ID: 1137614788

View in Genome Browser
Species Human (GRCh38)
Location 16:49839672-49839694
Sequence GCCTCCAGAGAGAACAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137614781_1137614788 8 Left 1137614781 16:49839641-49839663 CCCCAAGGAACTGACTCGCGGCC 0: 1
1: 0
2: 0
3: 0
4: 59
Right 1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG 0: 1
1: 0
2: 6
3: 53
4: 324
1137614782_1137614788 7 Left 1137614782 16:49839642-49839664 CCCAAGGAACTGACTCGCGGCCC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG 0: 1
1: 0
2: 6
3: 53
4: 324
1137614778_1137614788 19 Left 1137614778 16:49839630-49839652 CCCAGAAACAGCCCCAAGGAACT 0: 1
1: 0
2: 0
3: 30
4: 240
Right 1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG 0: 1
1: 0
2: 6
3: 53
4: 324
1137614783_1137614788 6 Left 1137614783 16:49839643-49839665 CCAAGGAACTGACTCGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG 0: 1
1: 0
2: 6
3: 53
4: 324
1137614779_1137614788 18 Left 1137614779 16:49839631-49839653 CCAGAAACAGCCCCAAGGAACTG 0: 1
1: 0
2: 3
3: 13
4: 193
Right 1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG 0: 1
1: 0
2: 6
3: 53
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137614788 Original CRISPR GCCTCCAGAGAGAACAGAGC CGG Intronic
900394286 1:2446779-2446801 GCCTGCAGAGGGGTCAGAGCCGG + Intronic
901193806 1:7428475-7428497 GCCACCAGAGGCAACTGAGCAGG - Intronic
902950878 1:19882197-19882219 GGGACCAGAGAGAACAAAGCAGG - Intergenic
903041237 1:20532370-20532392 GCCTCCAGAAGGAACATAGCTGG + Intergenic
903085799 1:20857496-20857518 ACCTGCAGGGAGAACAGAGTGGG + Exonic
903593997 1:24480032-24480054 GTCTCCCGACAGAACAGAGCTGG - Intergenic
903794540 1:25918881-25918903 GGCACCAGAGGGGACAGAGCAGG + Intergenic
904783738 1:32969996-32970018 GCCTCAAGAAAGAAAAAAGCAGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905290807 1:36920656-36920678 TCCTCCTCAGAGAACAGGGCTGG - Intronic
905750036 1:40454199-40454221 GCATCCTGAGACAGCAGAGCTGG - Exonic
905752950 1:40481759-40481781 GCATCCTGAGACAGCAGAGCTGG - Exonic
905991178 1:42338035-42338057 GGCTGGAGAGAGAACAGAGGTGG + Intergenic
905996335 1:42384099-42384121 GCCTCCAGGGAGAAAAGCTCAGG - Intronic
906737081 1:48140733-48140755 GCCTCCAGAGTAGACAGAGTAGG + Intergenic
907326344 1:53640956-53640978 GCCTCTGGAGGGAACAGAACCGG + Intronic
907386333 1:54127948-54127970 GCCTCCCCAGGGCACAGAGCAGG - Intergenic
907515613 1:54991564-54991586 CCCTGCAGAGAGAACTGAGGAGG + Intronic
908959960 1:69684906-69684928 CCCACCAGGGAGAGCAGAGCAGG - Intronic
911253087 1:95601272-95601294 ACCTTGAGAAAGAACAGAGCTGG - Intergenic
913221840 1:116666745-116666767 TTCCCCAGAGAGAACAGGGCAGG + Exonic
914808184 1:151007091-151007113 GGCTCCAGAGGGAAAAGAGCTGG - Intronic
915022728 1:152796765-152796787 GACTCCGGTAAGAACAGAGCAGG + Exonic
915314418 1:155019952-155019974 ACCTGCTGAGAGAGCAGAGCAGG - Intronic
917265254 1:173214296-173214318 GGCTCCAGAGTAAACAAAGCTGG - Intergenic
920195195 1:204222126-204222148 GCTCCCAGAGGGAACAGTGCTGG - Exonic
920417934 1:205811242-205811264 GCCTCCAGATGGAGCAGTGCAGG - Intronic
921866771 1:220094508-220094530 GCCTCCAGAGAGGCCCGATCCGG + Intronic
922500951 1:226096541-226096563 GCCTCCAGGGGGACCACAGCTGG - Intergenic
922542383 1:226429176-226429198 GCCCCTAGAGAGAAGGGAGCTGG + Intergenic
