ID: 1137614179

View in Genome Browser
Species Human (GRCh38)
Location 16:49837177-49837199
Sequence GGCCCTGGCGAGCTGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 361}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137614168_1137614179 1 Left 1137614168 16:49837153-49837175 CCCACCCCAGTAATGTACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614175_1137614179 -4 Left 1137614175 16:49837158-49837180 CCCAGTAATGTACAGAGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614165_1137614179 10 Left 1137614165 16:49837144-49837166 CCTCCACCTCCCACCCCAGTAAT 0: 1
1: 1
2: 9
3: 61
4: 742
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614174_1137614179 -3 Left 1137614174 16:49837157-49837179 CCCCAGTAATGTACAGAGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614170_1137614179 0 Left 1137614170 16:49837154-49837176 CCACCCCAGTAATGTACAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614166_1137614179 7 Left 1137614166 16:49837147-49837169 CCACCTCCCACCCCAGTAATGTA 0: 1
1: 0
2: 1
3: 36
4: 311
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614167_1137614179 4 Left 1137614167 16:49837150-49837172 CCTCCCACCCCAGTAATGTACAG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614164_1137614179 11 Left 1137614164 16:49837143-49837165 CCCTCCACCTCCCACCCCAGTAA 0: 1
1: 0
2: 11
3: 73
4: 638
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361
1137614176_1137614179 -5 Left 1137614176 16:49837159-49837181 CCAGTAATGTACAGAGGGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137614179 Original CRISPR GGCCCTGGCGAGCTGAGGCC TGG Intronic
900169948 1:1262253-1262275 GGCCGTGGTGAGATAAGGCCCGG - Intronic
900178791 1:1302409-1302431 GGGCCTGGGGAGCTGGAGCCTGG + Intronic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
900246947 1:1640748-1640770 GTCCCTGCAGAGCAGAGGCCTGG - Intronic
900308709 1:2023351-2023373 GGCACAGTCAAGCTGAGGCCGGG - Intronic
900312873 1:2042932-2042954 GCCCCTGGAGCCCTGAGGCCTGG - Intergenic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
900624572 1:3602378-3602400 GGAGCTGGGCAGCTGAGGCCAGG - Intronic
900787035 1:4655631-4655653 GGCCCTGGCGGGGAGCGGCCGGG + Intronic
900951661 1:5861576-5861598 GGGCCATGGGAGCTGAGGCCCGG - Intergenic
901671011 1:10856487-10856509 CGCCCTGGCCAACGGAGGCCTGG - Intergenic
902323599 1:15684385-15684407 GGCCCAGGCGAGGCGAGGGCCGG + Exonic
902721776 1:18308897-18308919 GGGCCTGGCAAGCCCAGGCCAGG + Intronic
903181915 1:21609088-21609110 GTACCTGGGGAGCTGAGCCCAGG - Intronic
903652398 1:24930017-24930039 GGCCCTGGCGAGTAGTGGCCGGG - Intronic
903670738 1:25034057-25034079 TGCCCTTGCGTGCTGCGGCCTGG - Intergenic
904301922 1:29559719-29559741 GGCCCTGGGGAGCTCTGCCCAGG + Intergenic
904610949 1:31726040-31726062 GTCCCTGGAGAGCTGAGGGAGGG - Intergenic
905345983 1:37311506-37311528 GGCCAAGGCGAGCTGAGGGTGGG + Intergenic
906319832 1:44808972-44808994 GGCCCTGGTGAGAAGAGGCTGGG + Intronic
906475550 1:46167131-46167153 GGCCCTGGCGACCTTGGGTCAGG + Intronic
907725331 1:57015250-57015272 AGCCCTGGCCAACTGTGGCCGGG - Exonic
908186060 1:61654363-61654385 GGTCCTGGGGAGCTGACGCAAGG - Intergenic
908703954 1:66930473-66930495 GGGCCTGGCCAGGAGAGGCCCGG + Intronic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
909471204 1:76030429-76030451 GGACCTGGAAAGGTGAGGCCAGG + Intergenic
910929181 1:92425680-92425702 GGCCCTGGGGAGATGAGGTGAGG + Intergenic
912518098 1:110228389-110228411 AGCCCAGGAGACCTGAGGCCAGG + Intronic
915147025 1:153801354-153801376 GTCCCTGCCCACCTGAGGCCAGG - Intergenic
915299989 1:154946329-154946351 GGGCCTGGAGAACTGGGGCCAGG - Exonic
917195279 1:172457667-172457689 GGCCAAGGCCAGCTTAGGCCTGG - Intronic
