ID: 1137613977

View in Genome Browser
Species Human (GRCh38)
Location 16:49836190-49836212
Sequence TGCCAGGCCTTGAACCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137613971_1137613977 18 Left 1137613971 16:49836149-49836171 CCAACTTCGCACCTAGCAGAACA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 151
1137613970_1137613977 21 Left 1137613970 16:49836146-49836168 CCTCCAACTTCGCACCTAGCAGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 151
1137613974_1137613977 7 Left 1137613974 16:49836160-49836182 CCTAGCAGAACAGAGGTGCTGGC 0: 1
1: 0
2: 1
3: 21
4: 189
Right 1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137613977 Original CRISPR TGCCAGGCCTTGAACCTTGC TGG Intronic
900347488 1:2216589-2216611 GGCCAGGCATTGAACCATCCCGG - Intergenic
901306398 1:8236102-8236124 TGCCAGGCCATGAGACATGCAGG + Intergenic
901427257 1:9190201-9190223 TGCCTGGCCAAAAACCTTGCAGG + Intergenic
901889532 1:12250739-12250761 AGCCAGGTCTTGAACCTGGGTGG + Intronic
903352854 1:22728628-22728650 GGCCAGCCCTGGAACCTTCCAGG - Intronic
903672363 1:25044117-25044139 TCCCAGGCCTTGAAACCTGATGG - Intergenic
905827500 1:41037200-41037222 TGCCTGGCCTTGCACCTGGGAGG - Intronic
910211324 1:84796409-84796431 TGGAAGGCCATGAACTTTGCCGG - Intergenic
911097101 1:94063739-94063761 TTCCTAGCCTTGAACCTTTCTGG + Intronic
914492695 1:148162098-148162120 CGCCAGGGTTTGCACCTTGCAGG + Intergenic
915213751 1:154327309-154327331 GGCCAGGCCTTGAACCTTTTAGG + Intronic
915555606 1:156659137-156659159 GGCAAGGCCTTGAACACTGCCGG + Exonic
917739893 1:177952053-177952075 TGCAAGGCCCTGAGCCTTGTGGG - Intronic
918897489 1:190366938-190366960 TGCCAGCCCATGAAACTAGCTGG - Intronic
919924093 1:202183362-202183384 TGCCTGCCCTTGATCCCTGCAGG + Intergenic
921180781 1:212629770-212629792 TGGGAGGCCCTGAACCTAGCTGG + Intergenic
921845846 1:219880919-219880941 AGCCAGGACTTGAACCTAGGTGG - Intronic
922604932 1:226884052-226884074 AGCCAGGCCATGAACCTGGGCGG - Intronic
1062924994 10:1309645-1309667 TGCCAGGCCCTGAACCAGGGAGG - Intronic
1065310875 10:24415056-24415078 TGCCGGGCCTCCAACCATGCAGG - Intronic
1066157107 10:32690058-32690080 TGCCAAGCTTTGATCCTTTCTGG - Intronic
1067317275 10:45180542-45180564 GGCCACGCCTGGAAGCTTGCAGG + Intergenic
1068885396 10:62092216-62092238 AGCCAGGCCCAGGACCTTGCCGG - Exonic
1069076409 10:64042208-64042230 TGCCAGGCCTTGGTCCTGGTGGG - Intergenic
1070298748 10:75187473-75187495 TGCCTGGCCCTGGACCTTGAAGG + Intergenic
1070995820 10:80780028-80780050 TGCCAGGCATGGGACTTTGCTGG - Intergenic
1071275895 10:84054725-84054747 TCCCAGGCCTAGAGCCTGGCAGG + Intergenic
1074221322 10:111441082-111441104 TGCCTGTCCTTGAAATTTGCGGG + Intergenic
1075087108 10:119421163-119421185 TGCCAGGCCTTGGGCCCTCCTGG + Intronic
1075652177 10:124134726-124134748 TGCCAGGCCTGGTGCCATGCTGG + Intergenic
1076365119 10:129916681-129916703 GGCCAGGCCCTGAGCTTTGCTGG - Intronic
1076668720 10:132107387-132107409 CGCCGGCCCTGGAACCTTGCCGG - Intronic
1076708013 10:132312612-132312634 TGCCAGGCCTTGAAACCTCATGG - Intronic
1076710802 10:132332689-132332711 TGCCTGGGGTTGAACCCTGCTGG + Intronic
1077453163 11:2662973-2662995 GGCCAGGCCTTGCACCTGGCTGG - Intronic