922786724 1:228286599-228286621 GGCTGCAGAGGGAACAGGGCAGG - Intronic
923323596 1:232860434-232860456 TCCTCCAGGAAGAACAGAGTTGG - Intergenic
924457554 1:244230778-244230800 GCCTCCAGAGAGTCCACGGCGGG + Intergenic
1062994090 10:1848626-1848648 GACAACAGAGAGAACAGAGGAGG + Intergenic
1065266208 10:23978885-23978907 GCCACCAGAGAGAACATGGCAGG - Intronic
1065800145 10:29344575-29344597 GCCTCCAGAGAGCCCTGTGCCGG + Intergenic
1065997574 10:31073396-31073418 GCCCCCATGGAGAACTGAGCAGG - Intergenic
1067471384 10:46541159-46541181 GCTTCCAGAAAGGACAGAGATGG - Intergenic
1067809916 10:49418274-49418296 GCCTCCTGAGGGGACAGAGTGGG + Intergenic
1068144823 10:53054788-53054810 GCCTCAAGGGAGAACAAATCAGG - Intergenic
1068251276 10:54444362-54444384 GTCTACAAAGAGAACAAAGCGGG - Intronic
1069527032 10:69181143-69181165 GGCTCCAGAGAGAAAAGAAGAGG + Intronic
1069882463 10:71602329-71602351 GGCTGCTGGGAGAACAGAGCTGG - Intronic
1071107088 10:82110693-82110715 GACTCCAGGGAGAACAGTGTGGG + Intronic
1073439995 10:103546872-103546894 GCCCCCAGATAGAACAGCTCTGG + Intronic
1074308335 10:112299511-112299533 GCCTCCTGCGAGACCAGACCGGG + Exonic
1075434089 10:122419438-122419460 GCCTCCTGAGACAACAAGGCAGG - Intronic
1076569079 10:131420487-131420509 GCCCCCAGAGAGAGCAGCGCTGG - Intergenic
1077309739 11:1883006-1883028 GCCCCCACAGGGAGCAGAGCAGG + Intronic
1077495465 11:2884811-2884833 GCCTCAAGAGAGCGCCGAGCAGG - Exonic
1077529489 11:3088471-3088493 CCCTCCAGGGGCAACAGAGCGGG + Intronic
1078731926 11:13982897-13982919 GCCCTCAGAGAGAACAGAGAGGG + Exonic
1080683466 11:34496486-34496508 GCCTCCTGAAAGAGAAGAGCAGG - Intronic
1081968382 11:47183068-47183090 GCCTTGAAGGAGAACAGAGCGGG + Exonic
1082932807 11:58626304-58626326 ATCTCCAGTGAGAACAGAGTAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084097400 11:66920692-66920714 ACCTCCTCAGGGAACAGAGCTGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084561464 11:69907872-69907894 GCCTCCATGGAGGCCAGAGCAGG + Intergenic
1085046064 11:73354377-73354399 GCCTCTGGACAGAACAGGGCAGG - Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1088198464 11:107303035-107303057 TCCTGCAGAAAGAACATAGCTGG - Intergenic
1089049175 11:115531155-115531177 GACTCCAGAAAGAACAAACCTGG - Intergenic
1089295552 11:117465112-117465134 GGCTACAGAGAGAACAGCCCCGG - Exonic
1089462374 11:118660729-118660751 GTCTCCTGTGAGGACAGAGCAGG + Exonic
1090258437 11:125302208-125302230 GCAGGCAAAGAGAACAGAGCAGG + Intronic
1090781158 11:130007832-130007854 GGCTTCAGAGGGAACAGGGCGGG + Intergenic
1091205575 11:133818621-133818643 ACCTCCAAAGAGAACGGATCTGG - Intergenic
1091239474 11:134042879-134042901 GCCTTCACAGAGAACAGGACAGG + Intergenic
1091359468 11:134964168-134964190 GCCTCCTGAGAGAATAAATCTGG + Intergenic
1091718729 12:2797045-2797067 GCCTCCAGAGGGAACATAAAGGG - Intronic
1091834316 12:3574866-3574888 GAGTCCAGGGAGAAAAGAGCAGG + Intronic
1092775822 12:11944461-11944483 GAGTCCAGAGAGAAGAGAACTGG + Intergenic
1095090483 12:38099713-38099735 GCACCCCGAGAGAAGAGAGCAGG + Intergenic
1096712632 12:53468619-53468641 GCCTCCAAAGAGGAAAGAGTGGG - Intronic
1096805907 12:54141025-54141047 CCCTCCACAGAGGCCAGAGCAGG + Intergenic
1097277268 12:57822058-57822080 GCCTCCAGGGAACACAGAGATGG + Exonic