919921094 1:202166902-202166924 CTCCCTGGAGAGCTGAGGGCTGG + Intergenic
922132198 1:222790939-222790961 GGCCCTGTGGGGCTGAGACCTGG + Intergenic
922966675 1:229696561-229696583 GGCCCTGGGGTGATGAGGGCAGG - Intergenic
923001091 1:230006960-230006982 GGGCCTGGCAAGGTGAGGTCCGG - Intergenic
923546524 1:234927498-234927520 GGCCCTTCTGGGCTGAGGCCAGG - Intergenic
924188221 1:241519291-241519313 GTCCGTGGCGGGCCGAGGCCGGG - Intronic
1063553251 10:7053350-7053372 GGCCCGGGCTAGCTGAGCCAGGG - Intergenic
1063663845 10:8050529-8050551 GGCCCTGGCGAGCTGGGCCTGGG - Intergenic
1066101698 10:32123286-32123308 GGGCCTGGTGGGCTGAGGCAGGG + Intergenic
1067226873 10:44382419-44382441 GGCCCTTCCAAGCTGAGGCAGGG + Intronic
1068544116 10:58327206-58327228 AGCCCTGGCGAACCGAGGCTGGG + Intergenic
1069644425 10:69982303-69982325 GGCCGAGGCAGGCTGAGGCCAGG + Intergenic
1071309380 10:84328576-84328598 GGCCCTGGAGGGCGGAGTCCGGG + Exonic
1071519165 10:86318428-86318450 GGCCCTGGCAGGCAGAGGGCAGG - Intronic
1071525040 10:86353689-86353711 GGGCCTGGAGAGCTGAGGGTGGG - Intronic
1072578106 10:96718764-96718786 GGCCCTGGGCTGCTGAGTCCAGG - Intronic
1072722564 10:97789855-97789877 GGCCCTGGGTAGGTGAGGCATGG + Intergenic
1073572523 10:104592540-104592562 GTCACTGACGAGCTAAGGCCAGG + Intergenic
1074102581 10:110365200-110365222 GGGCCTGGACAGCTCAGGCCTGG + Intergenic
1074115390 10:110454102-110454124 GGCCGGGGGGAACTGAGGCCAGG + Intergenic
1074829881 10:117241008-117241030 GGCGCGGGCGGGCGGAGGCCGGG + Intergenic
1076146437 10:128126083-128126105 GTCCCAGGTGAGCTGCGGCCGGG - Exonic
1076830964 10:132994038-132994060 CGGCCTGGGGGGCTGAGGCCGGG - Intergenic
1076853377 10:133103756-133103778 CTCCCTGGCGAGCTCCGGCCTGG - Intronic
1076854084 10:133106687-133106709 GATCCTGTCGAGGTGAGGCCTGG + Intronic
1076908155 10:133373432-133373454 GGCCCTCGCGAGATCAGCCCGGG + Exonic
1077207141 11:1350108-1350130 GGCCCTGGCGCCCTGACCCCCGG + Intergenic
1077230644 11:1456884-1456906 GTCCCTGGCGTGCAGAGGCGAGG - Intronic
1077231798 11:1461118-1461140 GGCCGTGCGGAGCTGAGGCGAGG - Exonic
1077329761 11:1979088-1979110 GTCCCTGGAGAGGAGAGGCCTGG + Intronic
1077330476 11:1981959-1981981 GGCCTTGGGGACCTGGGGCCGGG + Intronic
1077378802 11:2218274-2218296 GGCACTGGGAAGCTGAGCCCAGG + Intergenic
1077532287 11:3103026-3103048 GGCCCTGGATGGCTCAGGCCGGG - Intronic
1077555511 11:3224170-3224192 GGCCCTGGGGTGATGAGGGCAGG + Intergenic
1078937122 11:15961768-15961790 GGCCGAGGCGGGCTGAGGTCAGG - Intergenic
1079187412 11:18249522-18249544 AGCCCAGGGGGGCTGAGGCCAGG + Intergenic
1079870556 11:25793768-25793790 GGCCCTGGAGTGCTCAGGCCTGG + Intergenic
1081692146 11:45085976-45085998 GGGCCTGGTCAGCTGAGTCCAGG + Intergenic
1081998258 11:47378106-47378128 TGCCCTGGCGGGCTGAGGCCAGG - Intronic
1083859936 11:65414805-65414827 GGCCCTGCTGAGCTGAAACCTGG - Intergenic
1083994785 11:66266512-66266534 GGCACTGGGCAGCTGCGGCCGGG + Intronic
1084095057 11:66905851-66905873 GGCCCTGGCGAGCTTAGCCCAGG + Intronic
1084172130 11:67405810-67405832 GGCCCAGGGAGGCTGAGGCCTGG + Intronic
1084313926 11:68332718-68332740 AGCCCTTGTGGGCTGAGGCCAGG + Intronic
1084580366 11:70019538-70019560 GGCTCGGGTGAGCTGAGTCCTGG - Intergenic
1084598559 11:70131676-70131698 GGCCCTGCTGAGCTCAGGGCTGG + Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1088724396 11:112621349-112621371 GGCTCTCGGGAGCTGAGGCTGGG + Intergenic
1088796294 11:113269209-113269231 GGCCCCAGAGAGCTGAGTCCAGG + Intronic
1090004036 11:122984510-122984532 GGCCCTGGGGCGCTAAGGGCGGG + Intergenic
1090277873 11:125432339-125432361 GGCCGTGGCGACCTGCGGGCTGG - Exonic
1091121360 11:133060581-133060603 GGACCTGGGGAGCCAAGGCCTGG - Intronic
1202812739 11_KI270721v1_random:34267-34289 GTCCCTGGAGAGGAGAGGCCTGG + Intergenic