1077487797 11:2847049-2847071 TGCCATGTCTTTAACCTAGCGGG - Intronic
1078078063 11:8179631-8179653 TGCCATGTCTTGAACCTGACTGG - Intergenic
1079069212 11:17328674-17328696 TGCCAGGCCTTTACCCTTCAGGG + Intronic
1080242107 11:30138264-30138286 TCCCAGGTCTTGAAACTTACAGG + Intergenic
1080771655 11:35347689-35347711 TGCCAGGCCCTGAGCCAGGCAGG + Intronic
1082782892 11:57300925-57300947 TCCCAGTCCTGGGACCTTGCAGG + Exonic
1083164074 11:60872913-60872935 TGCCAGGCCCTGCACCTGGTGGG - Intronic
1083895353 11:65617054-65617076 TGCCTGGGCCGGAACCTTGCAGG + Intronic
1084195848 11:67523340-67523362 TGCCAGGCCTGGAACCCCGGGGG + Exonic
1085159630 11:74328407-74328429 GGCCAGGCCGTGAACCTGTCTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089217339 11:116842520-116842542 AGCCATGCCTGGAAACTTGCTGG + Intergenic
1091217232 11:133909703-133909725 GGTCAGGCCTTGACCCTTCCTGG + Intronic
1091261905 11:134241377-134241399 TGGCAGGCCTGGAACCTAGAGGG + Intronic
1095963182 12:47848475-47848497 TGTGATGCCTTGAACATTGCTGG + Intronic
1101289056 12:103348153-103348175 TCCCTGCCCTTGAACCATGCTGG + Intronic
1101652394 12:106689439-106689461 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1103573327 12:121858956-121858978 CCCCAGGCCTGGAACCTTCCAGG - Intronic
1104077761 12:125405558-125405580 AGCCAGGACCTGAACCTGGCAGG + Intronic
1110355625 13:74563486-74563508 TGCCAGGCTTTGCTCCTGGCAGG + Intergenic
1113450596 13:110406876-110406898 TGTGAGGAATTGAACCTTGCTGG + Intronic
1118319283 14:64743677-64743699 TTCCAGGCCTTGAACTCTGTCGG + Exonic
1119084600 14:71728194-71728216 TGATAGTCCTAGAACCTTGCAGG + Intronic
1122073598 14:99221556-99221578 CGCCTGGCCTTGTACCTGGCAGG - Intronic
1125771726 15:42172129-42172151 TTCCTTGCCTTGAACCTGGCAGG + Intronic
1128244675 15:66125098-66125120 TGCCAGACCTTTGACCTTTCAGG - Intronic
1128524487 15:68403110-68403132 TGGCAGGTCATGAACCTTGGAGG + Intronic
1128762028 15:70223599-70223621 TGCTAGGCCTTCACCTTTGCTGG + Intergenic
1131222550 15:90597143-90597165 TGCCAGGGCTTGCTCCTGGCTGG + Intronic
1131960600 15:97786706-97786728 TGCCAGGCCTTAAATCATCCTGG - Intergenic
1132123686 15:99200281-99200303 AGCCAGGACTTGAACCTTCCTGG - Intronic
1132154638 15:99486807-99486829 AGGGATGCCTTGAACCTTGCAGG + Intergenic
1132645739 16:998527-998549 TTCCAGGCCATGACCCTGGCAGG + Intergenic
1132934399 16:2473581-2473603 TGGAACGCCTTGACCCTTGCTGG + Intronic
1136008788 16:27348884-27348906 TGCCACGTCTTAAACCTGGCTGG - Intronic
1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG + Intronic
1138273076 16:55710024-55710046 TTCCAGGCTGTGACCCTTGCTGG - Intergenic
1138536675 16:57663913-57663935 GGCCAGGCCTTGGATCTTGAGGG + Exonic
1138594104 16:58020350-58020372 AGCCATGCCTTCAACCTGGCAGG + Exonic
1139506718 16:67401722-67401744 GGCCAGGCCCTGAACATGGCAGG - Intronic
1139884242 16:70197388-70197410 TGCCAGGCTTGGAACCTCGATGG - Intergenic
1139951892 16:70676472-70676494 TGCCAGGCCTAGCACCGTGTGGG - Intronic
1140368273 16:74398108-74398130 TGCCAGGCTTGGAACCTCGATGG + Intergenic
1140493515 16:75362180-75362202 TGCCTGGCCTTGAAGCCTGTAGG - Intronic
1141597041 16:85103766-85103788 TGCCAGGCCCTGGACCCTGGTGG + Intronic