1099307949 12:80981706-80981728 GCCTCCTGTGAGATCAGTGCAGG + Intronic
1100892405 12:99140548-99140570 GCCTACTGAAAGCACAGAGCTGG + Intronic
1101606933 12:106254166-106254188 TCCTCCAGAGAGAACACTGGAGG - Intronic
1103329952 12:120147277-120147299 ACATCCAAAGAGAAGAGAGCTGG + Intronic
1103414865 12:120737213-120737235 GTCTCCAGAGAGATCAGGGCTGG - Intronic
1103704895 12:122866106-122866128 CCCTTCAGAGAAAGCAGAGCCGG + Exonic
1103883007 12:124180831-124180853 GCCTCAAGAGAAACCAGACCTGG + Intronic
1103907542 12:124335279-124335301 GCCTGCAGGCAGAGCAGAGCTGG + Exonic
1105673839 13:22648695-22648717 TCCACCACAGAGAGCAGAGCAGG - Intergenic
1105707507 13:22977270-22977292 CCCTCCTGAGGGCACAGAGCAGG - Intergenic
1105899071 13:24741227-24741249 CTCTCCAGGGGGAACAGAGCTGG - Intergenic
1106109692 13:26765987-26766009 GCCTGCTGTGAGGACAGAGCAGG + Intergenic
1106449558 13:29867871-29867893 GCATCCAAACAGGACAGAGCTGG - Intergenic
1107766798 13:43744175-43744197 GCCTCCACAGAGAACAGGAATGG + Intronic
1109692428 13:65910290-65910312 GACTCCACAGAGAACAGAGAGGG - Intergenic
1110048420 13:70860693-70860715 GTCTCTAGACAGCACAGAGCTGG + Intergenic
1110063589 13:71071844-71071866 GCTCCCAGAGAGTAAAGAGCAGG + Intergenic
1110164647 13:72425584-72425606 GCCACCACACAGAACAGAGGAGG + Intergenic
1110250011 13:73370925-73370947 CTCTCCAGTTAGAACAGAGCAGG + Intergenic
1111615734 13:90659358-90659380 GCTTCCAGAGGAAAGAGAGCTGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1112460683 13:99601290-99601312 GCAGGCAGAGAGAACACAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118180412 14:63486750-63486772 GCCTTCAGAGTTAACAGACCAGG - Intronic
1118892742 14:69923519-69923541 GCACTGAGAGAGAACAGAGCAGG - Intronic
1119665088 14:76479763-76479785 ACCTCCAGAGAGCAGAGAGAAGG + Intronic
1119689049 14:76656310-76656332 GGCTCCTGAGGGAAAAGAGCAGG + Intergenic
1120280264 14:82430044-82430066 GCCTACATAGAAAACAGAGCAGG + Intergenic
1120929568 14:89835188-89835210 GCTGCCTGAGAGAACACAGCAGG + Intronic
1121443781 14:93965920-93965942 GGCCCCAGAGAGAACACACCCGG + Intronic
1121535038 14:94685386-94685408 GTCTGAAGAGAGCACAGAGCGGG + Intergenic
1122270003 14:100564772-100564794 GGCACCCCAGAGAACAGAGCCGG - Intronic
1122896486 14:104760105-104760127 GACTCCAGAGGGAGCACAGCTGG - Intronic
1125631376 15:41150257-41150279 GCCTCCAGAGTAAATTGAGCAGG - Intergenic
1125675506 15:41500388-41500410 GCCTGGAGAAAGAACAGGGCTGG - Intronic
1128541667 15:68539173-68539195 GCCTGCTGAGAGAACAGTGAGGG + Intergenic
1130051280 15:80486013-80486035 GCCTCCAGAAATAACTGACCTGG - Intronic
1130658023 15:85806199-85806221 GGCGACAGAGTGAACAGAGCAGG + Intergenic
1131477615 15:92753661-92753683 GCCTGTAGAGAGAACAGTTCTGG - Intronic
1131800791 15:96067627-96067649 GCCTGCAGAGATCACAGGGCAGG - Intergenic
1132350490 15:101136813-101136835 GCATCCAGAGAGAGAGGAGCTGG + Intergenic
1132622183 16:873021-873043 GGCTCCAGAGAGCACAGATCTGG + Intronic
1134113415 16:11530541-11530563 GCTGCCAGAGCTAACAGAGCAGG - Intergenic
1134156109 16:11844607-11844629 GTCTCCAGGTAGAGCAGAGCAGG - Intronic
1134875864 16:17698010-17698032 CCCTCCAGAGAGAACTGGGGAGG + Intergenic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1135956419 16:26960025-26960047 GAATCCAGAGAGCAAAGAGCTGG - Intergenic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138563094 16:57813763-57813785 GCCTTCAGAGGGAAGAGAACCGG + Intronic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1142504846 17:356800-356822 GCCTCGAAAGAGAGCAGTGCCGG - Intronic