1202813454 11_KI270721v1_random:37138-37160 GGCCTTGGGGACCTGGGGCCGGG + Intergenic
1091439545 12:501960-501982 GGCCTGGGCCAGCTGAGGCAGGG + Intronic
1091588121 12:1827588-1827610 GGCCATGGTGAGCTGTGGCGGGG + Exonic
1091648301 12:2290337-2290359 GCCCCTGCCCAGCTGAGCCCAGG - Intronic
1091917875 12:4282341-4282363 GGCCTTGGCGTGGGGAGGCCTGG - Intronic
1092002543 12:5044210-5044232 GGCCCGGGCAGGCTGCGGCCAGG + Exonic
1092487324 12:8914341-8914363 GGGCCTGGAGCGCAGAGGCCCGG + Intronic
1094113519 12:26885519-26885541 GACTCTGGTGAGCTGAGCCCAGG + Intergenic
1095752252 12:45726963-45726985 GGCCCTGGCGGGTCGCGGCCGGG - Intergenic
1096251064 12:50032959-50032981 GCCCCTGGGGAGGTGAGGGCCGG - Intronic
1096749541 12:53750033-53750055 GGCACTGGAGGGATGAGGCCTGG + Intergenic
1097169551 12:57105213-57105235 GGCCCTGACCAGCGGAGGCTTGG + Exonic
1098078996 12:66763474-66763496 GTCCCTGTCAAGCTGAGTCCTGG - Intronic
1100008177 12:89919750-89919772 GGCCTTGTCCACCTGAGGCCCGG - Intergenic
1101064379 12:101004294-101004316 GGCCCTGTGGAGCTGAGCCTCGG + Intronic
1101482036 12:105107681-105107703 GGCCCTCGCGAGCGGAGGCGGGG + Intronic
1102033613 12:109758786-109758808 CCCCCTGGCGAGCTGGGGCCAGG + Intronic
1102058653 12:109915595-109915617 GGCCCAGGGGAGCAGGGGCCGGG - Intronic
1102289287 12:111685815-111685837 GGCCCCGGCGGGCTCAGGCGAGG + Exonic
1102531720 12:113551615-113551637 GGACCTTGTGGGCTGAGGCCAGG - Intergenic
1103074211 12:117969103-117969125 GTCCCTGGCGCGCCGGGGCCGGG - Intergenic
1103598453 12:122038683-122038705 GGCCTTTTCGAGCTGAGGCCAGG + Intronic
1104732644 12:131116516-131116538 GGCACTGGAGGGCTGCGGCCTGG + Intronic
1104735398 12:131133173-131133195 GGGCCTGGGGAGCTGAGGGCTGG - Intronic
1104836440 12:131795189-131795211 GTCCCTGGTGAGCTGGGCCCGGG - Intronic
1106842084 13:33694539-33694561 AGGCCTAGTGAGCTGAGGCCAGG - Intergenic
1108243401 13:48490997-48491019 GGCCCTGGAGAAGTGAGGGCAGG + Intronic
1112733671 13:102394640-102394662 GCCCCCGGCGAGCCGAGGCTGGG + Intronic
1113676887 13:112213884-112213906 GCCCCTGGCTGGCTGTGGCCAGG - Intergenic
1117522648 14:56566166-56566188 GGCCCTTGTGTGCTGAGGACAGG - Intronic
1121671593 14:95714363-95714385 GGCGCGGGCCAGCTGGGGCCGGG - Intergenic
1122602400 14:102928293-102928315 AGCCCGGGCGAGCTCAGGCCCGG - Intronic
1122946707 14:105014313-105014335 GGCCCTGGGGAGCAGAGGAAGGG + Intronic
1124318655 15:28694278-28694300 GGCCACGGGGAGCTGAGACCGGG - Intergenic
1125510602 15:40290566-40290588 GGCCCAGGAGAGGTGAGCCCTGG - Exonic
1128800304 15:70492852-70492874 GGCCCTGGCACAGTGAGGCCAGG - Intergenic
1129111609 15:73340318-73340340 GCCCCTGGGAGGCTGAGGCCTGG + Intronic
1129116236 15:73366996-73367018 TGCCCTGGGAAGCTGCGGCCGGG - Intronic
1129777160 15:78244308-78244330 GGCCCTGGAGATAAGAGGCCTGG - Intronic
1130150558 15:81308397-81308419 GGCCATGGAGAGCTGGAGCCTGG + Intronic
1130925609 15:88383552-88383574 GGCCAGGGTGAGCTGAGGCCAGG + Intergenic
1131118466 15:89808683-89808705 GGCCCTGACATGCTGGGGCCTGG - Intronic
1132625881 16:891260-891282 GGTCCTGGCCAGGTGAGTCCTGG + Intronic
1132683058 16:1151800-1151822 GGCCCTGCCCAGCTGGGGCCCGG - Intergenic
1132703359 16:1231195-1231217 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132703408 16:1231328-1231350 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132703461 16:1231461-1231483 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132708042 16:1254906-1254928 GTCCATGGGGAGCTGGGGCCGGG + Intergenic
1132885041 16:2178865-2178887 GGGCCTGGCGGGCGGAGGGCGGG - Intronic
1133923207 16:10173020-10173042 GGCCCTGAAGAGCTGTGGTCTGG - Intronic
1134419340 16:14071385-14071407 GGCCGTTGGGGGCTGAGGCCGGG + Intronic
1136067105 16:27766728-27766750 GACCATGGCAAGCTGGGGCCTGG - Intronic
