1135096479 16:19568733-19568755 GAGGATGGCTGGAGCCCAGGAGG - Intronic
1135108009 16:19667642-19667664 GAGGATGGCTGGAGCCCAGGAGG + Intronic
1135769803 16:25208765-25208787 GAGGAATGCTTGGGCCCAGGCGG + Intergenic
1135992878 16:27228526-27228548 GAAGAGGGTGGGGGCCAAGGAGG - Intronic
1136298912 16:29320381-29320403 GAGGAGGGTGGGAGCCCAGGAGG + Intergenic
1136382278 16:29901198-29901220 GAGCAAGGTGAGGGCCGAGGAGG - Exonic
1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG + Intronic
1137822797 16:51461843-51461865 GAGCAAGGAGGGGGCCAAGAGGG - Intergenic
1137926656 16:52547162-52547184 GAGGCAGGAGGGGGAGAAGGAGG - Intronic
1138023157 16:53502874-53502896 GAGGGAGAGGGGGGCCCAGCTGG - Intronic
1138252179 16:55509537-55509559 GAGGAGGGAGGTGGCCCGAGGGG + Intronic
1138355059 16:56371050-56371072 CAGGAATGAGGAGGCCCTGGGGG - Intronic
1138371471 16:56530398-56530420 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
1138532989 16:57645327-57645349 GAGGAACGAGGGAGCCCCGGAGG - Intronic
1139423808 16:66866466-66866488 GAAGGAGGCGGAGGCCCAGGTGG + Intronic
1139549705 16:67666590-67666612 GAGCGAGGCCGGGGCCCAGGCGG - Exonic
1139558705 16:67728527-67728549 GAGGTGGGAGTTGGCCCAGGGGG + Intronic
1139581927 16:67878881-67878903 GAGGAAGGCCGGGGGGCAGGTGG + Intronic
1139796481 16:69486861-69486883 GAGGCAGGAGGAGGGCCAGGAGG + Intergenic
1139911987 16:70403203-70403225 GTACAAGGAGGGGGCCCATGGGG + Intronic
1139921742 16:70464909-70464931 CAGCAAGAAGGTGGCCCAGGTGG + Intronic
1140270163 16:73458353-73458375 GAGGAAGGAGGGAGGAAAGGAGG - Intergenic
1140517974 16:75557917-75557939 GAGGAAGGCTTGAGCCCAGGAGG + Intergenic
1140686044 16:77434867-77434889 GAGAAGGGAGGGCGCGCAGGCGG - Exonic
1141155489 16:81593986-81594008 GAGGAAAGAGGGGGAGGAGGGGG - Intronic
1141478768 16:84292352-84292374 GCGGGTGGAGGAGGCCCAGGAGG + Intergenic
1141502181 16:84451883-84451905 GAGTAAGGAGGGGTCACCGGGGG - Intronic
1141527099 16:84618422-84618444 GAGGAAGGAGGAGGGAGAGGAGG - Intergenic
1141615301 16:85206681-85206703 GAGGACGCTGGGGGCCCAGCCGG - Intergenic
1141657093 16:85422151-85422173 AGGGGAGGAGGGGGCCGAGGTGG - Intergenic
1141697817 16:85628381-85628403 GGGGCTGGAGGGGGCCCATGGGG + Intronic
1141913403 16:87076318-87076340 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
1142060593 16:88026936-88026958 GAGGAGGGTGGGAGCCCAGGAGG + Intronic
1142088117 16:88195274-88195296 AAAGCAGGAGGCGGCCCAGGGGG + Intergenic
1142147328 16:88498068-88498090 GGCGGAGGAGGGGGCCCTGGCGG + Intronic
1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG + Intergenic
1142181900 16:88675293-88675315 CGGGAGGGAGGGGGCCCTGGAGG + Intergenic
1142210372 16:88805695-88805717 GAGGATGGGGGCGGCTCAGGAGG - Intronic
1142243882 16:88959639-88959661 GAGGAAGGAGGAGGAAAAGGAGG - Intronic
1142248658 16:88981088-88981110 GAGGAGGGAGGAGGCCCACAAGG + Intergenic
1142353734 16:89591389-89591411 CAGGAGGGCGGGGGCCCAGCTGG + Intronic
1142359496 16:89619580-89619602 GGGGGAGCAGGGGGACCAGGGGG - Intronic
1142395475 16:89828977-89828999 GAGGAAGGAGGGAGAGAAGGAGG - Intronic
1142440952 16:90097183-90097205 GAGGACGCAGGCGTCCCAGGTGG + Intergenic
1142561309 17:811126-811148 GCGGGAGGAGGTGGCACAGGAGG + Intronic
1142640081 17:1280526-1280548 GAGGAAGGAGGAGGCCAGTGAGG - Intronic
1142801439 17:2348487-2348509 GAGGAAGGAGGGAGCTCTGAAGG + Intronic
1142820960 17:2466890-2466912 GAGGAAGGCTTGAGCCCAGGAGG - Intronic
1142868858 17:2807878-2807900 GAGGAGGCAGGGCGGCCAGGAGG + Intronic
1142994288 17:3751623-3751645 GAGGAAGGAGAGGGCCCCATGGG + Intronic
1143110304 17:4549150-4549172 GTGAAGGGAAGGGGCCCAGGAGG - Intronic
1143179043 17:4972994-4973016 GAGGAAGGGGGCGGGACAGGCGG + Intronic
1143476652 17:7207098-7207120 GATGATGGAGGGGGCAGAGGGGG + Intronic
1143521373 17:7446003-7446025 GAGAAATGAGGGGGCTCGGGGGG - Intronic
1143524382 17:7463594-7463616 GGGGCAGGTGGAGGCCCAGGCGG + Exonic
1143592663 17:7894916-7894938 GGAGAAGGAGGGGGTCCAGTGGG + Exonic
1143632498 17:8147137-8147159 CAGGAAGGAGAGGGCAAAGGAGG + Intronic
1143688037 17:8534998-8535020 GAGGAAGGACGGAGCTCAGCAGG + Intronic
1143794103 17:9322438-9322460 AAGGAAGGAGGAGGCCCACAGGG + Intronic
1143797908 17:9352747-9352769 GAGTAAGGGGGAGGCCGAGGCGG - Intronic
1144087608 17:11824913-11824935 GAAGAAGGAGGGGGAGGAGGAGG - Intronic
1144398519 17:14870477-14870499 GAGGAGGGAGGGGGAAGAGGAGG + Intergenic
1144420919 17:15097825-15097847 CAGGAAGGAGGGGGAAGAGGGGG - Intergenic
1144537313 17:16103528-16103550 GAGGCTGGAGGGGGCCCACTGGG - Intronic
1144580470 17:16456188-16456210 GAGGAAGGAGGAGGAAGAGGAGG + Intronic
1144631872 17:16877709-16877731 GAGACAGGATGGAGCCCAGGGGG - Intergenic
1144710691 17:17399644-17399666 GAGGGAGGTGGGAGCCCTGGAGG - Intergenic
1144847348 17:18226751-18226773 GAGGGAGGCGGGGGCTGAGGCGG - Intronic
1144957855 17:19028474-19028496 GAGGCAGGAGTGGGCCCTGAAGG + Intronic
1144977303 17:19146046-19146068 GAGGCAGGAGTGGGCCCTGAAGG - Intronic
1144993300 17:19248997-19249019 GAGCAAGGAGGGCGCAGAGGAGG + Intronic
1145056642 17:19707603-19707625 GGGGAAGGAGGGGGCCGTGCAGG + Intronic
1145098765 17:20055819-20055841 CAGAACGGAGGGGGCCCAGTGGG - Intronic
1145216292 17:21054968-21054990 GGGGAAGGAGGACTCCCAGGTGG - Intergenic
1145290587 17:21542598-21542620 GAGGACAGCGGGGTCCCAGGAGG - Intronic
1145722697 17:27088531-27088553 GAGGAAAGAGGGTGGCCAGAGGG - Intergenic
1145738962 17:27255969-27255991 TAGGAGGGAGGGGACCCAGAAGG + Intergenic
1145771651 17:27497518-27497540 AAGCAAGGAGTGGGACCAGGAGG + Intronic
1145816369 17:27797799-27797821 GAGGAAGGATGGGCCCGGGGAGG + Intronic
1146380165 17:32322204-32322226 GAGGATGCAGGGGGCCCATGTGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146916755 17:36682890-36682912 GAGGAAGGAGAAGGCACAAGGGG - Intergenic
1146979496 17:37146664-37146686 GGGGAAGGGGGGGGCAGAGGAGG + Intronic
1147045035 17:37745442-37745464 GTGGAAGAAGGGGACGCAGGAGG + Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147240602 17:39088085-39088107 GAGGAGGGAGCTGGCCAAGGAGG - Intronic
1147256728 17:39186126-39186148 GAGGGAGGAGGGAGGCGAGGTGG + Intronic
1147359676 17:39922930-39922952 GAGGAAAGATGGGGCCAGGGAGG + Intronic
1147575132 17:41594608-41594630 GAGGGAGGAGGGAGAGCAGGAGG + Intergenic
1147690765 17:42313060-42313082 GGGGTAGGAGGGGGCCGGGGAGG + Intergenic
1147786768 17:42984057-42984079 GAGGATGGATTGAGCCCAGGAGG - Intronic
1147948277 17:44092735-44092757 TAGGAGGGAGGCGTCCCAGGGGG + Exonic
1147976975 17:44253414-44253436 AAGGAAGGAGGGGGTGGAGGAGG - Intronic
1148000092 17:44382818-44382840 GAGGGAGGAGGGAACCCAGGGGG - Intronic
1148035518 17:44656692-44656714 GAGGAAGGGCAGGGTCCAGGGGG + Intronic
1148075311 17:44932266-44932288 GAGGCAGGATGTGGGCCAGGTGG + Intronic
1148228544 17:45916554-45916576 GAGAAAGGAGGGGCCCAAAGAGG + Intronic
1148680933 17:49473100-49473122 GAGAAAGGAAGAGGCACAGGGGG - Intronic
1148860355 17:50601341-50601363 GAGGCAGGAGAGGACACAGGGGG - Intronic
1149457077 17:56796882-56796904 GAGGAGGAAGGTGGCCCTGGTGG - Intronic
1149561238 17:57609317-57609339 GAGGGAGGAAAGGGCTCAGGAGG - Intronic
1149661275 17:58335252-58335274 GAGGAAGTAGGGGGCGGGGGCGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150090560 17:62321230-62321252 GAGGATTGCTGGGGCCCAGGAGG + Intergenic
1150108732 17:62479474-62479496 GAAGATGGGGGAGGCCCAGGCGG + Intronic
1150124486 17:62627631-62627653 GAGGGAGGAGGCAGCCCGGGCGG - Exonic
1150353521 17:64464211-64464233 GAGGCAGGAGGAGGCCTGGGAGG - Intronic
1150484902 17:65536971-65536993 AGGGAAGGAGGGGCCCCCGGCGG - Exonic
1150654989 17:67033527-67033549 AAAGAAGAAGGAGGCCCAGGGGG + Intergenic
1150743945 17:67801374-67801396 GAGGATGGTTCGGGCCCAGGAGG - Intergenic
1150850151 17:68696558-68696580 GAGGAACAGGGGTGCCCAGGGGG + Intergenic
1150890546 17:69144249-69144271 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1150983463 17:70169341-70169363 GAGGGTGGAGGGGGACGAGGCGG + Intronic
1151191184 17:72399334-72399356 GAGGATGGAAGGGACCCAGGAGG + Intergenic
1151253952 17:72860524-72860546 CAGGCAGGTGGGGGCACAGGTGG + Intronic
1151468902 17:74305487-74305509 GGGGATGGAGGGAGCCCAGCTGG + Intronic
1151477082 17:74350315-74350337 AAGGAGGGGAGGGGCCCAGGTGG + Intronic
1151560833 17:74868763-74868785 GAGGAGGGAGGGGGGCCAATCGG - Intronic
1151598764 17:75093791-75093813 GAGGATGGAGGGGAACCAAGAGG - Exonic
1151817835 17:76479861-76479883 GAGGAAGGAGGGAGGGCAGGCGG + Exonic
1151877047 17:76872821-76872843 GAGGAAGGAGGCGGGTCAGGAGG - Exonic
1151938754 17:77280322-77280344 GAGGAAGGCGGGAGGCCAGTTGG - Intergenic
1151954286 17:77372996-77373018 GAGGAGGGCGGGCGCCCAGAGGG - Intronic
1152111219 17:78358685-78358707 GGGGAAGGAGGGGGCTCCAGGGG + Exonic
1152134068 17:78493865-78493887 GAGGAAGCTGGGGGCCGAGGAGG - Intronic
1152261583 17:79270104-79270126 GAGGACGGAGGAGAACCAGGAGG - Intronic
1152336240 17:79701377-79701399 GAGGAGGGGGAGGGCACAGGTGG + Intergenic