1142614003 17:1124697-1124719 CCTTCCAGAGTGAACAGAGGAGG + Intronic
1145755049 17:27384336-27384358 GCCTGCACTGAGACCAGAGCCGG - Intergenic
1145822702 17:27852009-27852031 GCCTCCTGTTAGAACATAGCAGG + Intronic
1146927024 17:36752207-36752229 GCCACTAAAGACAACAGAGCCGG - Intergenic
1147451366 17:40506844-40506866 GGATCAAGAGAGAACAGAGCAGG + Intergenic
1147741680 17:42673903-42673925 GCCTCCAGAGTGCACTGAGGGGG + Intronic
1148455460 17:47808798-47808820 CCCTCCACAGAGTACAGAGCTGG - Intronic
1150145781 17:62767957-62767979 GCCTCCACAGAGAAAATATCTGG + Intronic
1150206368 17:63411705-63411727 GCCTCAAGAGAGCAGAGAGAGGG + Intronic
1150329989 17:64286819-64286841 TCCTCCAGTGGGAACACAGCAGG + Intergenic
1150431690 17:65123280-65123302 GCCTCCCGTGAGCCCAGAGCAGG + Intergenic
1150676128 17:67246397-67246419 GCCTCCAAAGACAGCAAAGCAGG - Intergenic
1152101001 17:78301742-78301764 GCCCCCAGAGACAACAGGACAGG - Intergenic
1152213996 17:79021756-79021778 GCCTCAAGGTAGGACAGAGCCGG + Intergenic
1152347776 17:79764056-79764078 GCCTCCAGAGAGAACCAACTCGG + Intergenic
1152521315 17:80858407-80858429 CCCGTCAGAGAGGACAGAGCTGG - Intronic
1152550994 17:81030147-81030169 CCTTCCAGAGAGCACAGAGTGGG - Intergenic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1156622939 18:38874239-38874261 GCCCCCTGAGTGGACAGAGCTGG - Intergenic
1157392088 18:47311379-47311401 GCCTCCAGAGGAAACATGGCCGG - Intergenic
1158747387 18:60217198-60217220 GAGAACAGAGAGAACAGAGCTGG + Intergenic
1159902553 18:74061051-74061073 CCCTCCACAGAGAACAGAACTGG + Intergenic
1160863301 19:1246648-1246670 GCTTCCAGTGAGAACAAAGGTGG - Intergenic
1160878609 19:1309473-1309495 GCCTCCAGGGAGAGCAGCACAGG + Intergenic
1161560164 19:4968841-4968863 CCCTCCAATGAGAACAGAGCCGG + Intergenic
1162671461 19:12261050-12261072 GTCTCTAGGGAGAACAGGGCAGG + Intronic
1163030991 19:14544077-14544099 GGATCCACAGAGGACAGAGCTGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164074150 19:21798424-21798446 GTATCCAGAGAAAATAGAGCAGG + Intergenic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1165502599 19:36202005-36202027 GAATCCAGAGAAATCAGAGCAGG - Exonic
1167742504 19:51332609-51332631 GCCTACAGAGACAACTGAACTGG + Exonic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168072325 19:53959983-53960005 GCTGCCAGGGAGAAGAGAGCTGG - Intergenic
1168105414 19:54163104-54163126 GATTCCAGAGAGAGAAGAGCAGG + Exonic
1168324104 19:55529590-55529612 GCCTGCAGAGAGGAGAGAGGAGG + Intergenic
925096247 2:1206389-1206411 GACTGCAGAGAGCAAAGAGCTGG + Intronic
926760194 2:16271694-16271716 ACCTCCAGAGAGAACCCAGCAGG + Intergenic
927201210 2:20579171-20579193 GTGTCCAGAGAGAACAAAGCGGG + Intronic
929555016 2:42920709-42920731 GGCTCCAGAGAGAACAGGATTGG + Intergenic
930818914 2:55626054-55626076 GCCTACAAAGAAAGCAGAGCTGG + Intergenic
931118332 2:59188900-59188922 GACACCAAAAAGAACAGAGCAGG - Intergenic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
931933697 2:67170906-67170928 GGCTCCAGAGAAAGCAGAGGAGG + Intergenic
932618726 2:73252958-73252980 GCCTCCAGTAAGAAGAGAGTGGG - Exonic