1136666791 16:31819572-31819594 GTCCCAGGTGAGCTGCGGCCGGG + Intergenic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1137683230 16:50368841-50368863 GGGCCAGGCGAGCGGAGGGCGGG + Intronic
1137983969 16:53092197-53092219 AGCCCTGGAGAGCTGCAGCCTGG + Intronic
1138342613 16:56300385-56300407 GGCCGTGGTGAGCTGCAGCCAGG - Intronic
1138521884 16:57575782-57575804 ATCCCTGGCGAGCTGGGCCCAGG - Exonic
1138610898 16:58123220-58123242 GGCCAAGGCGAGCTGAGGTCAGG - Intronic
1139530144 16:67538679-67538701 GGCCCCGGCGGGCTGAAGACCGG - Exonic
1139922926 16:70471022-70471044 GGCCCTGTCCAGCTGGGTCCTGG + Exonic
1141428941 16:83960934-83960956 GGTTCAGGCGAGCAGAGGCCTGG + Intronic
1141898496 16:86974244-86974266 GGCGGAGGCCAGCTGAGGCCAGG + Intergenic
1141990196 16:87604916-87604938 GACCCTGGGGCGCTGAGGGCCGG + Intronic
1142186966 16:88699221-88699243 GGCCATGGCGTGCAGAGGCACGG - Intronic
1142195280 16:88736714-88736736 GGCCCAAGCGGGCTGAGCCCAGG - Exonic
1142967862 17:3592222-3592244 GGCCGTGGAGAGCTGGGGCTTGG + Exonic
1143615518 17:8047087-8047109 GTCCCTGGAGAGCCGAGGGCTGG + Intronic
1144640460 17:16933922-16933944 GGGCCTGGCTAGCAGAGGCCTGG - Intronic
1145064883 17:19755611-19755633 GCCCCTGGCTGGCTGTGGCCAGG - Intergenic
1146398616 17:32487190-32487212 GGCCCTGGGGAGCGGAGACCGGG + Intronic
1146656369 17:34637480-34637502 GGCCCTGGTTGGCTGGGGCCCGG - Exonic
1147363476 17:39945507-39945529 TGCCCTACAGAGCTGAGGCCTGG + Intergenic
1147363907 17:39947917-39947939 TGCCCTACAGAGCTGAGGCCTGG + Intergenic
1147369799 17:39984518-39984540 GTTCCTGGGGATCTGAGGCCAGG - Intronic
1147994844 17:44354847-44354869 GGCCCCGGCGGGCTGGAGCCCGG - Exonic
1148148156 17:45379031-45379053 GTCCTTGGTGAGCAGAGGCCTGG - Intergenic
1148211940 17:45813887-45813909 GTCCCTGGCCAGCTGTGGACGGG + Intronic
1149429741 17:56588355-56588377 AGCCCAGGAGAGCTGAGGGCAGG + Intergenic
1149611171 17:57958624-57958646 GGCCATGGCGGGCGGAGGTCGGG - Intergenic
1150640678 17:66947558-66947580 TTCCCTGGTGGGCTGAGGCCTGG - Intergenic
1151342531 17:73481144-73481166 AGCCCAGGCGAGCTGAGCACGGG + Intronic
1151571052 17:74925480-74925502 AGGCCTGCCGAGCTGAGGACAGG - Intronic
1151740545 17:75979187-75979209 GGGCCGGGCGAGCGGAGGCGGGG - Exonic
1151803449 17:76391179-76391201 GGTCCCTGCTAGCTGAGGCCAGG + Exonic
1151809522 17:76429760-76429782 GCTCCTGGAGTGCTGAGGCCAGG - Intronic
1151952686 17:77363917-77363939 GGACCTGGCCAGCTCTGGCCAGG - Intronic
1152175288 17:78782734-78782756 CTCCCTGGCAAGCTGGGGCCGGG - Intergenic
1152356210 17:79808911-79808933 GGCACTGGCGAGCCGAGGCAAGG + Intergenic
1152628525 17:81399406-81399428 GGCCCGAGCGAGCGGCGGCCAGG - Intronic
1152650113 17:81488676-81488698 TGCCCGGGTCAGCTGAGGCCCGG - Intergenic
1152721911 17:81927536-81927558 GGGCCCGGCGGGCCGAGGCCGGG + Exonic
1152895256 17:82907220-82907242 GTCCCTGGCGAGATCAGACCTGG - Intronic
1154151373 18:11908844-11908866 GGCCCTGGCGTCAGGAGGCCGGG - Exonic
1157539776 18:48492286-48492308 AGCCCAGGTGAGCTGAGACCAGG - Intergenic
1160005936 18:75069152-75069174 GGCCCTGGCTGGCTGTGTCCAGG + Intergenic
1160079745 18:75714200-75714222 GGGCCTGGGGAGGTGGGGCCTGG + Intergenic
1160745407 19:709027-709049 GGCCGGGGCGGGCTAAGGCCTGG - Intergenic
1160791694 19:926334-926356 GGCCCTGGCGGGCTGGGGTTCGG + Intronic
1161219779 19:3113229-3113251 CGCCCGGGCCAGCCGAGGCCTGG + Intronic
1161224401 19:3136390-3136412 TGCCCTGGCCAGCAGGGGCCCGG + Exonic
1162079324 19:8209223-8209245 GGCCCTGGAGAGGCGGGGCCTGG - Intronic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1162789918 19:13057518-13057540 GGCCCTGGGGAGCCGAGGCTGGG - Intronic
1162917581 19:13882625-13882647 GACCCTGGCCAGGTGAGGCCAGG + Exonic
1163232407 19:16013638-16013660 GGCCCTGGTCAGTGGAGGCCTGG + Intergenic