1146125571 17:30228704-30228726 TGCCAGGCCTTGGAGGGTGCAGG - Intronic
1146180670 17:30696308-30696330 TGCCTGGCCTTGAACAATACAGG + Intergenic
1148490693 17:48022248-48022270 TTCCAGGCCAGGTACCTTGCTGG - Intergenic
1148562546 17:48614221-48614243 TGCCAGGCCTTGGGCCCTTCCGG + Intronic
1148741591 17:49896407-49896429 AGCCAGGTCTACAACCTTGCTGG + Intergenic
1149421920 17:56519945-56519967 TGCAATGCCTTGACCCTTTCTGG - Intergenic
1152497470 17:80683845-80683867 TGCCAGGACTTGAGCCATGCGGG - Intronic
1158203075 18:54961334-54961356 TTCCTGGCCTTGACCCTTCCTGG + Intergenic
1160134518 18:76261233-76261255 TGCCAGGCCCTGAGCCTCCCGGG + Intergenic
1160764372 19:800901-800923 AGCCAGGACTTGAAGCCTGCGGG + Intronic
1161504415 19:4636244-4636266 GGCCAGGCCTCGCACCCTGCCGG - Intergenic
1163395672 19:17059261-17059283 TGCCAGGCCCTGTCCCTTGGTGG - Intronic
1166651927 19:44581381-44581403 GGCCAGACCATGGACCTTGCAGG - Intergenic
1167854902 19:52229501-52229523 TGCCAGGCCTTGACTCCAGCAGG + Exonic
1168357360 19:55710347-55710369 GGCCAGGCCTTGTACCCTGCAGG - Intronic
926158550 2:10472088-10472110 GGCCAGCCCTGGAACCTTGGAGG + Intergenic
929077612 2:38091480-38091502 GGCAAGGACTTGAACCTCGCAGG + Intronic
930668421 2:54122746-54122768 TGCAAGGCACTGAACCATGCAGG - Intronic
935818281 2:106868312-106868334 TTCCAGGCCCTGCACCTTGCCGG - Intronic
936010474 2:108922099-108922121 TGCCAGACATTGAACATTGAAGG + Intronic
938079479 2:128362023-128362045 TGGCAGGCTTGGAACCTTGTCGG + Intergenic
940464146 2:154007318-154007340 GGCCAGGCCTTGCTCCTTTCTGG - Intronic
948239637 2:236419378-236419400 TGCCTGGCCCTGGACCCTGCAGG + Intronic
948289151 2:236811754-236811776 TGCCAAGCCATGCACCTGGCTGG - Intergenic
1168985368 20:2043762-2043784 TGCTGTGCCTTGAAACTTGCTGG - Intergenic
1173640904 20:44601243-44601265 TGCCAGGCCTAGACCCAAGCAGG - Intronic
1175216127 20:57392427-57392449 TCCCAGGCCTTGAACTTTGACGG + Intronic
1176144415 20:63559210-63559232 TCCCAGTCCTGGCACCTTGCAGG + Exonic
1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG + Intronic
1178261823 21:31106870-31106892 TGCCAGGCCTTGAAAGCAGCTGG - Intergenic
1179813341 21:43886121-43886143 TGCCTGGCATGGAAACTTGCAGG + Intronic
1183706436 22:39477473-39477495 TGCCAGGCCTTGCTCCTGACCGG - Intronic
1184164275 22:42718696-42718718 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1184688755 22:46108109-46108131 TGCGAGTCCTAGAGCCTTGCGGG + Intronic
1185395732 22:50586775-50586797 TGACAGCCCTTCATCCTTGCTGG + Intronic
949685307 3:6563115-6563137 TGCCTGGCCCTGAACCTTCAGGG + Intergenic
954274282 3:49532324-49532346 AACTTGGCCTTGAACCTTGCAGG - Exonic
954391469 3:50270120-50270142 TGCCAGGCCTGGAGCTCTGCAGG - Exonic
954433006 3:50481252-50481274 TACCAGGCCTTGACCCTTCCGGG - Intronic
954921512 3:54195069-54195091 AGCCAGCCCTTGAACCTCGGAGG + Intronic
955323705 3:57993532-57993554 TGCCTGGCCTGGAAACTTTCTGG - Intergenic
960191649 3:114713662-114713684 TGCCAGGCTTTGAACATTGAAGG + Intronic
961868225 3:129969602-129969624 GCCCAGGCCTAGAACCATGCCGG + Intergenic
962976854 3:140453154-140453176 TGCGAGGCCAGGAACCTTGGTGG + Intronic
968596772 4:1489890-1489912 TGGCAGGCCATGAGCCTGGCTGG + Intergenic