933711070 2:85326662-85326684 GCCTCCAGTGAGAACCGTGAAGG - Exonic
933863853 2:86498349-86498371 GGTTCCAGAGGGAACAAAGCAGG - Intergenic
935414359 2:102799890-102799912 GCCTCGGGAGAGAACAGGACTGG + Intronic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
937291646 2:120785545-120785567 GGCTCCAGGGAGAACCGGGCTGG - Intronic
937905999 2:127053113-127053135 GCCTCCAGACAGAAGTGGGCCGG - Intronic
939814676 2:146879414-146879436 TCCTCCAGAGAGAAGAAAGAAGG + Intergenic
941842854 2:170106505-170106527 GTCTCCACAGAGAATAGAGCAGG + Intergenic
942930325 2:181484446-181484468 GGCTCCAGGGAGAACAGACAAGG - Intronic
944518016 2:200531784-200531806 GCCTCCAGAGAGAGTGCAGCTGG - Intronic
945048416 2:205801503-205801525 GCCTCCAGAGAGAACATGAGAGG - Intergenic
945924208 2:215787290-215787312 GACTCCAGAGAGAAGCAAGCTGG + Intergenic
948026596 2:234782907-234782929 GCTTCCAGAAGGAACACAGCCGG + Intergenic
948265374 2:236632033-236632055 GCCTGCAGGGAGAAGAGAGCGGG + Intergenic
948594089 2:239068307-239068329 GGCCCCAGAGAGCCCAGAGCAGG - Intronic
948654917 2:239470682-239470704 ACCCCCAGGGAGCACAGAGCTGG + Intergenic
948764039 2:240210464-240210486 CCCTCCATAGAGAACGGGGCTGG - Intergenic
1169327035 20:4684755-4684777 GCCTGCAGGGAGGACAGAGCTGG - Intergenic
1170168438 20:13384883-13384905 ACCTTCAGAGGGAACAGAGGTGG - Intergenic
1170651358 20:18245490-18245512 GGCTCCAGAAAGGACAGAGCTGG - Intergenic
1170870354 20:20200292-20200314 GCTGACAGAGAAAACAGAGCTGG + Intronic
1170871798 20:20212853-20212875 GTCCCCACAGAGCACAGAGCTGG - Intronic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1172123482 20:32611883-32611905 GCCTCCTCTGTGAACAGAGCTGG - Intergenic
1172893522 20:38283733-38283755 GGCTCCAGAGAGATCTGAGCTGG + Intronic
1173810171 20:45950594-45950616 GCCTGCAGAGAGGGCAGAGTTGG + Exonic
1174286958 20:49480676-49480698 GCCTTCAGTGAGAACTGAGCCGG + Intronic
1176039712 20:63058939-63058961 GGCTCCAGAGCGCACAGAGGTGG + Intergenic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176675758 21:9775694-9775716 GCCTCCATAGAGAGAAGAGATGG - Intergenic
1178083310 21:29088117-29088139 CACTCAAGAGAGAGCAGAGCTGG + Intronic
1178619068 21:34158547-34158569 CCCTCCAGACAGCCCAGAGCAGG - Intergenic
1178812993 21:35900660-35900682 GCCTCTTGTGAGAACAGGGCTGG - Intronic
1179006167 21:37517289-37517311 GCCTCCCATGCGAACAGAGCTGG - Intronic
1179915721 21:44476903-44476925 TTATCCAGAGAGAACAGAGGAGG - Intergenic
1180257126 21:46638022-46638044 GCCTCTAGAGAGAGAAGAGGAGG - Intronic
1182296943 22:29315495-29315517 AGCTCGAGAGAGAGCAGAGCCGG + Exonic
1182473864 22:30565171-30565193 GCCTGCAGAGAGCCCAGAACAGG + Intronic
1182621066 22:31618871-31618893 GGCACCAGAGTGAACAGGGCAGG - Exonic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1183633664 22:39048002-39048024 GCCTCCACTGTGAACAGAGGAGG + Intronic
1184010314 22:41743055-41743077 GCATCCAGAGAGACAAAAGCAGG - Intronic
1184461735 22:44641592-44641614 TCCTCCAGACAGACCAGAGGGGG + Intergenic
1184699809 22:46163078-46163100 GCCTGCAGAGGGGAAAGAGCGGG + Intronic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
949862244 3:8516277-8516299 CCCTCCTGAGAGACAAGAGCCGG + Intronic
952140062 3:30468296-30468318 TTCTCCAGAGACTACAGAGCAGG - Intergenic
952254893 3:31686814-31686836 GCCCCCAGAGAGCACAGTGATGG - Intronic