1163236138 19:16031692-16031714 TGGCCTGGTCAGCTGAGGCCTGG + Intergenic
1163863141 19:19752955-19752977 GGCCCTGGTCAGCAGGGGCCTGG - Intergenic
1164240511 19:23384303-23384325 GGACCTGGGGAGCTGCAGCCTGG + Intronic
1164696947 19:30252344-30252366 GGCCCTGGCTGGCTGTGGCTGGG + Intronic
1164897270 19:31887837-31887859 GTGCCTGGCGTGCTCAGGCCAGG + Intergenic
1165448313 19:35868772-35868794 GGCGCGGCCGAGGTGAGGCCGGG + Exonic
1165784564 19:38453347-38453369 AGGCCTGGGGAGGTGAGGCCAGG + Intronic
1167530732 19:50014684-50014706 GGCCCAGGCGTGCTGAGGTGTGG + Intronic
1168571894 19:57477351-57477373 GGCCCTGGACAGCTGATCCCAGG - Exonic
925610400 2:5696845-5696867 GGCCCCGGGGAGCTGATTCCGGG - Exonic
925744073 2:7029931-7029953 GGCCCTGGGGAGGAGCGGCCTGG + Intronic
926695979 2:15770469-15770491 GGCCATGGAGCGCTGAGGACAGG - Intergenic
927574556 2:24190547-24190569 GGGTCTGGTGAGCAGAGGCCTGG + Exonic
929033796 2:37672150-37672172 GGACCTGGGGAGCTGCGGCCTGG - Exonic
929354339 2:41001578-41001600 GGCCCTGGGGTGATGAGGGCAGG + Intergenic
929967358 2:46545140-46545162 GGCCCAGGAGAGCTGAGAACTGG - Intronic
930206690 2:48594033-48594055 TGCCCTGGAGAGCTGAAGCTGGG - Intronic
931336885 2:61354629-61354651 GGCTCAGGCTAGCTGAGGCCAGG - Intronic
932494930 2:72141503-72141525 GGCCCAGGTGTGCTGGGGCCTGG - Intronic
933751075 2:85602469-85602491 CGCCCAGGCGAGCGGGGGCCGGG - Intronic
934098125 2:88626762-88626784 GGCCCTCGGGAGCCGAGCCCAGG + Intronic
937013955 2:118586672-118586694 GGTCCTGACAAGCAGAGGCCTGG + Intergenic
937467364 2:122146163-122146185 GGCGGTGGCCAGCTGGGGCCAGG - Intergenic
937907909 2:127061258-127061280 GGCCATGGTGACCTGAGGCTGGG - Intronic
937989342 2:127653729-127653751 GTCCCTGGGCAGATGAGGCCAGG + Intronic
938422703 2:131156981-131157003 GGGCCTGGCCAGCAGAGGGCTGG - Intronic
940238842 2:151541366-151541388 GCCACTGGCCAGGTGAGGCCAGG + Intronic
941916325 2:170816235-170816257 GGCACTGGGTAGCTGTGGCCAGG + Intronic
942043825 2:172087708-172087730 GCCCCTGGCAGGCTAAGGCCTGG + Intronic
946161355 2:217837911-217837933 GGCTCCGGGGAGCTAAGGCCTGG - Intronic
946427749 2:219608445-219608467 GGCTGGGGCGAGCTGAGGCCAGG + Intronic
947102850 2:226639883-226639905 GGCCCTTGCGGGCTGTGTCCAGG + Intergenic
947611173 2:231526013-231526035 GGCCTTGGGGAGCTGGGGGCTGG - Intronic
947900549 2:233718006-233718028 GGACCTGGGGAGCTGGAGCCTGG - Intronic
947931456 2:233968380-233968402 GTCCCTGGCAGGCTGAGCCCCGG - Intronic
948383763 2:237568705-237568727 GACCCTGGAGAACTGAGGGCAGG + Intergenic
948663747 2:239522035-239522057 GTCCCTGGCTAGCTGAGGGACGG + Intergenic
948851719 2:240711534-240711556 GTCTCTGGGGAGCTGAGCCCCGG - Intergenic
949031490 2:241799350-241799372 GGCTCTGGGGAGCAGGGGCCGGG + Intronic
1169521011 20:6372867-6372889 GGCCATGGCTACATGAGGCCAGG + Intergenic
1172121343 20:32600776-32600798 GGCCCTGGGGAGTGGAGTCCTGG + Intronic
1172705165 20:36877679-36877701 GGCCCCTGCCAGCTGAGGGCTGG - Intronic
1173998987 20:47360663-47360685 GCACCTTACGAGCTGAGGCCTGG + Intergenic
1174173511 20:48631044-48631066 GGGCCTGGGGAGCAGAGGGCTGG - Intronic
1174325239 20:49773658-49773680 GGCCCTTGCTAACAGAGGCCTGG + Intergenic
1174502958 20:50999144-50999166 GGCCTTGGAGTGCTTAGGCCAGG + Intergenic
1174553475 20:51377967-51377989 AGCCCTGGTGACCTGACGCCTGG - Intergenic
1174829252 20:53797709-53797731 GGCCAAGGCAAGCTGAGGTCAGG - Intergenic
1175162865 20:57021822-57021844 GGGACTGGAGAGCTCAGGCCAGG - Intergenic
1175396696 20:58669320-58669342 GGCCCTGCCGAGCCGGGCCCGGG + Exonic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1175889596 20:62310377-62310399 TGCCCTGCCCTGCTGAGGCCTGG + Intronic
1175928366 20:62481658-62481680 GCCCCTGCCCAGCTGTGGCCCGG - Intergenic
1175996221 20:62813359-62813381 GGTCCTGCCGGGCTGGGGCCTGG - Exonic