1152336352 17:79701669-79701691 GAGGAGGGGGAGGGCACAGGTGG + Intergenic
1152455985 17:80416426-80416448 GAGGAACGGAGGGGCCCAGGAGG - Intronic
1152470203 17:80487006-80487028 GTGGAAGGAGGGGGCCCGGAGGG - Intergenic
1152612736 17:81323542-81323564 GAGGATGGGGAGGCCCCAGGAGG + Intronic
1152634995 17:81427229-81427251 GGGGAAACAGGGGGGCCAGGAGG + Intronic
1152769192 17:82157116-82157138 TAGGAAGAAGGGGGCCCTGCTGG + Intronic
1152791714 17:82283651-82283673 GAGAAAGGAGGTGGCCTGGGTGG - Intergenic
1153225772 18:2898443-2898465 GAGGAAGGAAGGGGTGCTGGTGG + Intronic
1153489113 18:5629924-5629946 GAGGCAAGAGGGGGCGGAGGAGG + Intronic
1153991798 18:10406803-10406825 GAGGGAGGACGGAGCGCAGGTGG - Intergenic
1154309175 18:13254269-13254291 GAGGAGTGAGGGGCCCCAGGTGG + Intronic
1154335643 18:13462687-13462709 GCGGAAGGTGGGAGTCCAGGAGG + Intronic
1155054250 18:22170804-22170826 GAGAAAGGATGCGGCCGAGGGGG + Intronic
1155520852 18:26667628-26667650 GAGGAAGGAGGGAGACAGGGAGG + Intergenic
1156025283 18:32646344-32646366 GAAGAAGGAGGTTGCCAAGGAGG - Intergenic
1156466972 18:37353844-37353866 GAGGATGGCGGGAACCCAGGAGG - Intronic
1157196539 18:45624579-45624601 GAGTCAGGACGGGGCCCAGAGGG - Intronic
1157589687 18:48828915-48828937 GAGGGAGGAGGAGGAGCAGGCGG - Intronic
1157606341 18:48928226-48928248 AAGGCAGAAGGGGGCCCATGGGG - Intronic
1158235165 18:55304188-55304210 AAGGAAGGAAGTGGCCAAGGTGG + Intronic
1158367540 18:56755541-56755563 GATGAATCAGGAGGCCCAGGAGG + Intronic
1158492794 18:57925373-57925395 GTGGATTGAGGGCGCCCAGGTGG + Intergenic
1158624186 18:59057381-59057403 GAGGAAGGAGCGCCCCCATGTGG + Intergenic
1158641576 18:59208109-59208131 GAGGAAGGAGGGGGAAAAGTGGG + Intergenic
1159020065 18:63136036-63136058 GAGGAAGGAGGTAGCCCAAAGGG - Intronic
1159052749 18:63436705-63436727 GTGGCAGGATGGGGCCAAGGTGG + Intergenic
1160034231 18:75286301-75286323 GGGGAAGGAGGATGCCCAGAAGG + Exonic
1160279072 18:77470059-77470081 GAGGATCGTGGGAGCCCAGGAGG + Intergenic
1160393944 18:78558566-78558588 GAGGAGGGAGGGCGGCCACGGGG - Intergenic
1160540585 18:79618014-79618036 GAGGAAGGAGGCGGGCGCGGTGG + Intergenic
1160583751 18:79901571-79901593 AAGGAAGCAGGAGGCCGAGGAGG - Intergenic
1160657930 19:282812-282834 GAGGAAGGAGAAGGGGCAGGTGG + Intronic
1160684066 19:425290-425312 GAGCAAGGCGGGGTCCCACGAGG + Intronic
1160698389 19:495260-495282 GAGGAGGGTGGGGGGCGAGGGGG + Intronic
1160706315 19:531812-531834 GAGGCAGGCGGCGGCCCCGGTGG + Exonic
1160770492 19:828735-828757 GAGAAAGGAAGGGGCTCAGATGG + Intronic
1160798789 19:957614-957636 GAGGATCGAGGGAGCCCAGGAGG + Intronic
1160845626 19:1164818-1164840 GAGGAGGGAGGAGGAACAGGAGG + Intronic
1160968193 19:1755780-1755802 GAGGGAGGAGGGTCCCCAGGGGG - Intronic
1161038705 19:2098848-2098870 GAGAGAGGAGGGGGGCTAGGGGG + Intronic
1161077312 19:2292096-2292118 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1161165739 19:2786177-2786199 GGGGAAGGAGGCGTCCCGGGAGG + Intronic
1161210579 19:3063185-3063207 GAAGAAGGAGGGAGAACAGGGGG + Intergenic
1161222876 19:3126091-3126113 GAGGGAGGTGGGAGCCCTGGAGG + Intergenic
1161233397 19:3186567-3186589 AGGGGCGGAGGGGGCCCAGGAGG - Intronic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161274311 19:3407022-3407044 GGGGAGGGAGGGGGCAGAGGCGG + Intronic
1161310259 19:3589963-3589985 GAGGAGGCAGGGGTCCCAGCGGG + Intronic
1161415748 19:4145498-4145520 GAGGAGGGAGGAGGCTGAGGAGG + Intergenic
1161490359 19:4557862-4557884 GAGGAAGGTGGGAGCCACGGAGG - Intronic
1161558592 19:4958124-4958146 GAGGCAGGTGGGGCCCGAGGAGG - Intronic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161699063 19:5785087-5785109 GGGGAAGGTGGGGGCCGAGGAGG + Intronic
1162030588 19:7915646-7915668 GAGGATGGCTGGAGCCCAGGAGG + Intergenic
1162038159 19:7953512-7953534 GAGGAAGGAGGGGGAGAAGGAGG - Intergenic
1162063733 19:8111916-8111938 GAGGTAGGTGGGGGGCAAGGCGG - Intronic
1162110390 19:8396777-8396799 GCGGAAGGTGGGGGCCACGGAGG + Intronic
1162155153 19:8672975-8672997 GAGGCTGGTGGGGGCCCAGGTGG + Intergenic
1162176800 19:8836396-8836418 GAAGAAGGAGGAGGACAAGGAGG - Intronic
1162283596 19:9720375-9720397 GAGGGAGAAGGGGGTGCAGGAGG - Intergenic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162457669 19:10795822-10795844 GAATAAGGAGGGGACCCAAGAGG - Intronic
1162548525 19:11345594-11345616 GAGGAAGGCGGGAACCTAGGAGG - Exonic
1162549806 19:11352032-11352054 GTGGAGGGAGGGGGCTCAGGCGG - Intronic
1162760413 19:12885522-12885544 CAGGAAGGAGGGGGACGTGGCGG + Exonic
1162797885 19:13096004-13096026 GAGGGAGGAGGGGGCTGGGGGGG - Exonic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162930927 19:13957294-13957316 CAGGAGGGAGGGGGCCCCGGGGG + Intronic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163339976 19:16699485-16699507 GAGGATGGATTGAGCCCAGGAGG - Intergenic
1163344123 19:16729096-16729118 GAGGAAACAGAGGGTCCAGGAGG - Intronic
1163425169 19:17236782-17236804 CAGTAAGGAGGGGTCCCAGGGGG + Intronic
1163465813 19:17468023-17468045 GAGGAAGGAGGAGGGAAAGGAGG + Intergenic
1163493038 19:17628044-17628066 GAGGAAGCTGGGGTCCCATGGGG + Intronic
1163513548 19:17749570-17749592 GAAGAGGGAGGGGACCCATGGGG + Intronic
1163557918 19:18002698-18002720 AGGGCAGGAAGGGGCCCAGGAGG + Intronic
1163654127 19:18535805-18535827 GAGAGAGGAGCCGGCCCAGGAGG + Intronic
1163686243 19:18713561-18713583 GAGGGAGGAGGGGCACGAGGAGG - Intronic
1163695033 19:18759801-18759823 GAGGACGGTGGGGGGCCTGGGGG - Intronic
1164591871 19:29511886-29511908 GAGAAAGGAGGGGGATGAGGAGG + Intergenic
1164592308 19:29513537-29513559 GAGGAAGGAGGGGGATGAGGAGG + Intergenic
1164592323 19:29513586-29513608 GAGGAAGGAGGGGGATGAGGAGG + Intergenic
1164645798 19:29858206-29858228 GAGGAAGGAGGGTGGCCAGGTGG - Intergenic
1164740208 19:30570234-30570256 GTGGAGGGAGGGTGTCCAGGGGG - Intronic
1164897965 19:31893788-31893810 GAAGAAGGAGGGGGAGGAGGAGG + Intergenic
1165215696 19:34270605-34270627 GAGGAAGGAGGGTGCCATAGAGG - Intronic
1165330385 19:35138701-35138723 GGGGCTGGAGGGGGGCCAGGGGG - Intronic
1165336746 19:35175868-35175890 GATGATGGAGGGGGGCCTGGTGG + Intergenic
1165810280 19:38607808-38607830 TAGGAAGGTGGGGGCTGAGGTGG + Intronic
1165948547 19:39459473-39459495 GAGGAAGGGGGTGGCCCTGGGGG + Intronic
1166072273 19:40394385-40394407 GGCCAAGGAGGGGGCCGAGGAGG - Exonic
1166182777 19:41120569-41120591 GAGGATGGTTTGGGCCCAGGAGG - Intronic
1166299689 19:41906723-41906745 GAGACAGGAGGGGTCTCAGGCGG - Exonic
1166361742 19:42255331-42255353 GAGGAAGGAGGGGGTGGGGGTGG + Intergenic
1166364125 19:42269941-42269963 GAGGAAGGTGAGGGCCCCCGGGG + Intronic
1166432948 19:42741898-42741920 GAGGATGGAGGGAGGCCACGAGG + Intronic
1166436054 19:42767124-42767146 GAGGATGGAGGGAGGCCACGAGG + Intronic
1166445935 19:42857152-42857174 GAGGATGGAGGGAGGCCACGAGG + Intronic
1166471736 19:43084091-43084113 GAGGATGGAGGGAGGTCAGGAGG + Intronic
1166809434 19:45506909-45506931 GAGGAGGAAGTGGGCCAAGGGGG - Intronic
1166868171 19:45853754-45853776 GATGGAGAAGGGAGCCCAGGGGG - Intronic
1166944885 19:46390551-46390573 GAGGAAGGAGGTGGAGCAGCTGG + Exonic
1167145069 19:47676483-47676505 GAGGAAGGAGGTGGCCACCGTGG - Intronic
1167313824 19:48752664-48752686 GAGGAAGGAGAGGGCGCGGCCGG + Exonic
1167392788 19:49207538-49207560 GAGGAAGGCTTGAGCCCAGGAGG + Intronic
1167397879 19:49243359-49243381 GGAGGAGGAAGGGGCCCAGGGGG + Intergenic
1167498107 19:49830903-49830925 GAGGAAGGAGCAGGGGCAGGAGG - Intronic
1167564182 19:50246033-50246055 AAGGAAGGAGGGAGGGCAGGAGG - Intronic
1167574215 19:50309931-50309953 GAGGTTGCAGGGGACCCAGGTGG - Exonic
1167577625 19:50325429-50325451 GAGGAAGGGGGGTGCACAGAGGG - Intronic
1167633512 19:50639902-50639924 GGGGAAGGAGGGGGTGCAGGGGG - Intronic
1167633608 19:50640273-50640295 CAGGCAGGAGTTGGCCCAGGTGG - Intronic
1167646219 19:50706550-50706572 GAGGAAGGAGGTGGCCAGTGTGG - Intronic
1167670529 19:50850407-50850429 GAGATAGGAGGGGACCCAGCTGG - Intergenic
1167676473 19:50889551-50889573 GAGTTAGGAGGGGCCCCAGCTGG - Intergenic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167753089 19:51392603-51392625 GAGGATGGTTTGGGCCCAGGAGG - Intergenic
1167767008 19:51490305-51490327 GAGGAAGGAGTGGGCACTGTTGG - Intronic
1168156126 19:54473793-54473815 GAGGGAGGTGGAGGCCCAGGTGG + Intergenic
1168266400 19:55226096-55226118 GAGGAGGGAGGGCGGCAAGGGGG - Intergenic
1168357717 19:55712858-55712880 GGGGAAGGAGGGGGAGGAGGAGG + Intronic
1168697002 19:58409185-58409207 GAGGAATGAGGGGGCCCACCAGG + Intronic
1168704703 19:58463229-58463251 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
924998385 2:384706-384728 GAGGATGGCTGGAGCCCAGGAGG + Intergenic
925034256 2:673774-673796 GAGGAAGGAGGGGAAGGAGGAGG + Intronic
925064591 2:920525-920547 GAGTAAGGAGGAGGGACAGGTGG - Intergenic
925151024 2:1615037-1615059 GAGAGAGGAGTGGGCCAAGGAGG + Intergenic
925180084 2:1811835-1811857 GAGGCAGGAGAAGACCCAGGAGG - Intronic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925274552 2:2639486-2639508 GATGAAGCAAGGGGCCGAGGAGG - Intergenic
925284113 2:2704904-2704926 GAGGAAGGAAGAGGCCCATGAGG + Intergenic
925378602 2:3407553-3407575 GAGGAGGGGGGAGGCCGAGGCGG + Intronic
925579578 2:5397039-5397061 CAGGATGGAGGAGACCCAGGAGG + Intergenic
925875521 2:8308375-8308397 GAGAAAGGAAGGGACACAGGTGG + Intergenic
925902048 2:8515825-8515847 GAGGGAGGAGGGGGAGGAGGGGG - Intergenic
925902053 2:8515834-8515856 GAGGAAGGAGAGGGAGGAGGGGG - Intergenic
925971136 2:9107436-9107458 GAAGAAGGATGGGCCCAAGGAGG + Intergenic
926056011 2:9774445-9774467 CAGGAAGGAGGGAGCTCACGCGG + Intergenic
926164749 2:10514391-10514413 GAGAAAGGTGGGGCACCAGGTGG - Intergenic
926619467 2:15034033-15034055 GAGGAAGGAGGAGGAGGAGGAGG + Intergenic
926700710 2:15801340-15801362 CAGGAAGGAAGATGCCCAGGAGG + Intergenic
927079114 2:19610340-19610362 GAGGAAGCAGTGGTCACAGGTGG - Intergenic
927461932 2:23306768-23306790 GATGAAGGAGGGGGTGGAGGTGG + Intergenic
927488360 2:23504553-23504575 CTGGAGGGAGGGGGCACAGGGGG + Intronic
927505151 2:23608037-23608059 GAGGAAGGAGGGAGGGCGGGAGG + Intronic
927812474 2:26187674-26187696 GGAGGAGGAGGGGGCGCAGGAGG - Exonic
928260084 2:29758621-29758643 GAGGGAGGAGGGAGCCGAGGAGG - Intronic
928381389 2:30821702-30821724 CAGGAAAGAAGGGACCCAGGAGG - Intergenic
928589363 2:32798308-32798330 GAGAATGGAGTGGACCCAGGAGG + Intronic
928850539 2:35740156-35740178 GGGCTAGGAGGGGGGCCAGGGGG + Intergenic
928998703 2:37324781-37324803 GAGGGAGGAAGGGGCGCCGGAGG - Intronic
929559296 2:42945767-42945789 CATGAAGGAAGGGGCCCCGGAGG - Intergenic
929589299 2:43134684-43134706 GGGGAAGGAGCGGGGCCGGGCGG - Intergenic
929815743 2:45229956-45229978 AAGGAAGGAGGGATCCAAGGAGG - Intergenic
930026238 2:47030707-47030729 CAGGATGGAGGGGGAACAGGCGG - Intronic
930059108 2:47273695-47273717 GAGGAAGGTGAGGGAGCAGGCGG - Intergenic
930711820 2:54557385-54557407 GAGGAAAAAGGGGGGACAGGAGG + Intronic
931718206 2:65046185-65046207 GAGGGAGAAGGGGGTGCAGGAGG + Intergenic
932157316 2:69429937-69429959 GAGGATGGCTGGAGCCCAGGAGG + Intronic
932215624 2:69964227-69964249 GGGGAAGGATGGGGCCAAGGTGG - Intergenic
932219912 2:69991336-69991358 GAGGAGCGTGGGGGCCCAAGGGG - Intergenic
932582968 2:73004543-73004565 GAGGTAGGAGTGAGCCGAGGGGG + Intronic
932777811 2:74539030-74539052 AGGGAGGGAGGGGGTCCAGGAGG - Intronic
933253025 2:80050003-80050025 GAGGAAGGAGAGGGCACGGCAGG - Intronic
933849748 2:86356361-86356383 AAGGAAGGAGCAGGGCCAGGGGG + Intergenic
934526484 2:95055284-95055306 GAAGAAGGAGGGGGAGAAGGAGG + Intergenic
934563367 2:95324422-95324444 GAGAATGGCGTGGGCCCAGGAGG + Intronic
934609067 2:95721269-95721291 GAAGAAGGAGGAGGAGCAGGAGG - Intergenic
934914034 2:98283891-98283913 GAGGAAGGAGCTGGACTAGGAGG - Intronic
934937135 2:98473555-98473577 GAGTAAGGAGGGGAAGCAGGTGG - Intronic
935112082 2:100104012-100104034 GAGGAGGGAGGGGGCGCAGTCGG + Intronic
935146260 2:100397609-100397631 GACAAAGGAGGGGGGCCTGGGGG + Intronic
935531678 2:104240403-104240425 GAGGAGGGAGGAGGACGAGGAGG + Intergenic
935958765 2:108403386-108403408 GAGGGAGAAGGGGGTGCAGGAGG - Intergenic
936122890 2:109761139-109761161 GAGGAGGGAGGGGGCGCAGTCGG - Intergenic
936221798 2:110610325-110610347 GAGGAGGGAGGGGGCGCAGTCGG + Intergenic
936351682 2:111717413-111717435 AAGAAAGGTGGGAGCCCAGGTGG + Intergenic
936489268 2:112956515-112956537 GAGGATTCAAGGGGCCCAGGAGG - Intergenic
936542390 2:113362851-113362873 GAAGAAGGAGGAGGAGCAGGAGG - Intergenic
936716289 2:115190988-115191010 GAGGAAGAAGGAGGTGCAGGAGG + Intronic
936950573 2:117973888-117973910 AAGGTAGGTGGGGGCCCAGCTGG - Exonic
937017528 2:118619380-118619402 GAGGAAGGCAGGCACCCAGGAGG - Intergenic
937046346 2:118854000-118854022 GAGGAAGGAGGTGGGCGGGGTGG - Intergenic
937250288 2:120519490-120519512 GGGAAAGGAGGGGGCACAGGAGG - Intergenic
937251412 2:120526166-120526188 GTGGAAGGAGAGGGTCCCGGAGG + Intergenic
937339243 2:121080379-121080401 CAGAAAGGAGGTGGCCTAGGTGG + Intergenic
937814938 2:126240908-126240930 AAGGAAGGAGGGGGCGCGGCTGG - Intergenic
937875558 2:126823009-126823031 CAGGGAGGAGGAGCCCCAGGTGG - Intergenic
937984089 2:127630804-127630826 GAGGAAGCTGGCGGCTCAGGAGG + Exonic
938036802 2:128041435-128041457 GAGGGAGAAGGGGGTGCAGGAGG - Intergenic
938240317 2:129738151-129738173 ATGGAAGGATGGAGCCCAGGAGG - Intergenic
938261152 2:129895906-129895928 AAGGAAGGATGGGTCTCAGGTGG + Intergenic
938271647 2:129977519-129977541 GAGGATGGATGGAGCCCAGATGG - Intergenic
938388723 2:130887239-130887261 GAGGATGGTGTGAGCCCAGGAGG + Intronic
938934788 2:136118257-136118279 GAGGAAGGAGGGCGCAGGGGCGG + Intergenic
939489293 2:142857482-142857504 GAGGATGGATTGAGCCCAGGAGG + Intergenic
939880108 2:147621603-147621625 AAGGAAGAGGGGGCCCCAGGAGG + Intergenic
939969651 2:148644924-148644946 GAGGAAGGAGGTGGAGGAGGCGG + Intronic
941095828 2:161238817-161238839 GAGGAAGGAGGGAGCGCGGCAGG - Intergenic
941336043 2:164245081-164245103 GAGGAAGGAAGGGAAACAGGAGG - Intergenic
941653865 2:168122527-168122549 GAGGATTGATGGAGCCCAGGAGG - Intronic
942000037 2:171636978-171637000 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
942450752 2:176106888-176106910 GAGGAAGGAGGGGGAAGAGGGGG - Intronic
942589203 2:177522800-177522822 AGGGTAGGAGAGGGCCCAGGTGG - Intronic
943438940 2:187901941-187901963 GAGGCAGGAGTGAACCCAGGAGG + Intergenic
943502161 2:188705723-188705745 GAGGAAGGAGGAAGTCCGGGAGG + Intergenic
944099245 2:196004869-196004891 GAGGATGGCTTGGGCCCAGGAGG + Intronic
944412398 2:199457559-199457581 GAGGGAGGAGGGGGAGGAGGAGG + Exonic
945032747 2:205680890-205680912 GAGGAAGGAGGGAGGCAAAGAGG + Intergenic
945067562 2:205960026-205960048 GAGGCAAGTGAGGGCCCAGGTGG + Intergenic
945884823 2:215363962-215363984 TAGAAAGGAGCTGGCCCAGGTGG - Intronic
945945811 2:215994622-215994644 GAAGAAGGAGGGGGAGGAGGAGG + Intronic
945991546 2:216399684-216399706 GAGGAAGAAGGGGGGCCAGAAGG + Intergenic
946231872 2:218296436-218296458 CTGGAAGGGGTGGGCCCAGGTGG + Intronic
946358813 2:219206802-219206824 GAGGGAGGAGCGGGCGCCGGGGG + Exonic
946415776 2:219539026-219539048 GGGGAAGGAGGGAGCTGAGGAGG - Exonic
946418495 2:219552271-219552293 GACGAAGGTGGGGGCCCAGCAGG + Intronic
946435435 2:219648888-219648910 CAGGAAGCAGGGGGTTCAGGAGG + Intergenic
946501842 2:220257347-220257369 GAGGGAGGAGGAGGCGGAGGGGG + Intergenic
946688590 2:222294669-222294691 GAGGAAGGAGGGTACCCGGTGGG - Intronic
946739489 2:222787940-222787962 GAGAATGGAATGGGCCCAGGAGG - Intergenic
947089681 2:226495902-226495924 GAGGGAGGAGGGGGACTGGGAGG + Intergenic
947105523 2:226664237-226664259 GAGGAAGAGGTGGGCCCAAGAGG - Intergenic
947518524 2:230827634-230827656 GAGGCAGGAGTGAACCCAGGAGG - Intergenic
947772896 2:232684978-232685000 GAGGATGGATTGAGCCCAGGAGG + Intergenic
947828723 2:233124356-233124378 GAGGGAGCAGGGGGCCCTGGTGG - Intronic
947878101 2:233480926-233480948 GAGGAAGGAGGGGGACCGGGGGG + Intronic
947929496 2:233951986-233952008 GAGGAAGGTGTGAGCCCAGTGGG - Intronic
948057462 2:235019218-235019240 GTGGAACCAGGGAGCCCAGGAGG + Intronic
948080514 2:235201994-235202016 GATGCAGGAGGAGGCCGAGGAGG - Intergenic
948181866 2:235988649-235988671 CAGTAATGAGGGGGCCCAGTGGG + Intronic
948465032 2:238148184-238148206 GAGGAAGGCAGGGGCCTAAGAGG + Intronic
948479489 2:238240783-238240805 AGGGAGGGAGGGGGCCCCGGGGG - Intergenic
948511172 2:238466275-238466297 GAGGACCGAGGGGCCCCGGGCGG + Intergenic
948650337 2:239439824-239439846 GAGGAAGGAGGTGGCAGAAGAGG + Intergenic
948766392 2:240223724-240223746 AAGGAAGGAGGGTGCCGAGGTGG - Intergenic
948985696 2:241521623-241521645 GAGGAAGTGGGGGGCCGAGGTGG - Intergenic
948987303 2:241533324-241533346 GAGGAAGGTGGGCGACCTGGAGG - Intergenic
949001349 2:241615960-241615982 AAGCAAGGAGGGCGCCCATGGGG + Intronic
949007550 2:241658297-241658319 GAGGAAGGTGGTGGGGCAGGGGG + Intronic
1168810405 20:701093-701115 AGGGAAGGAGGGGGGACAGGAGG + Intergenic
1168840267 20:905593-905615 CAGGAAGGAGGGTTCCCAGGAGG + Intronic
1170438360 20:16352804-16352826 GAGGCCTGAGGGGCCCCAGGAGG - Intronic
1170447031 20:16439043-16439065 CAGGAAGGAGGAGGTTCAGGTGG + Intronic
1170551467 20:17480911-17480933 GAGGTGGGAGGAAGCCCAGGGGG + Intronic
1170998692 20:21391790-21391812 GAGGAAGGAGGGTGCGCCCGAGG - Intergenic
1171123648 20:22584640-22584662 GAGGAAGGAGGAGGAGGAGGCGG + Intronic
1171150077 20:22820055-22820077 AAGGAAGGACAGGGCCCTGGGGG - Intergenic
1171182022 20:23098032-23098054 GAGGACTGATGGGGCCCATGTGG - Intergenic
1171436354 20:25127591-25127613 GAGGCATGAGGAGCCCCAGGTGG - Intergenic
1172013641 20:31860877-31860899 GAAGGAGGTGGGGTCCCAGGAGG + Intronic
1172100969 20:32483741-32483763 GAGGGAGGAGTGGGCACGGGGGG + Intronic
1172178491 20:32986697-32986719 GAGCTGGGAGAGGGCCCAGGAGG + Intronic
1172184617 20:33023596-33023618 GAGGAAGGAGGGGGGAGATGAGG - Exonic
1172391397 20:34567780-34567802 GAGGAAGGAGGGAGCAAAGGAGG - Intronic
1172522368 20:35576339-35576361 GCGGAACCAGGGAGCCCAGGTGG - Intergenic
1172660969 20:36568551-36568573 GAGGAAGGCTTGAGCCCAGGAGG - Intergenic
1173378597 20:42514253-42514275 GAGCAAGGATGGGGAGCAGGAGG - Intronic
1173471941 20:43330667-43330689 GAGGAAGGAAGCTTCCCAGGGGG + Intergenic
1173790768 20:45826554-45826576 GAGGAAGGAGGGGGAGAAGGAGG - Intronic
1173930137 20:46811331-46811353 GCGGAGGGCGGGGGCCCGGGGGG - Intergenic
1174106363 20:48165273-48165295 GAGGAAGGAGTGGGTCCTGCAGG + Intergenic
1174262883 20:49309888-49309910 GAGGAAGGAGGTGGCTGAGGAGG - Intergenic
1174400859 20:50275114-50275136 CAGGAAGGAGGAGGCCTGGGTGG - Intergenic
1174446372 20:50593888-50593910 GAGGCAGGCAGGGGCCCACGAGG - Intronic
1174971527 20:55281255-55281277 GTGGGAGGAGGGGGGGCAGGGGG - Intergenic
1175226131 20:57444983-57445005 GAGGAGGGAGGGGCAGCAGGAGG + Intergenic
1175257263 20:57654977-57654999 GAGGCAGCGGGGGGCCCAGACGG - Intronic
1175261462 20:57676843-57676865 GAGGAAGTAGGGAGACAAGGAGG - Intronic
1175306959 20:57982765-57982787 GAGGGAGGTGGGCGCACAGGTGG + Intergenic
1175522571 20:59611570-59611592 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
1175527266 20:59643957-59643979 GAGGAAGGAGGTGGAGCAGAGGG + Intronic
1175758268 20:61544093-61544115 GAGGCAGGTGTGGGGCCAGGGGG - Intronic
1175763352 20:61576060-61576082 GATGAAAGAGGGGGTCCAGAGGG + Intronic
1175799324 20:61792154-61792176 GGGGAAAGCGGGGGCCCAGATGG + Intronic
1176160682 20:63646295-63646317 GGAGATGGAGGGGGACCAGGTGG + Intronic
1176297343 21:5081125-5081147 GAGGAAGGAGTGGGCCCTGGAGG - Intergenic
1176868546 21:14070355-14070377 GAGGAAAGAGGGGGCCTTGCAGG + Intergenic
1177156928 21:17510324-17510346 GAGGAGGGAGGAGGACCGGGAGG - Intergenic
1177739349 21:25135628-25135650 GAAGAAGGAGAGGGCACAAGAGG + Intergenic
1177894967 21:26846416-26846438 GAGGAAGGAGGGGTCCGGGAAGG - Intergenic
1178048345 21:28721203-28721225 GAGGATGGATGGAGCCCTGGAGG - Intergenic
1178298247 21:31429087-31429109 GAGGATGGTGTGAGCCCAGGAGG - Intronic
1178327365 21:31656923-31656945 GAGGATCGCGTGGGCCCAGGAGG - Intergenic
1178748190 21:35274042-35274064 GAGGAGGAGGGGGGACCAGGTGG - Intronic
1179031128 21:37720501-37720523 GAAGGAGGAGGGTGTCCAGGAGG + Intronic
1179080199 21:38163667-38163689 GAGGAAGGAGGAGGAAAAGGAGG - Intronic
1179524432 21:41966483-41966505 GAGGAAGGGGGTGACCCTGGAGG + Intergenic
1179644746 21:42768601-42768623 GAAGCAGGAGGGGGCCCAGGAGG + Intronic
1179707179 21:43188322-43188344 GAGGAGTGAGGGTGCCCAGCCGG - Intergenic
1179708439 21:43195637-43195659 CAGGGAGGAGGGGGCCTAGCAGG + Intergenic
1179769866 21:43606438-43606460 GAGGAGGGAGGAGGAGCAGGAGG + Intronic
1179822500 21:43944754-43944776 AAGAAAAGAGGGAGCCCAGGAGG + Intronic
1179859686 21:44180823-44180845 GAGGAAGGAGTGGGCCCTGGAGG + Intergenic
1179878661 21:44284414-44284436 GAGGAAGGTGGGGCCAGAGGTGG - Intergenic
1179903487 21:44406958-44406980 GAGGGAGGAGGGGGGCCTGGTGG + Intronic
1179979552 21:44889011-44889033 GGCCAAGGAGGGGGCCCAAGTGG + Intronic
1179984826 21:44914370-44914392 GGGGAAGCAGGGGGCTGAGGGGG + Intronic
1180064845 21:45407014-45407036 GTGGAAGGCGGGTGGCCAGGAGG + Intronic
1180166539 21:46033624-46033646 GAGGCAGCACGGGGTCCAGGAGG + Intergenic
1180259028 21:46654045-46654067 GAGGAAGGAGGAGGAGCTGGTGG + Intronic
1180469339 22:15641511-15641533 GGGGAAAGAGGGTGACCAGGAGG - Intergenic
1180833894 22:18920192-18920214 GAGCAGGCAGAGGGCCCAGGAGG + Intronic
1180857826 22:19059428-19059450 GAGGAAGTGGGAGGCCCTGGAGG - Intronic
1180941772 22:19664129-19664151 GAGGGAGGCGGAGTCCCAGGGGG - Intergenic
1181065927 22:20306047-20306069 GAGCAGGAAGAGGGCCCAGGAGG - Intergenic
1181517388 22:23422969-23422991 GAGGAGGGTGTGGGCGCAGGGGG - Intergenic
1181539496 22:23565864-23565886 CAGTAAGCAGGTGGCCCAGGAGG - Intergenic
1181631115 22:24151881-24151903 GAGGAAGGATGGGCCACTGGAGG - Intronic
1181783593 22:25209717-25209739 GAGGAAGGGGTGGGTCCAGCGGG - Intergenic
1182069673 22:27454804-27454826 GAGGACTGACAGGGCCCAGGTGG - Intergenic
1182480481 22:30605672-30605694 GAGGAAGGAGGGAGGCCAGTGGG - Intronic
1182575008 22:31267075-31267097 GAAGATGGAGGGGGCCCGGGAGG + Intronic
1182931472 22:34178296-34178318 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
1183285890 22:36963473-36963495 GAGGAAGGGGAGGGACGAGGAGG - Intergenic
1183341324 22:37283542-37283564 GAGGAAGGGGGATGCCCAGTGGG - Intronic
1183500609 22:38176518-38176540 GTGGGAGGAGGGTGCTCAGGAGG - Intronic
1183958774 22:41398303-41398325 CAAGAAGCAGAGGGCCCAGGAGG - Exonic
1184049921 22:41996910-41996932 GTGGAAGGACAGTGCCCAGGAGG - Exonic
1184096189 22:42317737-42317759 GTGGAAGAAGGGAGCCGAGGTGG + Intronic
1184133231 22:42530346-42530368 GAGGAAGGAGGAGGAGGAGGAGG + Intergenic
1184189741 22:42886797-42886819 GAGGCAGGGAGGGTCCCAGGAGG + Intronic
1184425338 22:44405949-44405971 GGGCAATGAGGGGTCCCAGGGGG - Intergenic
1184449817 22:44576184-44576206 GAGGAAGGAGGAGGAAGAGGAGG + Intergenic
1184591984 22:45490994-45491016 AAGGAGGAAGGGGCCCCAGGTGG + Intergenic
1184602766 22:45553193-45553215 GGAGAAGGAGGGGGCCTAGAGGG + Intronic
1184684678 22:46090763-46090785 GAGCAAGGAGGGCTTCCAGGAGG - Intronic
1184689788 22:46112282-46112304 GGGGAGGGAGGGGGCCGAGCAGG + Intronic
1184764649 22:46565288-46565310 GAGGAAGGAGGGAGGAGAGGGGG + Intergenic
1184837569 22:47032923-47032945 GAGGAAGGAGGGGCCACACAGGG - Intronic
1184985660 22:48131680-48131702 GAGGCAGGAGGGGGACCAGAGGG - Intergenic
1185005907 22:48276939-48276961 GGGGAAAGAGGGGGCAGAGGAGG + Intergenic
1185233011 22:49694087-49694109 GAGGATCTGGGGGGCCCAGGTGG + Intergenic
1185255538 22:49828712-49828734 GAGGACAGAGGGGGCCCTGCGGG + Intergenic
1185317055 22:50183800-50183822 GGAGAAGGAGGGGCTCCAGGAGG + Intergenic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
1185349282 22:50326246-50326268 GTGGAGGGACGGGGCCCATGGGG + Intronic
1203283980 22_KI270734v1_random:145490-145512 GAGCAGGCAGAGGGCCCAGGAGG + Intergenic
949226071 3:1697831-1697853 GAGGATGGATTGAGCCCAGGAGG - Intergenic
950026753 3:9825518-9825540 TAGGAAGGGGGTGGCACAGGTGG + Intronic
950106513 3:10392324-10392346 GTGGCAGGAGGGGGCACAGCTGG - Intronic
950475861 3:13214469-13214491 GAGGAAGGAGGGCTACGAGGAGG - Intergenic
950510612 3:13423936-13423958 GAGGATGGCTGGAGCCCAGGAGG - Intergenic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
951613982 3:24521904-24521926 GAGGAAGGGCGGGCCGCAGGCGG + Intergenic
951703878 3:25524621-25524643 GAGGAAGGAGGGAGGCAGGGAGG - Intronic
952402955 3:32979760-32979782 GAGGATGGCTGGAGCCCAGGGGG + Intergenic
952646662 3:35667907-35667929 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
953412205 3:42696948-42696970 GGGGAAGGTGTGGTCCCAGGGGG + Intronic
953434332 3:42866548-42866570 GAGGAAGGACAGGGGCCAGTTGG - Exonic
953661382 3:44894064-44894086 GAGGTGGGAGAGGGCCAAGGGGG - Intronic
953702921 3:45210590-45210612 GAGGAAGGCTGGAGCCCAGTAGG - Intergenic
953931307 3:47007215-47007237 CAGGCAGGAGGGGGCAGAGGTGG - Intronic
953965784 3:47304932-47304954 GAGGATGGTGTGAGCCCAGGAGG + Intronic
954026453 3:47786913-47786935 GAGGATGGCGTGGACCCAGGAGG + Intergenic
954130217 3:48556853-48556875 GAGGAGGGGCGGGGCCCAAGGGG - Exonic
954133099 3:48569961-48569983 GAGGACGGAGGAGGATCAGGGGG + Intronic
954157663 3:48695555-48695577 GGAGAAGGCGGGGGCCAAGGTGG - Intronic
954204931 3:49051576-49051598 GAGGGGGGGGGGGGCGCAGGGGG - Intronic
954662005 3:52231327-52231349 GAGGAAGATGGGGGCGCTGGGGG - Intronic
954844830 3:53546262-53546284 GAGGGAGGTGTGGGCCCTGGGGG + Intronic
955041292 3:55320196-55320218 CTGGAAGTAGGGGGTCCAGGTGG + Intergenic
955600586 3:60641350-60641372 GATGAGGCAGAGGGCCCAGGAGG + Intronic
955771278 3:62387133-62387155 GAGCAAGGAGGGGGGCAGGGTGG - Intergenic
955883439 3:63572281-63572303 GAGGAAGGAGGAGGAGGAGGAGG - Intronic
956063330 3:65370731-65370753 GAGGATGGCTGGAGCCCAGGAGG - Intronic
956198792 3:66683909-66683931 GAAGAAGGAGGGGGAGGAGGAGG - Intergenic
956716884 3:72087142-72087164 GAGGAAGAAAGCGGCCCAGGTGG + Intergenic
957171616 3:76744447-76744469 GAGGATCATGGGGGCCCAGGAGG - Intronic
957405190 3:79766778-79766800 GAGCAAGAAGGGGCCCCAGAAGG + Intronic
957762640 3:84578168-84578190 GAGGAAGGAGGAGGAGGAGGAGG + Intergenic
957822942 3:85401483-85401505 GAAGATGGAGGGGCCACAGGAGG + Intronic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
960454262 3:117851481-117851503 GAGAATGGAGTGGACCCAGGAGG - Intergenic
960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG + Intergenic
960601342 3:119462045-119462067 GTGGAAGGAGGGGCCCTAGTCGG - Exonic
960626160 3:119684345-119684367 GCGGAAGTAGGGGGCTCAAGGGG - Intergenic
960702985 3:120455225-120455247 GGGGGAGTAGGGGGCCAAGGTGG + Intergenic
960965809 3:123104044-123104066 GAAGAAGCAAGGAGCCCAGGTGG + Intronic
961205704 3:125079704-125079726 GAGGATGGCTGGAGCCCAGGAGG + Intergenic
961393105 3:126568312-126568334 GAGGGAGGGGGTGGCCCAGCAGG + Intergenic
961431912 3:126889613-126889635 CAGGAACATGGGGGCCCAGGTGG - Intronic
961558798 3:127714744-127714766 GAGGCAGGAGGGGACCCGGGTGG + Intronic
961602466 3:128072288-128072310 GAGGAAGCACCAGGCCCAGGTGG - Intronic
961649626 3:128410890-128410912 CGGGAAGGAGGGGGCTCGGGTGG + Intergenic
961660077 3:128463816-128463838 GAGGCAAGAGGAGGCCAAGGTGG + Exonic
962263330 3:133928484-133928506 GAGCAAGGTGGGGGCCCCGTGGG + Exonic
962370799 3:134819376-134819398 GAGGCAGAAGGGTGCCCATGTGG + Intronic
962917477 3:139917714-139917736 GATGATGGAGGTGGTCCAGGAGG - Intergenic
964671394 3:159229822-159229844 GGGGAAGGAGGGGGAGAAGGAGG - Intronic
966362739 3:179148166-179148188 GAGGAGGGGGGGGGCCGAGGGGG + Intronic
966787796 3:183636293-183636315 GAGGAATGACGGGGTCAAGGTGG + Exonic
966862979 3:184241035-184241057 GAGGCAGGAGGGGTTCCTGGGGG - Exonic
966992852 3:185252038-185252060 GAGGATGGGGGTGGCACAGGTGG + Intronic
967240156 3:187430871-187430893 GAGGAAGCAGGGGGCAGAGGTGG + Intergenic
967272855 3:187745012-187745034 GAGGAAGGAGGGGAATTAGGGGG - Intronic
967303987 3:188043028-188043050 AAGGAAGGAGGCTGGCCAGGAGG - Intergenic
967319256 3:188179343-188179365 GCTGAAGGCGGGGGCCTAGGAGG - Intronic
967815571 3:193795672-193795694 GAGGCAGGAGTGGACACAGGTGG - Intergenic
967933334 3:194706584-194706606 GAGGAAGGATGGGGGTGAGGAGG + Intergenic
967983673 3:195080233-195080255 TAGGAAGGAAGGGGCCCAGATGG + Intronic
968330820 3:197867932-197867954 GAGGATGGATTGAGCCCAGGAGG + Intronic
968361216 3:198148170-198148192 GAGGGCGCAGGGGTCCCAGGTGG + Intergenic
968477603 4:819697-819719 GAGGAAGGTGGGGGCCAGGGTGG - Intronic
968501569 4:952534-952556 GTGCAGGTAGGGGGCCCAGGGGG + Intronic
968614371 4:1570805-1570827 GAGGAGAGAGGGTGCCCAGGCGG + Intergenic
968698196 4:2042696-2042718 CAGGGTGGAGGGGGCGCAGGGGG - Intronic
968758552 4:2429008-2429030 GAGGAATGGGGGTGCCCAGGAGG - Intronic
968853749 4:3102918-3102940 GAGGAATGTGGGGCCCCAGCTGG + Intronic
969021763 4:4143803-4143825 GAGGAAGGTGCGGGGCGAGGCGG - Intergenic
969060654 4:4431718-4431740 GAGGAGGGAGGGTGCACAGAAGG - Intronic
969087401 4:4666781-4666803 GAAGGAGGAGGAGGCCCAGAAGG - Intergenic
969131772 4:4995505-4995527 GTGTAAGTAGGGGACCCAGGAGG - Intergenic
969334513 4:6499797-6499819 AAGTAAGGAGGGAGCCCAGCAGG - Intronic
969360508 4:6660430-6660452 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
969515004 4:7642223-7642245 GAGCAAAGAGGTAGCCCAGGAGG - Intronic
969542994 4:7805371-7805393 GAGAAAGGAAAGGCCCCAGGGGG - Intronic
969618765 4:8268535-8268557 GAGGAGGGAGGGGGAGCTGGAGG - Intergenic
969682899 4:8653042-8653064 GAGGAGGGAGAGGGCCAGGGTGG - Intergenic
969692213 4:8709998-8710020 GAGGCAGGAGAGGACTCAGGGGG + Intergenic
969732105 4:8963612-8963634 GAGGAAGGTGCGGGGCAAGGCGG + Intergenic
971396252 4:26230098-26230120 GAGGATCAAGGGAGCCCAGGAGG + Intronic
971618457 4:28824159-28824181 GAGGTAGTGGGGGGTCCAGGTGG - Intergenic
972568577 4:40290450-40290472 GAGGAAGGAGGGTGGGCAGGAGG - Intergenic
972624346 4:40781534-40781556 GAGTATCGATGGGGCCCAGGAGG - Intronic
972710009 4:41586196-41586218 GAGGATTGATGGAGCCCAGGAGG - Intronic
972788130 4:42346294-42346316 AAGTCAGGAGGGGGCCGAGGTGG - Intergenic
973159137 4:46993864-46993886 GCGGAAGGGAGGGGGCCAGGAGG - Exonic
973331132 4:48911042-48911064 GAGGGAGGGAGGGGCACAGGAGG - Intergenic
973959672 4:56097222-56097244 GAGGATGGAGGAGGCCCTGTTGG + Intergenic
974059055 4:57013625-57013647 GAGGATCGTTGGGGCCCAGGAGG - Intronic
974112204 4:57538058-57538080 GAAGAAGGAGGAGGATCAGGAGG - Intergenic
976143620 4:82019556-82019578 GAGAAAGGAGGGAGCCAAGATGG + Intronic
976308172 4:83582367-83582389 GAAGCAGAAGGGGACCCAGGTGG - Intronic
976621070 4:87127809-87127831 GTGGAAGGAGGGGGTGCAGCAGG + Intronic
976939954 4:90687673-90687695 AAGGAAGGAGGGCTCCCAAGGGG - Intronic
977203041 4:94139672-94139694 AAGGAAGGAAGGGGCCAAGTCGG + Intergenic
977600881 4:98932133-98932155 GAGAAAGGAGTGAACCCAGGAGG + Intergenic
977919218 4:102625183-102625205 GAGGAAGGAGGGAGGTGAGGAGG - Intergenic
978264770 4:106810402-106810424 GAAGAAGGAGGGGGAGGAGGAGG - Intergenic
978954757 4:114599405-114599427 GATGGAGGTGGGGGACCAGGAGG + Intronic
979594119 4:122514245-122514267 GAGGATGGATGGAGACCAGGAGG + Intergenic
979698523 4:123640881-123640903 AAGGAAGGAGGGAGGCAAGGAGG + Intergenic
980576830 4:134693899-134693921 GAAGAAAGAGGGGGCCTTGGAGG - Intergenic
981949998 4:150394489-150394511 AACGGAGGAGGGGGCACAGGAGG + Intronic
982235734 4:153249579-153249601 GAGCAGGGAGGTGGCCGAGGCGG - Intronic
982235742 4:153249602-153249624 GAGCAGGGAGGTGGCCGAGGCGG - Intronic
982959913 4:161823357-161823379 GACGAGGGAGGGAGGCCAGGGGG - Intronic
983531901 4:168818495-168818517 GAGGATGGCTTGGGCCCAGGAGG + Intronic
984639341 4:182144770-182144792 AAGGAAGGAGGGCGCGCCGGCGG - Intronic
984902585 4:184598317-184598339 GAGGAAGGAGAGGGCTGATGGGG - Intergenic
984973454 4:185210026-185210048 CAGGAAGGAGAGGGCCACGGCGG - Intronic
985064376 4:186105764-186105786 GTGCAAGGAGGGTGCCCAGGGGG - Intronic
985135133 4:186778572-186778594 GGGAAAGAAGGGGGCCCAGGTGG - Intergenic
985315362 4:188653483-188653505 GGGGATGGAGGGTGCCTAGGTGG - Intergenic
985406810 4:189646222-189646244 GAGGAAGGCGGGAGCGCAGCGGG + Intergenic
985406846 4:189646402-189646424 GAGGAAGGCGGGAGCGCAGCGGG + Intergenic
985497607 5:218444-218466 GGGGCAGGCGGGGGCCGAGGCGG + Intronic
985688572 5:1294774-1294796 GCGGAAGGAGGGGGCGGCGGGGG + Exonic
985737715 5:1594347-1594369 GGGGCAGGCGGGGGCCGAGGCGG - Intergenic
985761464 5:1751406-1751428 GAGGAAGGAGAGGGACAAGGGGG - Intergenic
985761477 5:1751443-1751465 GAGGAAGGAGAGGGATGAGGGGG - Intergenic
985806709 5:2050111-2050133 GGGGAAGGACTGAGCCCAGGAGG - Intergenic
985851624 5:2392618-2392640 GAGGAAGGAGGGAGGAAAGGAGG - Intergenic
985988871 5:3538890-3538912 GGGGAAGGAGGCTGCCCAGCAGG + Intergenic
986085256 5:4438346-4438368 GAGGAAGGAGGAGGAGGAGGAGG + Intergenic
986183641 5:5417002-5417024 GGGGAAGGAGGGGGAGGAGGAGG + Intergenic
986498280 5:8370024-8370046 GAGGAAGGAGGAAGCGGAGGAGG + Intergenic
986822836 5:11486590-11486612 GGGGAAGGAGGGAATCCAGGAGG + Intronic
987082593 5:14438926-14438948 AAGGAGGGAGGGGACCCAGAAGG + Intronic
987700934 5:21397294-21397316 GAAGAAGGAGGAGGACGAGGAGG + Intergenic
988255778 5:28818418-28818440 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
988255790 5:28818457-28818479 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
988632073 5:32942296-32942318 GAAGAAGGAGGAGGACGAGGGGG + Intergenic
988686519 5:33530515-33530537 GAGGCTGGAGAGGGCACAGGTGG + Intronic
989592519 5:43124938-43124960 GAGGATTGCTGGGGCCCAGGAGG + Intronic
990348787 5:54895136-54895158 GAGCAATGAGGGGGCCCACATGG + Intergenic
990403068 5:55459531-55459553 GAAAAATGTGGGGGCCCAGGGGG + Intronic
992543737 5:77789555-77789577 GAGGATGGCTTGGGCCCAGGAGG + Intronic
992646415 5:78815903-78815925 AAGAAAGAAGGGGCCCCAGGAGG - Intronic
994397302 5:99235265-99235287 GGGGGAGGAGGGGGACAAGGGGG + Intergenic
995404317 5:111777003-111777025 GAGGAAGGAGGTGGAGGAGGAGG + Intronic
995404324 5:111777025-111777047 GAGGAAGGAGGTGGAGGAGGAGG + Intronic
995525180 5:113045013-113045035 GAGGTGGAAGGCGGCCCAGGTGG - Intronic
996908735 5:128632308-128632330 GAGGAAGGAGGAGCCCAAAGTGG + Intronic
997064383 5:130544729-130544751 GAGGAAGGAGGATGCCAAGGGGG + Intergenic
997199008 5:131998476-131998498 CAGGAAGAAAGGGGCCCTGGTGG + Intronic
997200864 5:132009466-132009488 GAGAAAGGCTGGGGGCCAGGTGG + Intronic
997381038 5:133438555-133438577 GAGGAAGGAGGTGGATCTGGTGG + Intronic
997534767 5:134610642-134610664 GTGGGAGGATGGAGCCCAGGAGG + Intronic
997554616 5:134784520-134784542 GAGGAAGGAGAGGGGCCAATAGG + Exonic
997594006 5:135094426-135094448 GAGTAAAGAGGATGCCCAGGAGG - Intronic
998013604 5:138714958-138714980 GAGAGAGGAGGGTGCCCTGGAGG + Intronic
998199466 5:140108021-140108043 GAGGAAGGAGGGCGGGCTGGCGG - Intronic
998227132 5:140335795-140335817 CATCAAGGAGAGGGCCCAGGAGG + Intronic
998305280 5:141069954-141069976 GAGGATGGAGTGAGTCCAGGAGG + Intergenic
998422795 5:142003063-142003085 GAGGGAGGTGTGGGTCCAGGAGG - Intronic
998726183 5:145017322-145017344 GAGGATTGAGGGAGCTCAGGAGG - Intergenic
999006087 5:147981106-147981128 GAAGAAGGTGGTGGCCTAGGAGG + Intergenic
999122176 5:149218028-149218050 GGGGTAGGAGGAGCCCCAGGAGG + Intronic
999249314 5:150172661-150172683 GGGGGAGGAGGGGGCCCAGCAGG + Intronic
999698158 5:154204360-154204382 GAGGTAGGAGAGGAGCCAGGAGG - Intronic
1000081377 5:157850519-157850541 GAGGATGGATTGAGCCCAGGAGG + Intronic
1000294492 5:159901373-159901395 GAGGAAGGAGGAGGAGGAGGAGG + Intergenic
1000607809 5:163343198-163343220 GAGGATGGATTGAGCCCAGGAGG + Intergenic
1001035242 5:168292309-168292331 GGGGCAGGTGGGGGCCCAGGCGG - Intronic
1001120618 5:168977051-168977073 GGGGAACAAAGGGGCCCAGGAGG + Intronic
1001492049 5:172162829-172162851 GATGGTGGAGGAGGCCCAGGTGG + Intronic
1001776279 5:174331398-174331420 GAGTCAGGAGGGGGCCTGGGAGG + Intergenic
1001816332 5:174672201-174672223 GAGGCATGGGAGGGCCCAGGAGG - Intergenic
1001929479 5:175662581-175662603 GGGGAAGCAGGGAGGCCAGGTGG - Intronic
1001936591 5:175709878-175709900 GAGGCTGGAGAGGGCCCAGCAGG - Intergenic
1002140377 5:177133999-177134021 GAGGGAGGAGGGTGGCCGGGCGG + Intronic
1002170404 5:177371292-177371314 CAGGAGGAAGGGGGTCCAGGTGG + Intronic
1002175403 5:177398713-177398735 GAGGAAGGAAGGTGGCAAGGAGG - Exonic
1002534418 5:179868426-179868448 GATGCAGTAGGAGGCCCAGGCGG - Intronic
1002550532 5:179987255-179987277 GAGGATGGATTGAGCCCAGGAGG - Intronic
1002634750 5:180601749-180601771 GAGGAAGGGGGAGGTCCACGGGG + Exonic
1002662810 5:180802942-180802964 GGGAAAGGAGGCGGGCCAGGAGG - Intronic
1002701753 5:181129777-181129799 CAGGAAGGAGGGGGCTGATGTGG - Intergenic
1002704046 5:181148362-181148384 TAGGAAGGAGGGGGCTGATGTGG + Intergenic
1002887810 6:1311995-1312017 GGGGAACGAGGTGGCCGAGGTGG - Intergenic
1003976170 6:11346632-11346654 GGGGAAGGAGGGGGCTGGGGAGG + Intronic
1004345239 6:14843263-14843285 GAGGATGGATTGAGCCCAGGAGG + Intergenic
1004716905 6:18226688-18226710 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1004746941 6:18519705-18519727 TAGGATGGAGTGAGCCCAGGAGG + Intergenic
1004961919 6:20799675-20799697 GAGGTAGGATTGGGCCAAGGTGG + Intronic
1005471555 6:26166395-26166417 GAAGGAGGAGGGGGTCCAGGAGG - Intronic
1005811145 6:29517478-29517500 GAGGAAGGAGGAAGCTCAGGAGG - Intergenic
1005856090 6:29864177-29864199 TAGGCAGGAGGGAGCCCGGGAGG + Intergenic
1005930577 6:30481284-30481306 GCGGCAGGAGGGGGCGCACGGGG - Intergenic
1006149531 6:31979223-31979245 AAGGAAGGAGGGGGAGGAGGAGG + Intronic
1006160470 6:32038094-32038116 GCAGAGGGAGAGGGCCCAGGTGG + Intergenic
1006304665 6:33211814-33211836 CAGGAAGCAGGGGAGCCAGGAGG + Exonic
1006317326 6:33298504-33298526 GAAGAGGGTGGGGGCCCAGGTGG - Exonic
1006522406 6:34578714-34578736 GAGGACAGAGAGGGCTCAGGTGG + Intergenic
1006929826 6:37680969-37680991 GAGGAAGGGTGGGCCCCAGTAGG - Intronic
1006950740 6:37819684-37819706 GAAGAAGGAGGGAGCCGAGGAGG - Exonic
1007111649 6:39316329-39316351 GCAGAAGCAGGGGGCCCAGTGGG + Intronic
1007692106 6:43709127-43709149 GGGGAAGGAGGGGGAGGAGGGGG - Intergenic
1007714521 6:43848038-43848060 GAGGAAGGTGGGGGCGGATGGGG + Intergenic
1010318594 6:74479919-74479941 GTGGCAGGAGAGGGACCAGGAGG + Intergenic
1010381374 6:75229176-75229198 GAGGATGGATTGAGCCCAGGAGG + Intergenic
1011596215 6:89019337-89019359 GAGGATGGCTGGAGCCCAGGAGG - Intergenic
1012881484 6:104796198-104796220 GAGGAGGGATTGAGCCCAGGAGG - Intronic
1013168057 6:107611276-107611298 GAAGAAAGAGGGGGCCCCGGTGG + Intronic
1013274587 6:108572066-108572088 CAGTAAGGAGGGGGACTAGGGGG - Intronic
1013296307 6:108761128-108761150 GAGCAAGGAGAGGAACCAGGAGG - Intergenic
1013775393 6:113673622-113673644 GTGGAAGGAGGGGCCCCTGGAGG + Intergenic
1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG + Intronic
1014109243 6:117602239-117602261 GCAGCCGGAGGGGGCCCAGGGGG - Exonic
1016161307 6:140883945-140883967 GAGAAAGGAGGAGGAGCAGGAGG - Intergenic
1017001825 6:150002554-150002576 GAGGAAGGAGGGGGCAAAGATGG + Intergenic
1017297192 6:152811867-152811889 GAGGAAGGAGGGAGCGAGGGAGG - Intergenic
1017682061 6:156874159-156874181 GAGGCAGGAATGAGCCCAGGAGG - Intronic
1017757989 6:157545750-157545772 GAGGAAGGAGAGGGCTTTGGAGG + Intronic
1017820845 6:158048201-158048223 GAGGAAGGGAGAGGCCCCGGGGG + Intronic
1017877483 6:158536663-158536685 GAGAAGAGAGGGGGCGCAGGCGG + Exonic
1018038817 6:159904069-159904091 GGGGAAGAAGGGCTCCCAGGAGG - Intergenic
1018702335 6:166436871-166436893 GGGGAAGGCGGGAGCCCAGGAGG - Intronic
1018726878 6:166619610-166619632 GAGGAGGCAGGAAGCCCAGGGGG - Intronic
1018916354 6:168134872-168134894 GAGGCAGGAGGGTGTGCAGGAGG + Intergenic
1018960116 6:168441718-168441740 GAGGCAGGTGGGGTCCCAGCCGG - Intronic
1019176669 6:170162761-170162783 GAGGAAGGAGGGCTGCCATGGGG - Intergenic
1019385469 7:753299-753321 CAGAAAGGAGCGGGCACAGGCGG + Intronic
1019390597 7:784440-784462 GAGTTAAGAGGGGGTCCAGGAGG - Intronic
1019404866 7:877818-877840 GAGAAAGGCGGGGGGCCGGGGGG - Intronic
1019473230 7:1232247-1232269 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1019494969 7:1333464-1333486 GAAGAAGGAGGGGGAGGAGGAGG - Intergenic
1019564787 7:1673929-1673951 GAGGCAGGAGGGGGTCCAGCAGG + Intergenic
1019624965 7:2011363-2011385 GGTGAAGGCGGGGGCCCAGCAGG - Intronic
1019666093 7:2252927-2252949 GAGGGATGAGGGGGAGCAGGAGG - Exonic
1019763124 7:2828981-2829003 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1019812543 7:3175205-3175227 GAGGAGGCAGGGGCCCCGGGAGG - Intergenic
1019907605 7:4076464-4076486 GAGGATGGATTGAGCCCAGGAGG + Intronic
1019924179 7:4181531-4181553 GAGGGAGATGGGGGCCCAGTGGG - Intronic
1020817353 7:12922170-12922192 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1021188449 7:17592649-17592671 GTGGAAGGAGGGGGAGGAGGAGG + Intergenic
1021697080 7:23286245-23286267 GGGGAAGGAGGGGGGAGAGGGGG - Intergenic
1021697125 7:23286346-23286368 GTGGAAGGAGGGGGGAGAGGGGG - Intergenic
1021782818 7:24122579-24122601 GAGTAAGGTGGGGGCCCACATGG - Intergenic
1021934335 7:25615123-25615145 GAGGGAGGAGAGGGCCCTTGGGG - Intergenic
1021978491 7:26031596-26031618 GAGGAAGTTGAGGGCCCACGAGG + Intergenic
1022097147 7:27148124-27148146 GAGGAAGGAGGGGACCTGGCGGG - Intronic
1022121696 7:27314620-27314642 GCTGCAGGAGGGGACCCAGGCGG + Intergenic
1022413997 7:30162670-30162692 GAGGGAGGAGGGAGCAGAGGTGG - Exonic
1022473401 7:30695084-30695106 GAGGAAGGAGGGGGAGGACGAGG + Intronic
1022536525 7:31101994-31102016 AAGGAAGGAGGAGACACAGGGGG - Intronic
1022735510 7:33072081-33072103 GAGGATTGATTGGGCCCAGGAGG - Intergenic
1022966916 7:35482547-35482569 GAGGGTGGGGGAGGCCCAGGTGG + Intergenic
1023177515 7:37448386-37448408 GCGGAGGGAGGGGGCGCTGGAGG - Intronic
1023396937 7:39760092-39760114 GAGGGAGAAGGGGGTACAGGAGG - Intergenic
1023789983 7:43746262-43746284 CAGGAAGGAAGGGGGCCATGGGG + Intergenic
1023850217 7:44146149-44146171 GAGGAGGGGGAGGGCCCAAGGGG - Intronic
1023874950 7:44281871-44281893 GAGGCAGGTGGGGGTCCTGGAGG - Intronic
1023965984 7:44963261-44963283 GAGGGAGGAGGGGGCGGTGGGGG - Intronic
1024028351 7:45433329-45433351 GAGGAAGGAGGAGGGGGAGGTGG - Intergenic
1024226397 7:47329338-47329360 AAGAAAGGAGGCAGCCCAGGAGG - Intronic
1024421114 7:49167825-49167847 GAGGAGGGAGGGAGCCAAGAGGG - Intergenic
1024591966 7:50894595-50894617 GAGGAAGGAGGAGCCACAAGAGG + Intergenic
1024923804 7:54591074-54591096 GAGGATGGCTTGGGCCCAGGAGG - Intergenic
1025036317 7:55594420-55594442 GAGGAACCAGGGAGCCCAGGAGG + Intergenic
1025175904 7:56802357-56802379 GAGGAAGGAGGTGGGCCAGGAGG + Intergenic
1025176333 7:56804207-56804229 GAGGCAGGAGCTGGCCCTGGAGG - Intergenic
1025198691 7:56949385-56949407 GAGGAAGGAGAGGGGAGAGGAGG - Intergenic
1025232207 7:57210380-57210402 GTGGAAGGATGGGGCCCTGGTGG - Intergenic
1025673257 7:63627546-63627568 GAGGAAGGAGAGGGGAGAGGAGG + Intergenic
1025673280 7:63627608-63627630 GAGGAAGGAGGAGGGCGGGGCGG + Intergenic
1025694194 7:63766434-63766456 GAGGCAGGAGCTGGCCCCGGAGG - Intergenic
1025695460 7:63772215-63772237 GAGGCAGGAGCTGGCCCTGGAGG + Intergenic
1025695889 7:63774065-63774087 GAGGAAGGAGGTGGGCCAGGAGG - Intergenic
1025898746 7:65726728-65726750 CAGGAGGGATGGGGCCTAGGGGG - Intergenic
1025995850 7:66526964-66526986 GAGGAAGGCTTGAGCCCAGGAGG + Intergenic
1026727501 7:72880794-72880816 GAGGATGGATGGAGCCCAGGAGG + Intronic
1027116340 7:75484935-75484957 GAGGATGGATGGAGCCCAGGAGG - Intronic
1027121631 7:75526631-75526653 GAGGATGGATGGAGCCCAGGAGG - Intergenic
1027141699 7:75662093-75662115 GGGGAAGGAGGGGGCGTAGCTGG + Intronic
1027275488 7:76550770-76550792 GAGGATGGATGGAGCCCAGGAGG + Intergenic
1027464937 7:78503597-78503619 GGGGAAGGAGGGGGAGAAGGAGG - Intronic
1027539843 7:79453394-79453416 GAGGAGCAAGGGGGCCCAGGGGG + Exonic
1027686019 7:81279595-81279617 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
1028585535 7:92447786-92447808 GTGGAAGAAGGGAGCGCAGGGGG + Exonic
1029122888 7:98280520-98280542 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1029145049 7:98439856-98439878 GAGGAAGAAGGGGGCTCTGCAGG - Intergenic
1029170838 7:98628072-98628094 GAGGGAGGAGTGGGCCAAGAAGG - Intronic
1029421805 7:100475870-100475892 GCAGAGGAAGGGGGCCCAGGTGG + Intronic
1029438398 7:100574779-100574801 GGGGAAGGGGAGGGCACAGGAGG + Exonic
1029443877 7:100602480-100602502 CAGTGAGGAGGGGCCCCAGGAGG - Exonic
1029490760 7:100868713-100868735 GAGGAAAGTGGGGGCCCGGGAGG - Exonic
1029514799 7:101018079-101018101 GGGAAGGGAGGGGTCCCAGGGGG - Intronic
1029538150 7:101167626-101167648 GGGGAGGGAGGGAGCCAAGGGGG + Intergenic
1029721196 7:102365320-102365342 GAGGATGGATGGAGCCCAGGAGG + Intronic
1030291059 7:107872919-107872941 GAGGATTGACGGAGCCCAGGAGG - Intergenic
1030820212 7:114085077-114085099 GAGGAGAGAGCGGGCCCCGGAGG - Intergenic
1031034508 7:116773628-116773650 GAGGAAGGAAGGAGCCTAGCTGG - Intronic
1031083763 7:117282455-117282477 GAGGAAGGAGGAGGGGGAGGAGG + Intronic
1031555969 7:123176779-123176801 GAGGTAGGAGGAGAACCAGGAGG - Intronic
1031597308 7:123662868-123662890 GAAGAAGGAGGGGGAGGAGGAGG - Exonic
1031854636 7:126907314-126907336 GAGGAAGGAGGGGGAAGAAGGGG + Intronic
1032037748 7:128531984-128532006 GAAGATGGGGGAGGCCCAGGCGG + Intergenic
1032177430 7:129642848-129642870 GAGGATGGAGTGAGCCCAGGAGG - Intronic
1032395494 7:131586456-131586478 GAGGCAGGAGGGGGCCCTTTGGG + Intergenic
1032466835 7:132151405-132151427 GAGGAAGGAGGAGGAGGAGGAGG + Intronic
1032490635 7:132321653-132321675 CAGGCAGGAGGGAGCCCCGGGGG + Intronic
1032508052 7:132450843-132450865 GAGCAAGTCGGAGGCCCAGGAGG + Intronic
1032529330 7:132607318-132607340 GAGGCAGGAGGGGGAGAAGGTGG - Intronic
1032641843 7:133778492-133778514 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1033036327 7:137879341-137879363 GAGGGAGGAGGGGGCCAGGCAGG + Exonic
1033329207 7:140404125-140404147 GAGGAAGAAGGGGGCACTGGGGG + Exonic
1033398298 7:140996290-140996312 GAGAACGGTGTGGGCCCAGGAGG + Intergenic
1034185062 7:149169539-149169561 GAGGATGGCTTGGGCCCAGGAGG - Intronic
1034418350 7:150976779-150976801 GAGGTGGGGGTGGGCCCAGGGGG - Intronic
1034447843 7:151122529-151122551 GGAGAAGGAGGAGGACCAGGAGG - Intronic
1034651165 7:152691348-152691370 GAGGAAGCATGGGGTCCAGTCGG + Intergenic
1035026618 7:155830723-155830745 GAGGATGGCTGGAGCCCAGGTGG - Intergenic
1035057159 7:156043344-156043366 GAGGAAGGAGGGTGTCTGGGTGG + Intergenic
1035125631 7:156606824-156606846 GAGGTAGGGTGGTGCCCAGGCGG - Intergenic
1035186701 7:157131838-157131860 GAGGATGGCTTGGGCCCAGGAGG + Intergenic
1035344013 7:158186497-158186519 GAGGGGGTAGGTGGCCCAGGTGG - Intronic
1035344034 7:158186564-158186586 GAGGGGGCAGGTGGCCCAGGCGG - Intronic
1035344056 7:158186631-158186653 GAGGGGGCAGGTGGCCCAGGCGG - Intronic
1035344077 7:158186698-158186720 GAGGGGGCAGGTGGCCCAGGCGG - Intronic
1035404560 7:158588687-158588709 GCGGAGGTTGGGGGCCCAGGTGG - Intergenic
1035569983 8:666521-666543 GAGAGAGGAGGGGCCCCAGCAGG - Intronic
1035624176 8:1059286-1059308 GGGGATGCAGGGGTCCCAGGAGG - Intergenic
1035657200 8:1319172-1319194 GAGGAGGGAGGGGAGCCATGGGG - Intergenic
1035753058 8:2009102-2009124 GAGGAAGAAAGAAGCCCAGGTGG - Intergenic
1035765102 8:2099228-2099250 GAGGTGGGAGGGAGCACAGGAGG + Intronic
1035985116 8:4420893-4420915 GAGGGAGGAGGGCTCCTAGGAGG - Intronic
1036116778 8:5967686-5967708 GAAAGAGGAGGGGGCACAGGGGG - Intergenic
1036134946 8:6152332-6152354 GGGGAGGGAGGGGACCCAGATGG + Intergenic
1036448425 8:8843489-8843511 GAGGATGGATTGAGCCCAGGAGG + Intronic
1036571702 8:9985421-9985443 AAGTAAGGAGGAGGCCGAGGTGG - Intergenic
1036895643 8:12632767-12632789 GAGGAAGGCTTGAGCCCAGGAGG + Intergenic
1037741177 8:21610424-21610446 GAGGAAGGTGGGGGCTGAGAGGG + Intergenic
1037764600 8:21764651-21764673 GAGGAGGGATGGGGTCCATGTGG - Intronic
1037805669 8:22056880-22056902 AAGGAGGGTGGGGGCCCAGAGGG + Intronic
1037834193 8:22206756-22206778 AAGAAAGGAGGGGGGGCAGGAGG + Intronic
1038040554 8:23720544-23720566 CAGGCAGGAGGGGGACCCGGGGG + Intergenic
1038076067 8:24076594-24076616 GAGGAAGGAGGAGGAGGAGGAGG - Intergenic
1038326962 8:26578899-26578921 GAGGAAGGCGGGGGGCAAGGCGG + Intronic
1038328399 8:26589392-26589414 GAGGAGTGAGGCTGCCCAGGCGG - Intronic
1038416069 8:27397038-27397060 AAGGCAGGAAAGGGCCCAGGTGG - Intronic
1038547929 8:28440349-28440371 AAGGATGGAGGAGGCCGAGGTGG - Intronic
1038577499 8:28717490-28717512 GTGGAACGAGGCGGCCCTGGTGG + Exonic
1038865616 8:31436069-31436091 GAAGAGGCAGGGGGCCTAGGAGG - Intergenic
1038874949 8:31538399-31538421 AAGGAAGGATTGAGCCCAGGAGG - Intergenic
1039480421 8:37869136-37869158 GAGGATTGATTGGGCCCAGGAGG + Intronic
1039684143 8:39778663-39778685 GAAGAAGGAGGAGGACGAGGAGG + Intronic
1039821512 8:41139262-41139284 GAGGCAGGAAGGGATCCAGGTGG - Intergenic
1040034721 8:42859092-42859114 GAGGAAGGCTTGAGCCCAGGAGG + Intronic
1040380169 8:46864822-46864844 GAGGAGTGAGGAGGCCCAGGTGG + Intergenic
1040522772 8:48192721-48192743 GAGGAAGGAGGAGGTGGAGGAGG + Intergenic
1040550033 8:48430514-48430536 CAGGAAGCAGGGGACCCTGGAGG - Intergenic
1040576151 8:48653035-48653057 GAGGAGGGAGGGAGGCCATGTGG + Intergenic
1040850950 8:51899613-51899635 CAGGCAGGGCGGGGCCCAGGCGG - Intergenic
1041463159 8:58133518-58133540 GAGGAAGGATGGGACTCAGAGGG + Intronic
1041623269 8:59998434-59998456 GAGGAAGGATGGGGCCAATATGG + Intergenic
1042137495 8:65645613-65645635 GAGGATCGCTGGGGCCCAGGAGG - Intronic
1042216005 8:66430004-66430026 GATGAGGGAGGAGGACCAGGAGG + Exonic
1042245042 8:66701403-66701425 GAGGAAGGAGGGAGGGAAGGAGG - Intronic
1042835050 8:73072116-73072138 GAGGAAGGAGAGGGGCCAGGAGG + Intronic
1043388179 8:79768078-79768100 GGGGAAGGAGGAGGCGCGGGCGG + Intergenic
1044321222 8:90803764-90803786 GCAGATGGAGGGTGCCCAGGGGG - Intronic
1044338257 8:91015331-91015353 GTGGAAGGAGGGGGAGAAGGAGG + Intronic
1044619109 8:94171989-94172011 GAGGGAGGAGGGGGAGGAGGGGG - Intronic
1045341388 8:101257669-101257691 GAGGCATGAGGGGCCTCAGGTGG - Intergenic
1045474655 8:102542605-102542627 GAAGAAGGAGGGGGAGGAGGAGG - Intergenic
1045913306 8:107435990-107436012 GAGGATGGCTTGGGCCCAGGAGG - Intronic
1046547466 8:115669234-115669256 GAGGGAGGAGGGGGGAGAGGCGG - Intronic
1046768787 8:118098316-118098338 GGAGAAGGGAGGGGCCCAGGAGG - Intronic
1047499228 8:125429642-125429664 GAGGAAGGAGGGGGATAGGGAGG - Intergenic
1047537625 8:125734051-125734073 GAGGTAGGAGGGAAACCAGGAGG + Intergenic
1047706437 8:127504414-127504436 TAGGCAGGAGGGGGCCCAGCAGG + Intergenic
1047724214 8:127670297-127670319 CAGGAAGCAGGGAGGCCAGGAGG - Intergenic
1047768914 8:128014613-128014635 GGGGAAGGTGGGGACCCAGTGGG + Intergenic
1048148300 8:131867476-131867498 GAGGAAGGTGGTGAGCCAGGAGG - Intergenic
1048337716 8:133515216-133515238 GAGCAGGGTGTGGGCCCAGGAGG - Intronic
1048494416 8:134923218-134923240 TAAAAAGGAGGGGGACCAGGAGG - Intergenic
1048867303 8:138770377-138770399 GAGGCATGAGGAGGTCCAGGTGG - Intronic
1049055938 8:140237658-140237680 GAGGGAGGAGGGGGACAGGGAGG + Intronic
1049133134 8:140867253-140867275 GAAGAAGGAGGGAGACTAGGAGG + Intronic
1049203582 8:141353167-141353189 GGGGATGGAGGGGGCACAAGTGG - Intergenic
1049218295 8:141417671-141417693 GAGGAAGGAGGGGTCCCGGGCGG + Intronic
1049237026 8:141517568-141517590 GAGGGAGGTGCGGCCCCAGGAGG - Intronic
1049278183 8:141730382-141730404 GAGGAAGGAGGAGGAGGAGGGGG - Intergenic
1049318284 8:141981297-141981319 GAGGAAGGAGGGATTCCTGGAGG + Intergenic
1049408162 8:142460810-142460832 GGGGAAGGAGAGTGCTCAGGAGG - Intronic
1049493329 8:142916553-142916575 GAGGCAGGTGGGGACGCAGGTGG - Intronic
1049494283 8:142922483-142922505 AGGGAAGGCGGGGGCCCTGGCGG - Intergenic
1049582922 8:143420945-143420967 GAGGATCGTGGGGGCACAGGCGG - Intronic
1049610867 8:143554127-143554149 GAGGAGGGAGGAGGCCCAGATGG + Intronic
1049617186 8:143580796-143580818 AAGGAGGGAGGAGGGCCAGGAGG - Intronic
1049681033 8:143918363-143918385 GGGGAAGGTGGAAGCCCAGGCGG + Exonic
1049796978 8:144501359-144501381 CAGGCAGGAGGGGGTCCAAGCGG - Intronic
1049824916 8:144662235-144662257 GAGGAAGGAGGGGTTCAAGGTGG - Intergenic
1049824998 8:144662520-144662542 GAGGAAGGAGGGGTTCAAGGTGG - Intergenic
1049825062 8:144662735-144662757 GAGGAGGGAGCTGGCCAAGGTGG - Intergenic
1049825177 8:144663105-144663127 GAGGGGGGAGTGGGCCAAGGGGG - Intergenic
1049936334 9:504672-504694 GGGGAAGGGCGGGGCGCAGGGGG - Intronic
1050000248 9:1069946-1069968 GAGGAAGGAGGAGGAAGAGGAGG + Intergenic
1050424142 9:5496661-5496683 GAGGAATGAGGGGAACTAGGGGG - Intergenic
1050475902 9:6040894-6040916 GAGGAAGGAGGAGGAAGAGGAGG - Intergenic
1050550528 9:6744995-6745017 AGGGAAGGAGAGGGACCAGGAGG - Intronic
1051170375 9:14314690-14314712 GAGGAAGGTGGGGGGGCGGGGGG - Intronic
1051188544 9:14486361-14486383 GAGGCAGGAGAAAGCCCAGGAGG + Intergenic
1053070908 9:35101410-35101432 GATGCAGGTGGGGGCCAAGGAGG - Exonic
1053261662 9:36671433-36671455 GAGGAAGCAGGGGGCACAGATGG + Intronic
1053313760 9:37035554-37035576 GAGGAAAGGGGGGCCCCCGGCGG + Intergenic
1053478438 9:38398711-38398733 GGGGATGGAAGGGACCCAGGTGG + Intergenic
1053669833 9:40348688-40348710 GAGGAAGGAGCGGGCCGTGGTGG + Intergenic
1053919632 9:42974943-42974965 GAGGAAGGAGCGGGCGGTGGTGG + Intergenic
1054380965 9:64488689-64488711 GAGGAAGGAGCGGGCAGTGGTGG + Intergenic
1054514779 9:66027608-66027630 GAGGAAGGAGCGGGCCGTGGTGG - Intergenic
1054739259 9:68788195-68788217 AAGGAATGTGTGGGCCCAGGAGG + Intronic
1054803653 9:69377680-69377702 TAGGAAGGGGGAGGCACAGGCGG - Exonic
1055376154 9:75649624-75649646 GAGGCAGGGAGGGGCTCAGGTGG + Intergenic
1055393549 9:75849080-75849102 GAGGAATGAAGGAGCCCAGCAGG + Intergenic
1056240096 9:84636725-84636747 GAGGAGGGAGGGGGAGAAGGAGG - Intergenic