952710202 3:36423573-36423595 GCATACAGACAGAACAGTGCTGG + Intronic
952832413 3:37576167-37576189 TCCTCCAGGGAGGACATAGCTGG + Intronic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
953983892 3:47426888-47426910 GGCTCAAGAGAGACCAGAGGAGG + Intronic
954382742 3:50228107-50228129 GTCTCCGGGGAGAAGAGAGCTGG - Intronic
954930930 3:54280692-54280714 GGCACAAGAGAGAACAGAGTCGG - Intronic
955724669 3:61920247-61920269 GTCTCCAGAAGGCACAGAGCTGG - Intronic
955735276 3:62032153-62032175 GCCTGCAGAGAACACAGAGTTGG + Intronic
957373328 3:79324687-79324709 AACTCAAGAGAGAACAGACCAGG + Intronic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
959455137 3:106550469-106550491 TGCTCCACTGAGAACAGAGCAGG - Intergenic
960036218 3:113105331-113105353 GGCACCAGAGAGAACAGCCCTGG + Intergenic
961091460 3:124116126-124116148 GCCACCAGAGGGAAGAGAGCTGG - Intronic
961795190 3:129403942-129403964 GCCTCCTTAGAGAACAGGGCTGG - Intronic
964418152 3:156471823-156471845 GCATCCAGAGAGGAAAAAGCAGG + Intronic
964446430 3:156764092-156764114 GCCTGCCTAGAGAACACAGCAGG - Intergenic
966366235 3:179190683-179190705 GCCTCCAGAGGAGACAGAGACGG - Intronic
967497119 3:190154393-190154415 GGCCTCACAGAGAACAGAGCTGG + Intergenic
968041415 3:195592250-195592272 GCCTCGAGAGAGAAAGGAGAAGG + Intergenic
968462785 4:733574-733596 GCCCCCAGGGAGGACAGTGCAGG - Intronic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
968911072 4:3477260-3477282 CCCTCCAGAGAGAAGAGAGGAGG - Intronic
969296471 4:6273127-6273149 CCCCCCAGAGAGAACAGAATGGG + Intronic
969314715 4:6374824-6374846 GCCTCCAGTGTGAACTGCGCAGG + Intronic
969343218 4:6555533-6555555 GCCTCCAGACAACACACAGCAGG - Intronic
969444329 4:7235513-7235535 GACTGCAGAGAACACAGAGCGGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970176010 4:13340054-13340076 GCCTTCAAAGAGAAAAGAGTCGG - Intergenic
971264931 4:25088865-25088887 GCCTCCTGAGCGAGCAGCGCCGG - Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979626938 4:122855561-122855583 GCCTCCTCAGACAACAGAGCAGG + Intronic
982971378 4:161992246-161992268 GTCTCCAGGGAGAAAAGTGCAGG + Intronic
983374253 4:166903509-166903531 GCCTCCAGTGAAAAGAAAGCGGG - Intronic
984702084 4:182825083-182825105 CACTCCACAGAGAACAGACCTGG - Intergenic
985399777 4:189582994-189583016 GCCTCCATAGAGAGAAGAGATGG + Intergenic
985989800 5:3546462-3546484 GCCTCCACAGGAAACAGTGCTGG + Intergenic
986065315 5:4229273-4229295 GCATCCAGAGAGAAGTGACCTGG - Intergenic
986648372 5:9940393-9940415 GCTTCCAGAGAACACAGACCTGG + Intergenic
988586554 5:32512154-32512176 TCCTGGGGAGAGAACAGAGCAGG + Intergenic
988589495 5:32536494-32536516 GCCTCCTGTCAGATCAGAGCTGG + Intronic
989041213 5:37231664-37231686 GCCTGCAGAGAGGACAGATGTGG - Intronic
990515129 5:56523977-56523999 GCCTCCAGATATAACTGAGCAGG + Intronic
992098445 5:73382604-73382626 GCCTCCAGAGGGAACAGGCCTGG + Intergenic
997580568 5:135014286-135014308 GCTTTCAGAGAGCAGAGAGCTGG + Intergenic
998380455 5:141721273-141721295 GGCTCCAGAGTGAAGAAAGCAGG - Intergenic
998454800 5:142263529-142263551 GCTTCCAGAGAGCACATAGCAGG - Intergenic
999316844 5:150589835-150589857 CACTACAGAGAGCACAGAGCTGG - Intergenic
1000025409 5:157354735-157354757 GCCTCCAAAGTGAACCGAGTGGG + Intronic
1000408405 5:160913203-160913225 GGCTGCAGAAAGCACAGAGCTGG - Intergenic