1175996282 20:62813539-62813561 GGTCCTGCCGGGCTGGGGCCTGG - Exonic
1176194295 20:63830521-63830543 GGTCCCGGCGCCCTGAGGCCGGG - Intronic
1176196082 20:63836796-63836818 GGCCTGGGACAGCTGAGGCCTGG - Intergenic
1176199758 20:63854987-63855009 GTCCCTGGGGAGCTGGCGCCAGG - Intergenic
1179987919 21:44931681-44931703 GGACCTGGCGCGCCTAGGCCGGG - Intronic
1180983726 22:19891942-19891964 GGTCCTCGCCAGCTGCGGCCAGG + Intronic
1181023774 22:20116582-20116604 GCCCATGGAGAGCTGTGGCCAGG - Exonic
1181496338 22:23289307-23289329 GGCCCTGGAGAGCCCAGGCCTGG - Intronic
1181569018 22:23757025-23757047 GGCCCTGGAGAGATTAGGGCAGG - Intergenic
1183194280 22:36342772-36342794 GGGCCTGGCGAAGTGAAGCCGGG + Intronic
1183241391 22:36660359-36660381 GGCACTGGAGGGCTGAAGCCGGG - Intronic
1183317684 22:37145922-37145944 GACCCTGGGAAGCTGAGGGCTGG - Intronic
1183441838 22:37827447-37827469 GGCCCTGGGGAGCAGTGGCCAGG - Intergenic
1183675103 22:39294805-39294827 GGACCAGGCAAGCTGAGGCGGGG + Intergenic
1183697386 22:39430943-39430965 GGCCCCGGTGGGCTGAGGCAGGG + Exonic
1184003740 22:41694020-41694042 GGCACTGTCGACCAGAGGCCTGG + Exonic
1184287032 22:43477597-43477619 GGCCGTGGCAAGATGAGACCAGG - Intronic
1184300360 22:43555266-43555288 GGCCCTGCTGAGCAGAAGCCTGG + Intronic
1184662600 22:45972285-45972307 CGCCTGGGCCAGCTGAGGCCGGG + Intronic
1184665789 22:45988406-45988428 GGACCAGGAGAGCTGAGGTCAGG + Intergenic
1184674790 22:46035880-46035902 GCCCCTGGCGCGTAGAGGCCCGG + Intergenic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
1185066892 22:48636918-48636940 GGCCCTGGGAGGCTGAGGCCAGG + Intronic
1185345074 22:50307450-50307472 GGGCCTGCCGCGCTGGGGCCCGG - Intronic
952979542 3:38723648-38723670 GTGCCTCGCCAGCTGAGGCCTGG + Intronic
953369815 3:42377925-42377947 GACCTTGGCGAGCTGAGTCATGG - Intergenic
953387183 3:42513297-42513319 GGCCCTGGGAACCAGAGGCCAGG + Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
953705382 3:45226357-45226379 GAGCCTGGCGAGCGGAGGGCGGG - Intergenic
954453803 3:50586158-50586180 GGCCCTGGGGGGCAGAGGCTGGG - Intergenic
954684110 3:52361341-52361363 GGGCCTGGCCAGGTGAGGCTGGG + Exonic
954841742 3:53517400-53517422 GGTCCTGTCGAGCTCTGGCCTGG - Intronic
956105137 3:65809667-65809689 AGCCCTGGAGCCCTGAGGCCAGG + Intronic
960704498 3:120468992-120469014 GGCCCTGCTGAGCTGAAGCCAGG - Intergenic
960705592 3:120477819-120477841 GGCCCTGCTGAGCTGAAGCCAGG + Intergenic
960955347 3:123027338-123027360 GGCTCTGGCAAGTTGAAGCCAGG - Intronic
961574408 3:127823045-127823067 GGCACTGGCGGGCTGGGGCAGGG + Intronic
961639822 3:128358125-128358147 GGCCCGGGAGAGCTGGGGCTAGG + Intronic
962200908 3:133400341-133400363 GGGCCTGCGGAGCTCAGGCCTGG + Exonic
962258832 3:133890163-133890185 AGCTCTGGCAAGCTGAGGTCTGG + Intronic
962731779 3:138290176-138290198 GGCCCTGGCCAGACCAGGCCAGG - Intronic
963786190 3:149536676-149536698 TGCCCCGGCGACCCGAGGCCAGG + Intronic
964757370 3:160100762-160100784 GGGCCAGGCGAGCGGAGGGCGGG - Intergenic
965648346 3:170908348-170908370 GGCCGGGCCGAGCTGAGCCCTGG - Intronic
966975297 3:185077599-185077621 GGACTTGCCGCGCTGAGGCCTGG + Intergenic
968589277 4:1449638-1449660 GGCCCAACTGAGCTGAGGCCTGG + Intergenic
968591046 4:1459852-1459874 GGTCCTGGGGGGCAGAGGCCGGG - Intergenic
969339885 4:6533514-6533536 GGCCATGGGGTGCTGAGCCCTGG - Intronic
969431862 4:7159968-7159990 GGCCAAGGCGACTTGAGGCCGGG - Intergenic
969444998 4:7239610-7239632 GCCCCTGGGGAGCTGGGGCTGGG + Intronic
971299844 4:25432995-25433017 GGTGCTGGCTAGCTGGGGCCTGG + Intergenic
976184406 4:82430221-82430243 GCCTCTGGCGGGCTGACGCCGGG + Exonic
976270172 4:83222475-83222497 GGCCCTGGGGTGATTAGGCCAGG - Intergenic
984796823 4:183669376-183669398 AGGCCTGGAGAGCTGAGGCCAGG - Intronic