1056342204 9:85647497-85647519 GAGGAATGAGGTGGCTCATGAGG + Intronic
1056513362 9:87327123-87327145 GAAGAAGGAGGGGGAGGAGGAGG + Intergenic
1056638178 9:88348409-88348431 GAGGATGGCTTGGGCCCAGGAGG - Intergenic
1056679148 9:88701920-88701942 GAGGCAGGAGGGTGGCCTGGGGG + Intergenic
1056682198 9:88729521-88729543 GAAGAAGGAAGTGGCCCATGGGG + Intergenic
1056795274 9:89654920-89654942 GTGGCAGGAGGGGGCCAAGGAGG - Intergenic
1057413463 9:94839856-94839878 GAGGATCAATGGGGCCCAGGAGG - Intronic
1057497429 9:95572001-95572023 GAGGGAGGAGAGGGCGGAGGAGG + Intergenic
1057604538 9:96489567-96489589 TGGGAAGGAGGGGCCACAGGAGG - Intronic
1057613409 9:96567080-96567102 AAGGAAGGCGGGCGGCCAGGCGG - Intronic
1057796201 9:98159845-98159867 GGGGAAGGTGGGGGCCCAAGGGG - Intronic
1057913922 9:99041121-99041143 GAGTAAGGAGGGGGCCAAATAGG + Intronic
1058166512 9:101625281-101625303 GAGGAAGGACTGAGCCCAGAAGG - Intronic
1058461923 9:105190865-105190887 GGGGCAGGAGGTGGCCAAGGTGG - Intergenic
1058830566 9:108812518-108812540 GGGGGCGGAGGGAGCCCAGGGGG + Intergenic
1059072414 9:111152789-111152811 GAGGAAGAAGGAGGCAGAGGAGG + Intergenic
1059072421 9:111152811-111152833 GAGGAAGGAGGCGGAGGAGGAGG + Intergenic
1059310396 9:113384911-113384933 GAGGCAGGAGCGAGCCCAGGAGG - Intergenic
1059391258 9:114001032-114001054 GAGCAAGGCCTGGGCCCAGGTGG + Intronic
1060206398 9:121685132-121685154 GAGGGTGGAGGGGGCGGAGGGGG - Intronic
1060269708 9:122131933-122131955 TAGGAAGGGTGGGGGCCAGGGGG - Intergenic
1060408203 9:123383009-123383031 GAGGAAGGAGGAGGCCAAGTTGG + Intronic
1060423598 9:123486774-123486796 GAGGGTGGAGGGTGCCCAGAAGG - Intronic
1060476181 9:123988489-123988511 GAGGTAGGGTGGGGCCCAGAGGG + Intergenic
1060482163 9:124022934-124022956 GAGGGAGGGGCGGGCCCAGAGGG - Intronic
1060656152 9:125374146-125374168 GAGGCAGGAGGGGGCACCTGGGG - Intergenic
1060682490 9:125577653-125577675 GAGGGAGGTGGGGGTCCGGGAGG + Intronic
1060764067 9:126280753-126280775 GAGGAAGTAGTGGGCTCAGATGG + Intergenic
1060846011 9:126838424-126838446 TAGCAGGAAGGGGGCCCAGGGGG - Intergenic
1060934236 9:127506382-127506404 GCGGAAGGAGCAGGGCCAGGAGG + Exonic
1060945856 9:127569067-127569089 GGGCAGGGAGGGGGCCAAGGCGG - Exonic
1061009262 9:127945605-127945627 GAGGAAGGAGGAGGCCACGGGGG + Intronic
1061200658 9:129136664-129136686 AGGGAAGGAGGGAGCGCAGGAGG - Intronic
1061232747 9:129324352-129324374 CAGGAGGGCGGGGTCCCAGGAGG + Intergenic
1061257297 9:129460299-129460321 GAGGAGGGAGGAGGAGCAGGGGG - Intergenic
1061275633 9:129568345-129568367 CAGTAAGCAGGTGGCCCAGGAGG - Intergenic
1061408151 9:130403880-130403902 GAGTGAGGACGGGGCCGAGGTGG + Intronic
1061415325 9:130444435-130444457 GGGGAGGGAGGGGGCTCTGGGGG + Intergenic
1061470041 9:130816994-130817016 AAGGAATGAGGGAGACCAGGCGG - Intronic
1061478775 9:130886071-130886093 GTGGAAGAAGGAGGCCCAGCCGG - Intronic
1061610126 9:131740272-131740294 GAGGAATGCGGAGTCCCAGGCGG - Intergenic
1061669813 9:132182447-132182469 CTGGAAGGAGGAGGCCCAAGTGG + Intronic
1061727628 9:132590120-132590142 GGGGCAGGAAGGGGCCAAGGGGG + Exonic
1061764884 9:132875367-132875389 GAGGCATGAGGGGGGCCACGTGG + Intronic
1061851284 9:133417595-133417617 GAGGCTTGAGGGGGCCCGGGCGG - Intronic
1061852506 9:133424314-133424336 GGGGAAGGAGGGCGGCCTGGAGG - Exonic
1061920231 9:133778621-133778643 CAGGGAGGAGGAGGCACAGGGGG - Intronic
1061920466 9:133779766-133779788 CAAGAGGGAGGGGGCCCAGATGG + Intronic
1061938720 9:133872655-133872677 AAGGGAGAAGTGGGCCCAGGTGG + Intronic
1062070153 9:134551061-134551083 CAGGAGGGAAGGGGGCCAGGTGG + Intergenic
1062070679 9:134553560-134553582 CAGGAAGCGGGGAGCCCAGGAGG - Intergenic
1062097969 9:134712456-134712478 TAGGAAGGAGGGGGACAAGAAGG - Intronic
1062116453 9:134811718-134811740 TTGGAATGAGGAGGCCCAGGAGG - Intronic
1062145190 9:134985188-134985210 GAGGAAGGCGGGGGCTCAGCAGG - Intergenic
1062181063 9:135191594-135191616 GAGGAAGGAAGGGACCCCAGCGG + Intergenic
1062196399 9:135276533-135276555 GTGGAAGCAGGGGGCCAATGGGG - Intergenic
1062238532 9:135524026-135524048 GAGGGAGGAGGGAGGGCAGGTGG - Intronic
1062261118 9:135663791-135663813 GAGGACAGAGGGGGACCTGGAGG + Intronic
1062307811 9:135919635-135919657 GAGTGAGGAGGGGGCCAATGGGG - Intergenic
1062419704 9:136474257-136474279 GAGGACTGAGGAGGCCGAGGGGG + Exonic
1062432289 9:136531600-136531622 GAGGAAGGAAGGGGAGCGGGAGG - Intronic
1062477633 9:136736576-136736598 GAGGATGGCTGGAGCCCAGGGGG - Intergenic
1062556318 9:137114757-137114779 GAGGGAGGAGCGCGCCCTGGCGG - Intronic
1062568206 9:137172585-137172607 GGGGCAGGAAGGGGCCAAGGAGG + Intergenic
1062591706 9:137277437-137277459 GGGGGAGGTGGGGGCCCTGGAGG + Intergenic
1062729290 9:138100188-138100210 GAGGGAAGAGGGAGGCCAGGTGG + Intronic
1062745927 9:138212002-138212024 GAGGGTGCAGGGGTCCCAGGTGG + Intergenic
1185449562 X:275228-275250 GAGGAAGGAGGAGGGGGAGGAGG + Intergenic
1185463151 X:341519-341541 GAGGCAGGAGGAGGGGCAGGAGG - Intronic
1186010483 X:5126037-5126059 GAGGAAAGCTTGGGCCCAGGAGG - Intergenic
1186063399 X:5736234-5736256 GAGGATGGTTGGGGCCTAGGAGG - Intergenic
1186124706 X:6400903-6400925 GAGGAAGGGGAGGGGGCAGGGGG - Intergenic
1186291867 X:8109088-8109110 GAGGAAGGAGGGAGGCAGGGAGG - Intergenic
1186326539 X:8483331-8483353 GAGGATGGCGTGAGCCCAGGAGG - Intergenic
1186486965 X:9940964-9940986 GAGGCAGCAGGGGGCTCTGGTGG + Intronic
1187071592 X:15893618-15893640 GAGGATGGATTGAGCCCAGGAGG + Intergenic
1187155889 X:16719984-16720006 GGGGGATGAGGGGGCCGAGGTGG + Intronic
1187432793 X:19240091-19240113 GAGGAAGGTAGGGGCACAGATGG - Intergenic
1187460866 X:19485645-19485667 GAGGGAGAAAAGGGCCCAGGAGG - Intronic
1187472612 X:19582434-19582456 GAGGAAGGAGGGGCCGGAGTTGG - Intronic
1187712742 X:22070594-22070616 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1187977540 X:24718452-24718474 GAGGAAGGAGGAGGCCTGTGTGG + Intronic
1188384164 X:29535042-29535064 GAGGATGGCTTGGGCCCAGGAGG + Intronic
1189230791 X:39451021-39451043 GAGGAAGGAGGAGGAGAAGGAGG - Intergenic
1189497132 X:41518968-41518990 GAGGAAGGAGAGACCACAGGTGG + Intronic
1189534428 X:41922824-41922846 GGGGAAGGAGGGAGGGCAGGGGG + Intronic
1189724541 X:43954990-43955012 GAGGAAGGAGGGGCTGGAGGGGG - Intronic
1190136593 X:47804487-47804509 GGGGGAGGAGGGGGCCCCGGAGG - Intergenic
1190247107 X:48697566-48697588 GAGGAAAGCGTGGGCACAGGCGG + Intronic
1191937365 X:66439856-66439878 GAGGGAGGAGGGGGGCGTGGAGG + Intergenic
1192219013 X:69184428-69184450 GGAGAAGGAGGGGGCAGAGGGGG - Intergenic
1192224905 X:69221561-69221583 GAGGAGGTAGGGGGCCCTGCCGG - Intergenic
1192452555 X:71253095-71253117 GAGGATGGAGAAGGGCCAGGGGG + Exonic
1192939023 X:75893358-75893380 AAGGAAGGAGGGAGCCAAGAAGG - Intergenic
1193640211 X:84003211-84003233 GAGGAGGGAGGGGTCCCAAGGGG - Intergenic
1194665751 X:96675760-96675782 GATGCAGGCCGGGGCCCAGGTGG + Intergenic
1195033337 X:100947990-100948012 GAGGATGGATTGAGCCCAGGAGG - Intergenic
1195672460 X:107481422-107481444 GAGGAAGGATGAGTCCCTGGTGG - Intergenic
1196196381 X:112841487-112841509 GAGGGAGGAGGGGTCGCGGGCGG + Intergenic
1196647048 X:118128985-118129007 GTTCAAGGAGGGGGCCGAGGAGG + Intergenic
1197718086 X:129724595-129724617 GAGGAAGGAGGGAGTCCTTGGGG + Intergenic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1199022685 X:142900232-142900254 GAGGGAGGGAGGGGCACAGGAGG + Intergenic
1199471282 X:148198745-148198767 GAGGAAGAAGGGGGCTCATGGGG - Intergenic
1199855528 X:151756143-151756165 AAGGAAGGAGGAGGGGCAGGAGG - Intergenic
1200068702 X:153517565-153517587 GAGGAGGGAGCGGGCGCGGGGGG - Intergenic
1200123954 X:153804528-153804550 GGGGAAAGAGGAGGCCCAGCTGG + Exonic
1200135751 X:153873816-153873838 GAGGAAGGAGGGAGAAGAGGAGG - Intronic
1200137789 X:153883375-153883397 GAGGAAGGTGATGGCCCTGGGGG + Intronic
1200145957 X:153926661-153926683 GGGGAAGGAGGCAACCCAGGGGG - Intronic
1200183487 X:154166411-154166433 GAGGAGGGAGGCAGCCCAGAGGG + Intergenic
1200189141 X:154203539-154203561 GAGGAGGGAGGCAGCCCAGAGGG + Intergenic
1200194896 X:154241348-154241370 GAGGAGGGAGGCAGCCCAGAGGG + Intergenic
1200200546 X:154278469-154278491 GAGGAGGGAGGCAGCCCAGAGGG + Intronic
1200690658 Y:6304835-6304857 GACGAAGGTGGTGGCCCAGGAGG - Intergenic
1200829142 Y:7673435-7673457 GAGGGCGGAGGGGGGGCAGGGGG - Intergenic
1200831064 Y:7689308-7689330 GGTGAAGGTGGTGGCCCAGGAGG - Intergenic
1201044614 Y:9869881-9869903 GACGAAGGTGGTGGCCCAGGAGG + Intergenic
1201063478 Y:10068857-10068879 GTGGCAGGAGGAGGCCCAGCGGG - Intergenic
1201077938 Y:10200628-10200650 GAGGCAGGAGGGAGCCCCCGAGG - Intergenic
1201909724 Y:19121701-19121723 GAAGAAGGAGGAGGAGCAGGAGG - Intergenic
1202274376 Y:23100260-23100282 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
1202291651 Y:23320411-23320433 GAGGAGGGAGGGGGAGGAGGAGG + Intergenic
1202427369 Y:24734011-24734033 GAGGAGGGAGGGGGAGGAGGAGG - Intergenic
1202443422 Y:24936083-24936105 GAGGAGGGAGGGGGAGGAGGAGG + Intergenic