968912374 4:3482867-3482889 TGCCAGGCTGAGCACCTTGCCGG - Intronic
972692260 4:41410856-41410878 TGCCAGGCCCTGCTCCCTGCTGG + Intronic
973079372 4:45970820-45970842 TCCCAGTCTTTGAACCTTTCTGG - Intergenic
975952312 4:79788835-79788857 GGCCAGGCCCAGAGCCTTGCTGG + Intergenic
977486825 4:97659526-97659548 TGTCAGCTCATGAACCTTGCTGG + Intronic
981278512 4:142930148-142930170 TGCCAGGCATTAAACTTTTCTGG + Intergenic
981655618 4:147109425-147109447 TGCCAGGCCTTGCAGCTAGGTGG - Intergenic
982359114 4:154499853-154499875 TGCCAATCCTTGAACTTTGCAGG + Intergenic
985038198 4:185862290-185862312 TGCAGGGCCTTGAGCCTTGTAGG + Intronic
985622284 5:961921-961943 TGGCAGGCTTTGGTCCTTGCGGG + Intergenic
990485592 5:56256944-56256966 TTCCAGGCTTTGAACCGTCCAGG - Intergenic
991562564 5:67969945-67969967 AGCCAGGTCTTGCACCTTTCTGG + Intergenic
995846484 5:116499388-116499410 TGCCATGGCTTGAACCTGGGCGG + Intronic
999188091 5:149727736-149727758 TGCCTGGCCCTGAATCTTGCAGG - Intergenic
1000055672 5:157604027-157604049 TCCCAATCCTTAAACCTTGCAGG - Intergenic
1002505933 5:179679135-179679157 TGCCAGGGCGTGGACCTTGTAGG + Exonic
1005767122 6:29022766-29022788 TGCTAGTCATTGTACCTTGCTGG - Intergenic
1006023657 6:31133200-31133222 TCCCAGGCCATGAACCTTGTGGG - Intronic
1006709562 6:36055454-36055476 TGCCAGGCTTTGGACCATGATGG + Intronic
1006779651 6:36623648-36623670 TTCCAGGCCTTGGACCTGTCAGG + Intergenic
1006992363 6:38226261-38226283 TGCCATGCTTTGAACTGTGCAGG - Intronic
1007764392 6:44152348-44152370 TGCCAGGCCCCGACCCTTGAAGG + Intronic
1007834400 6:44663668-44663690 AGCCAGGCCATGCCCCTTGCAGG - Intergenic
1009882420 6:69584881-69584903 TGCCAAGGCTGAAACCTTGCAGG - Intergenic
1010880734 6:81167038-81167060 TACCAGGCTTTTAATCTTGCAGG + Intergenic
1012425588 6:99110785-99110807 TGCCAGGCCATGCATGTTGCTGG - Intergenic
1013693448 6:112672587-112672609 TGCCAGGCATTCATCGTTGCAGG + Intergenic
1015796178 6:137013753-137013775 AGCCAGGCTATGAACCTAGCTGG - Intronic
1025606934 7:63046282-63046304 TGCCTGGCCTTGACCCTAGGTGG - Intergenic
1026669868 7:72380594-72380616 TGCTAGGACATGAAGCTTGCAGG - Intronic
1031146585 7:118003699-118003721 TGTCTGGCTTTGAGCCTTGCAGG + Intergenic
1033485946 7:141789391-141789413 TACCAGGCCTTGCAGCTTGGTGG + Intergenic
1034567706 7:151928906-151928928 TGGCAGTCCTTGAAGCTTCCTGG - Intergenic
1040578794 8:48677871-48677893 TGCCAGGCCTACAACCCTGTGGG - Intergenic
1047067764 8:121305560-121305582 TGACATGCTTTGAACCTTACAGG + Intergenic
1048321563 8:133404248-133404270 TCCCAGGCCCTGAGCCTTGCTGG - Intergenic
1048340709 8:133536598-133536620 AGCCAGGCCTCCCACCTTGCCGG - Intronic
1048968796 8:139632570-139632592 GGCCAGGCCTGGAACCCTGCTGG - Intronic
1051305162 9:15700524-15700546 TGCCTGGGCTCGAACCTTGGCGG - Intronic
1054869354 9:70035139-70035161 TGCCAGGCCTTGGATGTTGGAGG - Intergenic
1057074749 9:92132598-92132620 TGCCTGCCCTTGATCCCTGCAGG + Intergenic
1061289856 9:129644503-129644525 TGCCACACCCTCAACCTTGCCGG - Intergenic
1062108352 9:134767942-134767964 TGCCAGGCCTGGGACCTTCCAGG + Intronic
1187522211 X:20023726-20023748 TGACAGGCCTTGATAATTGCAGG - Intronic
1198686689 X:139235167-139235189 TCCCTGGCCTTGAACTTTTCTGG - Intergenic