985549451 5:525564-525586 GCCCCTGGGGAGCTGAGGAAGGG - Intergenic
985657095 5:1137832-1137854 GGCCCCGGGGAGCTGGTGCCGGG - Intergenic
985674024 5:1221024-1221046 GGCCCTGGCAAGGGGAGGCCGGG + Intronic
985720099 5:1484471-1484493 CTGCCTGGCGACCTGAGGCCAGG + Intronic
985846827 5:2355997-2356019 GGCTCTGGAGAGCAGATGCCAGG - Intergenic
985875743 5:2592409-2592431 GGCCCTGCCGAGCTGAGAGGCGG - Intergenic
990321961 5:54638836-54638858 GGCCCTGGAGGGGTGTGGCCAGG - Intergenic
991331649 5:65499104-65499126 AGGCCTGCCAAGCTGAGGCCAGG - Intergenic
997648646 5:135498605-135498627 GGCCTTGGCATCCTGAGGCCGGG + Intergenic
999143976 5:149380715-149380737 GGCCCTGTCGTGCTGAGGGCCGG + Intronic
999826099 5:155275124-155275146 TGCTCTGGAGAGATGAGGCCTGG - Intergenic
1002076693 5:176712653-176712675 GGAGGTGGGGAGCTGAGGCCTGG + Intergenic
1002518185 5:179774611-179774633 GGCCCTGCTGGGCTCAGGCCAGG - Exonic
1002784718 6:392400-392422 GGCCCGGGAGAGCGGAGGCGGGG - Intronic
1002900013 6:1402458-1402480 GGCCCTGGGCAGGTAAGGCCAGG - Intergenic
1003282559 6:4706555-4706577 GGCCAAGGCGGGCTGAGGTCAGG + Intronic
1003291894 6:4786971-4786993 GGCCCTGCAGAGCTCTGGCCTGG + Intronic
1004154230 6:13152982-13153004 GGCCCTGGAGTGCTGAGGACAGG + Intronic
1006136279 6:31897863-31897885 GTCCCTGCAGAACTGAGGCCAGG - Intronic
1007257516 6:40539151-40539173 GGCCCTGCAGAGGTGAGGCCAGG - Intronic
1013034243 6:106364655-106364677 GAGCATGGCGAGCTGTGGCCAGG + Intergenic
1013571351 6:111429729-111429751 GGGCCAGGCGAGCCGAGGGCGGG - Intronic
1014079174 6:117268480-117268502 GGCCCTGGCGAGGTGAGTATAGG + Exonic
1017072602 6:150589089-150589111 GGCTCTGGAGAGCAGGGGCCAGG + Intergenic
1017989439 6:159473308-159473330 GGCCCTGGCTTGCTGAGCACAGG + Intergenic
1019170672 6:170131592-170131614 GGCCATGGGGTGATGAGGCCTGG + Intergenic
1019305500 7:332624-332646 AGCCCTGGCGGTCTGAGGCTAGG - Intergenic
1019377187 7:699098-699120 GCCCCTGGCGTGCTGGGGCAGGG - Intronic
1019689620 7:2403470-2403492 GGCGCAGGCGCGCTGAGGGCGGG + Intergenic
1019716387 7:2541346-2541368 GACCCTGGCGGGCTGCGTCCGGG - Exonic
1020107113 7:5427316-5427338 TGCCCTGGCTAGCCGAGGCCCGG + Intergenic
1020111653 7:5451228-5451250 GGCCCCTCTGAGCTGAGGCCTGG - Intronic
1020211840 7:6163691-6163713 GGCCCTGGGGTGCAGAGGCCCGG - Exonic
1021340400 7:19457230-19457252 GGTCCTGGAGAGCTGATTCCTGG + Intergenic
1023140160 7:37094186-37094208 GGGCTTGGACAGCTGAGGCCTGG - Intronic
1023258562 7:38335879-38335901 GGCCCTGGCCAGCTGGCGCCAGG - Intergenic
1023822266 7:43986770-43986792 GGCCCTGGCGAGAGCAGCCCGGG + Intergenic
1024227276 7:47335559-47335581 GGCCCTGGGTGGCTGAGCCCTGG - Intronic
1024559645 7:50632395-50632417 CGTCCTGGGGAGCTGAGACCAGG - Intronic
1026040012 7:66860212-66860234 GGCGCTGTCGGGCTGAGGCCTGG + Intergenic
1026104958 7:67413567-67413589 GGCCCTGCCCAGCTCAGGCTTGG - Intergenic
1027025601 7:74849946-74849968 GGCCCTGGGGAGCAGACGTCAGG + Intronic
1027062163 7:75094173-75094195 GGCCCTGGGGAGCAGACGTCAGG - Intronic
1028774060 7:94658183-94658205 GGCCCAGGAGAGGTGGGGCCTGG - Intronic
1029750531 7:102540184-102540206 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1029768484 7:102639292-102639314 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1031164656 7:118214121-118214143 GGCCCCGTGGAGCTGAGCCCAGG - Intergenic
1032331692 7:130986517-130986539 GGCCCTGGCGATCAGAGGAGGGG - Intergenic
1034437770 7:151071302-151071324 GGCCAGGGCGGGCTGGGGCCAGG + Intronic
1034533533 7:151712535-151712557 GGCCCTGATGAGCTGACACCCGG + Intronic
1035030251 7:155852234-155852256 GGGCCTGGGGAGATGAGGCATGG - Intergenic
1035075846 7:156176814-156176836 GGGCCTGCAGAGCTGTGGCCAGG + Intergenic
1035375543 7:158404755-158404777 GGGGCCGGGGAGCTGAGGCCGGG - Intronic
1035375614 7:158404931-158404953 GGAGCTGGGGAGCTGGGGCCGGG - Intronic
1035382217 7:158447441-158447463 GGCCCTGACGGACTCAGGCCAGG + Intronic
1035436793 7:158865461-158865483 GGCCCTGGGGAGCTGGTGCTGGG + Intronic
1035459329 7:159029603-159029625 GCCCCAGGCCAGCTGCGGCCAGG - Exonic
1035571084 8:673007-673029 GGCCCTGGCCAGCTGTGCCAAGG - Intronic
1035682878 8:1501392-1501414 GGCCCCGGAAAGCTGATGCCCGG - Exonic
1037773427 8:21816939-21816961 GGTCCTGTCGGGCTGAAGCCTGG - Intergenic
1037818122 8:22122523-22122545 GCCCCTGCCAAGCTGATGCCCGG - Exonic
1037961804 8:23103269-23103291 GGCCCTGGTCACCTGCGGCCGGG + Intronic
1040104656 8:43534860-43534882 GGACCTGGTGAGCGGAGGCCTGG + Intergenic
1040482763 8:47841571-47841593 GACCCTGGGGGGCTGAGACCAGG - Intronic
1042151445 8:65790219-65790241 AGCCCTGGGGAGCAGAGGCCAGG + Intronic
1044103529 8:88172052-88172074 GGCCAAGGCGACCTGAGGTCAGG - Intronic
1047888010 8:129274306-129274328 GGCCCTGGAGAGCTGAGAGGTGG + Intergenic
1048375339 8:133818152-133818174 GGCCAGGGCGAGCTGAGACCAGG - Intergenic
1048833848 8:138499937-138499959 GGCCCTGAACAGCTGGGGCCTGG + Intergenic
1048977012 8:139678726-139678748 AGCCCTGGCCAGGTGAGGTCTGG - Intronic
1049316269 8:141970235-141970257 GGCCCTGGTGGGCTGTGGCTGGG - Intergenic
1049654383 8:143791373-143791395 AGCCCTGGTGAGTTGGGGCCGGG - Exonic
1051166831 9:14271251-14271273 GGCCCAGGCGAGATTGGGCCAGG - Intronic
1052217295 9:25982690-25982712 GGGCATGGCAAGCTGAGGCGGGG + Intergenic
1052756802 9:32550635-32550657 GGCCCTGGCCCGCCGAGGCCCGG + Intronic
1053753629 9:41280497-41280519 GGCCCAGGGGTGCTGAAGCCGGG - Intergenic
1053919490 9:42973740-42973762 GGCCGAGGCGGGCTGAGGTCAGG + Intergenic
1054259152 9:62844857-62844879 GGCCCAGGGGTGCTGAAGCCGGG - Intergenic
1054332627 9:63775180-63775202 GGCCCAGGGGTGCTGAAGCCGGG + Intergenic
1055729824 9:79268931-79268953 GGCCCTGGACAGCTGATGCCAGG - Intergenic
1056197876 9:84246008-84246030 GATGCTGGTGAGCTGAGGCCAGG + Intergenic
1056577820 9:87869334-87869356 AGCCATGGAGGGCTGAGGCCCGG + Intergenic
1057081493 9:92177399-92177421 GGGGCTGGCCAGCTGGGGCCTGG - Intergenic
1057180787 9:93028954-93028976 AGCCATGAAGAGCTGAGGCCAGG - Intronic
1057199871 9:93134244-93134266 GGCTCGGGCGCGCTCAGGCCCGG - Exonic
1057307485 9:93920654-93920676 GGCTCAGGAGAGCGGAGGCCCGG + Intergenic
1058432170 9:104928804-104928826 GGACCTGGGGAGCTCAGGCTGGG - Intergenic
1060827150 9:126693839-126693861 GGCCAGGGTGAGCTGGGGCCGGG + Exonic
1061288436 9:129637443-129637465 AGCCCTGGGGTGCTGAGGCTTGG + Exonic
1061308726 9:129748611-129748633 GGCCATGGCCAGGTGTGGCCAGG + Intronic
1061404489 9:130385818-130385840 AGCCCTGGCGAGCTGCGGGGAGG + Intronic
1061862567 9:133475574-133475596 GGCGCTGGCTGGCTGTGGCCGGG - Exonic
1061996361 9:134188199-134188221 TGCCCTGGGGTCCTGAGGCCTGG + Intergenic
1062118714 9:134822619-134822641 GCCCCTGGCACGCTGAGGGCTGG + Intronic
1062156306 9:135050587-135050609 GGGCCTGTCGTGCTGAGTCCTGG + Intergenic
1062586964 9:137253837-137253859 GGCCCTGGTGAGCAGATCCCTGG - Intergenic
1062631550 9:137465318-137465340 GGCCGGGGCAAGGTGAGGCCGGG - Intronic
1186427838 X:9478246-9478268 GTCCCTGGAGAGCTGAGCACAGG + Intronic
1186496347 X:10015237-10015259 GGCCCGGGCGAGCAGGGGCAGGG - Intergenic
1186732982 X:12429975-12429997 GGCCCTGGCAAGTTGGGGCCTGG - Intronic
1188105233 X:26141105-26141127 GGGACTGGAGAGCAGAGGCCAGG + Intergenic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1190215360 X:48476400-48476422 GGCCCTGGGGCGCGGAGGACAGG + Intronic
1190326224 X:49208648-49208670 AGCCCCGGCGAGCTGAGGGCTGG + Exonic
1192233978 X:69284689-69284711 GGTGGTGGCGAGCTGAGACCAGG - Intergenic
1198020826 X:132656314-132656336 GTCACTGGGGAGCTGAGGCATGG + Intronic
1201017986 Y:9624456-9624478 GGCCGTGGCGTACTGGGGCCTGG - Intergenic