1001343551 5:170869175-170869197 ACCTCAAGACAGAACAGACCTGG - Intronic
1001702064 5:173713858-173713880 GTCTGGAGAGAGAACAGGGCTGG + Intergenic
1002783668 6:385178-385200 GCATCTAGAAAGGACAGAGCAGG + Intergenic
1002824871 6:763614-763636 GCCTTCAGAGGGAGCACAGCAGG + Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006676924 6:35771289-35771311 GTCTCCAGAGGGGACATAGCAGG - Intergenic
1007070900 6:39037602-39037624 GCTTCCAGAGAAAGCAGACCAGG - Intergenic
1007087291 6:39157738-39157760 GCCTCCAGTGACAACTGTGCAGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1015539482 6:134299498-134299520 GCTTCCTGAGAGATCAGAGGTGG + Intronic
1016299802 6:142618004-142618026 TAGTCCAGAGAGAACAGATCCGG + Intergenic
1016984141 6:149881677-149881699 GCCTCCAGTGAGAACAGAGTGGG - Intergenic
1017331408 6:153201983-153202005 GTCTCCAGAGAGAAATGAACTGG - Intergenic
1019670307 7:2274459-2274481 ACCACCAGTGAGATCAGAGCTGG + Intronic
1020112667 7:5456272-5456294 GCCTCCTGAGAGCCCAGGGCAGG - Intronic
1020212618 7:6167475-6167497 CCCTCCAGAGACTCCAGAGCAGG + Intronic
1020649334 7:10855544-10855566 CCCTCCAGAGAGCCCAGACCTGG + Intergenic
1022008896 7:26292057-26292079 TCCTCCGGGCAGAACAGAGCAGG - Exonic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1022129154 7:27387981-27388003 CCCTTCAGAGAGTACTGAGCTGG - Intergenic
1023142032 7:37111145-37111167 GCCTGCAGAGAACGCAGAGCTGG - Intronic
1023393514 7:39732334-39732356 TCCTCCAGAAAGAACGGGGCTGG - Intergenic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1025078329 7:55962572-55962594 GCCACCAGGGAGGACAGAGGTGG - Intronic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1027878751 7:83804431-83804453 GCCTCCAGAGACACCAAACCTGG - Intergenic
1029820949 7:103146644-103146666 GCCTCCAGAGCCAACAGCACTGG + Intronic
1031592614 7:123611623-123611645 GGCTCCATAGAGAACTGAACTGG + Intronic
1031592642 7:123612007-123612029 GGCTCCATAAAGAACTGAGCTGG - Intronic
1032777628 7:135130198-135130220 TCCTCCAGAGAGAACTGACTTGG - Intronic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1033728263 7:144145439-144145461 GCCTGCAGTGAGAACAGGGTTGG - Intergenic
1034892443 7:154853163-154853185 ACCTGCAGAGAAAACAGATCAGG + Intronic
1035081337 7:156219101-156219123 GTCTGCAGAGAGCACAGAGCAGG + Intergenic
1035081360 7:156219205-156219227 GTCTGCAGGGAGCACAGAGCAGG + Intergenic
1035309388 7:157955561-157955583 GCTTCCAGACAGCACACAGCAGG + Intronic
1035726843 8:1830093-1830115 GTCTGCAGACAGAACGGAGCGGG - Intronic
1036142938 8:6225176-6225198 GACGCCAGATAGAAGAGAGCAGG - Intergenic
1036238379 8:7062152-7062174 TCCTCCAGATATCACAGAGCTGG + Intergenic
1036463299 8:8973434-8973456 GCCTCCAGAGAGTTGTGAGCTGG + Intergenic
1036473128 8:9068727-9068749 GCTTCCTGAGAGCAGAGAGCTGG + Intronic
1037510336 8:19576084-19576106 GCCTGCACAGAGAACAGGGATGG - Intronic
1037648522 8:20815740-20815762 GCCTCCTTAGAGATAAGAGCTGG + Intergenic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1038779936 8:30561642-30561664 GCCCCCAGAGAGTGGAGAGCGGG + Intronic
1039057673 8:33549491-33549513 TGCTGCAGAGAGAAAAGAGCAGG + Exonic
1039078424 8:33713112-33713134 GCTTCCCAAGAGAACAAAGCAGG - Intergenic
1040660219 8:49564766-49564788 GCCTACAGAGGGCACAGAGAAGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1042702915 8:71636547-71636569 AATTCCAGAGAGAAAAGAGCTGG - Intergenic
1044659237 8:94579053-94579075 ACCTGCAAAGAGAACAGAGGAGG + Intergenic
1045356522 8:101394377-101394399 GGCTCCTGGGAGAACAGAGGTGG - Intergenic
1045364144 8:101460155-101460177 GCCTCGAGATCCAACAGAGCTGG + Intergenic
1045372592 8:101539512-101539534 GCCTCCAGAAAGAACTAAGAAGG - Intronic
1046797499 8:118388841-118388863 GCCAACAGAGAGACCAGAGCTGG + Intronic
1047692008 8:127365568-127365590 TCCTCCAGAGCCAACAGAGTAGG + Intergenic
1048208070 8:132431444-132431466 ACCTCCCTAGAGACCAGAGCTGG - Intronic
1048234462 8:132675891-132675913 GCTTCCAGAGCCAACAGATCTGG + Intergenic
1048849744 8:138633430-138633452 GCTTCCAGTGAGAACAGATCAGG + Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049107728 8:140624206-140624228 GGCTCCAGAGGGGGCAGAGCCGG - Intronic
1052315232 9:27109604-27109626 GACTCCACAGAGAACTAAGCTGG - Exonic
1052735404 9:32337103-32337125 GCCACCAGAGAGGAAAGAACAGG + Intergenic
1053221453 9:36316340-36316362 GCCCACAGACAGAACAGAGAGGG + Intergenic
1053392992 9:37749478-37749500 GCCTCCAAAGAGAACAGATAAGG + Intronic
1053536155 9:38928248-38928270 GCCTCCATTGGGAACACAGCTGG - Intergenic
1054629980 9:67435704-67435726 GCCTCCATTGGGAACACAGCTGG + Intergenic
1057483180 9:95461751-95461773 GTCTCCAGAGAGCACAGGGTGGG + Intronic
1057514866 9:95712563-95712585 GGCTCCAGGGAGAACAAAGAAGG + Intergenic
1057633809 9:96743535-96743557 GCCACCAGCAAGAACAGAGCTGG - Intergenic
1059687542 9:116651779-116651801 CTCTCCAGAGACCACAGAGCTGG - Exonic
1060505918 9:124198450-124198472 GCCTCCAGTAAGAAGAGAGTAGG - Intergenic
1060552552 9:124492474-124492496 GGCTCCAGAGAGCTCAGAGTCGG - Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061237635 9:129351853-129351875 GGCCCCAGAGAGAAAAGACCAGG - Intergenic
1061520963 9:131117592-131117614 GCCTCCAAAGAGAGCAGGGAGGG + Intronic
1061651923 9:132057462-132057484 CCTTCAAGAGGGAACAGAGCTGG + Intronic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062562194 9:137146576-137146598 GGCTGCAGAGAGATCAGAGCTGG + Intronic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1186350354 X:8732799-8732821 GTCTCCAGGGAAAACAGTGCGGG - Intergenic
1187055702 X:15739540-15739562 GGCTCCAGGGAGAAGAGGGCAGG - Intronic
1187756954 X:22538790-22538812 GCCTTCAGTGGCAACAGAGCAGG - Intergenic
1188586526 X:31782761-31782783 TCCAGCAGAGAGAACACAGCTGG + Intronic
1189129102 X:38479957-38479979 TGCTCCAGAGAGGGCAGAGCTGG - Intronic
1189328998 X:40131274-40131296 ACCTCCTGAGAGAGCTGAGCTGG + Intronic
1189582055 X:42416414-42416436 GCCTCCAGAGAGAACTCTGCAGG - Intergenic
1191025615 X:55909748-55909770 GCATGCAGAGAGGAAAGAGCAGG + Intergenic
1192636402 X:72823720-72823742 GCCACCAGAGGGAACAGAACAGG - Intronic
1192645312 X:72897094-72897116 GCCACCAGAGGGAACAGAACAGG + Intronic
1195238002 X:102920798-102920820 GCCTGCATAGAGAACAAAGTGGG - Intergenic
1197324451 X:125074758-125074780 GCCTGGAGAGAGAATAGACCTGG - Intergenic
1198028854 X:132735640-132735662 GCATCCAGAGAAAGCAGAACTGG - Intronic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199773572 X:150991190-150991212 GGCTCCACAGAAAACTGAGCTGG - Intergenic
1200110219 X:153737136-153737158 GCCTGCAGAGACAGCACAGCGGG - Exonic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic