ID: 1137614945

View in Genome Browser
Species Human (GRCh38)
Location 16:49840902-49840924
Sequence GGCCAGGAAGCCCCTTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 2, 2: 4, 3: 31, 4: 570}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137614940_1137614945 -7 Left 1137614940 16:49840886-49840908 CCGCTTCCCTGAGCCTGGCCAGG 0: 1
1: 0
2: 2
3: 67
4: 601
Right 1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG 0: 1
1: 2
2: 4
3: 31
4: 570
1137614936_1137614945 5 Left 1137614936 16:49840874-49840896 CCTCCCACACAGCCGCTTCCCTG 0: 1
1: 0
2: 3
3: 40
4: 479
Right 1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG 0: 1
1: 2
2: 4
3: 31
4: 570
1137614935_1137614945 6 Left 1137614935 16:49840873-49840895 CCCTCCCACACAGCCGCTTCCCT 0: 1
1: 0
2: 4
3: 62
4: 439
Right 1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG 0: 1
1: 2
2: 4
3: 31
4: 570
1137614938_1137614945 1 Left 1137614938 16:49840878-49840900 CCACACAGCCGCTTCCCTGAGCC 0: 1
1: 0
2: 1
3: 29
4: 409
Right 1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG 0: 1
1: 2
2: 4
3: 31
4: 570
1137614937_1137614945 2 Left 1137614937 16:49840877-49840899 CCCACACAGCCGCTTCCCTGAGC 0: 1
1: 0
2: 2
3: 25
4: 208
Right 1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG 0: 1
1: 2
2: 4
3: 31
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137614945 Original CRISPR GGCCAGGAAGCCCCTTGAGA AGG Intronic
900364778 1:2306657-2306679 GGCCCGGGAGCACCTGGAGAAGG + Exonic
902517058 1:16995205-16995227 GTCAAGGAAGCCCCCTGAGCAGG - Intronic
902622611 1:17659259-17659281 GGCCAAGGAGGCCCCTGAGAAGG + Intronic
902715635 1:18270689-18270711 GGGCAGGAAGCCCATTGTCACGG - Intronic
902720675 1:18302120-18302142 GGCCAGGCAGCCCCTGAAGAAGG - Intronic
905325267 1:37147323-37147345 TTCAAGGAAGCCCCTTGAGGGGG + Intergenic
905800072 1:40837695-40837717 GGACAGGAAGGCCCGGGAGAAGG + Exonic
906753689 1:48289043-48289065 GGTCAGGAACCCACTTGAGGTGG - Intergenic
906960100 1:50415101-50415123 GGCCAGGAAGAGCCTAGAGCCGG - Intergenic
907415736 1:54312738-54312760 GGCCTGGTAGCCCCCTGACATGG - Intronic
907436016 1:54448711-54448733 GGTCAGGGAGCCACTTGAGGAGG + Intergenic
908128061 1:61050238-61050260 GGCCCGCCAGCCCCTGGAGAGGG - Intronic
908171603 1:61510716-61510738 TGGCAGGATGCCCCATGAGAGGG + Intergenic
908585536 1:65563876-65563898 GGTCAGGAACCCACTTGAGGAGG + Intronic
908813496 1:68008543-68008565 GGCCAGGGACCCACTTGAGGAGG + Intergenic
909403359 1:75258691-75258713 GGTCAGGGACCCACTTGAGAAGG - Intronic
910177267 1:84443735-84443757 GGCCAGGGACCCACTTGAGGAGG - Intergenic
910799590 1:91131890-91131912 GGCCAGGGACCCACTTGAGGAGG - Intergenic
910940679 1:92530452-92530474 GGTCAGGAACCCACTTGAGGAGG - Intronic
910956908 1:92716153-92716175 GGTCAGGAACCCACTTGAGGAGG - Intronic
911147329 1:94565355-94565377 GTCCAAGAAGCCCCATGAGCAGG - Intergenic
911700742 1:100949464-100949486 GGTCAGGAACCCACTTGAGGAGG + Intronic
912463269 1:109851728-109851750 GGTCAGGGACCCACTTGAGAGGG - Intergenic
912499970 1:110115155-110115177 GGGCAGGAGGGCCCTTGGGATGG - Intergenic
912973319 1:114304674-114304696 GGTCAGGAACCCACTTGAGGAGG - Intergenic
913985642 1:143563422-143563444 GGTCAGGGACCCACTTGAGAAGG + Intergenic
914224351 1:145707821-145707843 GGCCAGTAAGCCCCAGGAAATGG + Intronic
914350162 1:146833514-146833536 AGCCTGGCAGCCCCCTGAGATGG - Intergenic
915652859 1:157331734-157331756 GGCCTGGAAGCCCCTGGGCAGGG + Intergenic
915758102 1:158282654-158282676 GGTCAGGGACCCACTTGAGAAGG + Intergenic
915814696 1:158953420-158953442 GGTCAGGGACCCCCTTGAGGAGG - Intronic
915872321 1:159574403-159574425 GGTCAGGGACCCACTTGAGAAGG + Intergenic
915992201 1:160529424-160529446 GGTCAGGAACCCACTTGAGGAGG + Intergenic
916334116 1:163650760-163650782 GCCTAAGAAGTCCCTTGAGATGG - Intergenic
917111727 1:171555872-171555894 GGCCAGGGACCCACTTGAGGAGG + Intronic
919387606 1:196941419-196941441 GGTCAGGGACCCACTTGAGAAGG + Intronic
919971575 1:202583597-202583619 TGTCTGGAAGCCCCATGAGATGG + Exonic
920986761 1:210897913-210897935 GGCTAGGAAGACTGTTGAGATGG + Intronic
920993115 1:210959370-210959392 GGCCAGGGACCCACTTGAGGAGG + Intronic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
922066272 1:222146440-222146462 GGTTAGGAACCCGCTTGAGAAGG - Intergenic
923194425 1:231651539-231651561 GGTCAGGGAGCCACTTGAGGAGG + Intronic
923672591 1:236053524-236053546 TGCCAGGAAGCTCTCTGAGAAGG - Intronic
1063243227 10:4192527-4192549 TGTCATGAAGGCCCTTGAGAGGG + Intergenic
1064162742 10:12959853-12959875 GGCCAGGAAACCCCTTAAAAAGG - Intronic
1064514486 10:16131499-16131521 GGACAGTAAGACCCCTGAGAAGG - Intergenic
1064905277 10:20339289-20339311 GGTCAGGGAGCCACTTGAGGAGG + Intergenic
1065594817 10:27299927-27299949 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1066140767 10:32501816-32501838 GGTCAGGGACCCACTTGAGAAGG + Intronic
1066168592 10:32816534-32816556 GGTCAGGAACCCACTTGAGGAGG - Intronic
1067199194 10:44151842-44151864 GGTCAGGGACCCTCTTGAGAAGG + Intergenic
1067339331 10:45388388-45388410 GGTCAGGGAGCCACTTGAGGGGG - Intronic
1068149301 10:53111940-53111962 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1068410360 10:56646411-56646433 GGTCAGGGACCCGCTTGAGAAGG + Intergenic
1068651649 10:59528882-59528904 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
1068910846 10:62376523-62376545 GGACAGGAAGCCATTTGAGGTGG + Exonic
1069120767 10:64566935-64566957 GGTCAGGGATCCACTTGAGAAGG + Intergenic
1070710809 10:78681938-78681960 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1070813812 10:79311330-79311352 GACCAGGAAGCCCCATGATGGGG + Intronic
1070943326 10:80366738-80366760 GGACACAAACCCCCTTGAGAAGG + Exonic
1071845760 10:89519556-89519578 GATCAGGAAGCCTCTTGAGAGGG + Intronic
1071900747 10:90118505-90118527 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1072123079 10:92420799-92420821 GGCGTGGAAGCCCCAGGAGAGGG + Intergenic
1072401824 10:95110737-95110759 GGCCAGGTACCCACTTGAGGAGG + Intergenic
1073784914 10:106878461-106878483 GGCAAGGCAGCCCCTTAATAAGG - Intronic
1074230058 10:111524725-111524747 GGCCAGGAAGCCTGTTGGCATGG - Intergenic
1074453463 10:113577985-113578007 GGCCAGGAAGGCTCTTCAGAAGG - Intronic
1075205684 10:120445752-120445774 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1076389865 10:130091084-130091106 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1076610884 10:131725372-131725394 GGCCAGGAAGGCCCCAGAGCTGG + Intergenic
1077713720 11:4560071-4560093 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1077798913 11:5518732-5518754 GGCCATGAAGGCCCCTGACAGGG + Intronic
1078321659 11:10340288-10340310 GGTCAGGGAGCCACTTGAGGAGG - Intronic
1078560454 11:12366636-12366658 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1078726719 11:13938808-13938830 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1081169303 11:39847338-39847360 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1081433750 11:43004812-43004834 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082009652 11:47441610-47441632 GGCCAGGAAGGCGCTGGACAAGG - Exonic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1083503408 11:63132756-63132778 GGCCAGGGACCCACTTGAGGAGG + Intronic
1083532418 11:63435986-63436008 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1083591222 11:63896143-63896165 GGCCAGGAAGCCCACTCAGGAGG - Intronic
1084416805 11:69037250-69037272 GGCCAAGAAGCACCTGGAGCAGG + Intergenic
1085162483 11:74361096-74361118 GGTCAGGAACCCACTTGAGGAGG - Intronic
1085433923 11:76481912-76481934 GGTCAGGAACCCACTTGAGGAGG - Intronic
1085445417 11:76597858-76597880 GGCAAGGAAGGCCCCTGGGAGGG - Intergenic
1085645535 11:78219911-78219933 GGCCTGGAAGTCCCTTCTGAAGG + Intronic
1085908946 11:80798462-80798484 GGTCAGGAACCCACTTAAGAAGG - Intergenic
1087718895 11:101639555-101639577 GGTCAGGAACCCACTTGAGGAGG - Intronic
1087868320 11:103261361-103261383 GGTCAGGGACCCACTTGAGAAGG - Intronic
1088138847 11:106591542-106591564 TTACAGGAAGCCCCTTGAAAGGG - Intergenic
1088300978 11:108357614-108357636 GGTCAGGAACCCACTTGAGGAGG - Intronic
1088381018 11:109192813-109192835 GGTCAGCAACCCACTTGAGAAGG + Intergenic
1089580781 11:119480947-119480969 GGCCATGAAGCCCCATGTCATGG + Intergenic
1089743151 11:120598958-120598980 GGCCAAGAAGCCCCATTTGAAGG + Intronic
1089888532 11:121855583-121855605 GGTCAGGAAGCCACTTGAGGAGG - Intergenic
1090216265 11:124968106-124968128 GGTCAGGAACCCACTTGAGGAGG + Intronic
1090799872 11:130163709-130163731 CTCCAGAAAGCCCCTGGAGAAGG - Intronic
1091185327 11:133641484-133641506 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1091417177 12:298210-298232 GGCCAGGGACCCACTTGAGGAGG - Intronic
1091584782 12:1809964-1809986 GGCCAGGCAGGGCCCTGAGATGG + Intronic
1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG + Intronic
1093344526 12:18024497-18024519 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1094423520 12:30296450-30296472 TGCCTGGAAGACCCTTGAGAGGG - Intergenic
1094710470 12:32956867-32956889 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1095066773 12:37787594-37787616 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1096941913 12:55355893-55355915 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
1097828252 12:64196269-64196291 GGTCAGGAACCCACTTGAGGAGG - Intronic
1098015490 12:66100173-66100195 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
1098152325 12:67559650-67559672 AGAAAGGAAGCCCCTTAAGAAGG + Intergenic
1098375601 12:69810341-69810363 GGTCAGGGAGCCACTTGAGGAGG + Intronic
1099514857 12:83584950-83584972 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1101636893 12:106551361-106551383 GGTCAGGTAGCCGCTTGAGGAGG + Intronic
1102798088 12:115706814-115706836 GGCCATGAAGCCACTGGGGAAGG + Intergenic
1103713090 12:122927705-122927727 GGCCAGGAAGCCCCTTGCGAGGG + Intronic
1104105795 12:125657780-125657802 CACCAGCAAGCCTCTTGAGAAGG + Exonic
1104274843 12:127317178-127317200 CACCAGCAAGCCTCTTGAGAGGG - Intergenic
1105928971 13:25034194-25034216 GGCCAGGAGGACCATTGAGGAGG + Intergenic
1106025869 13:25954522-25954544 GGTCAGGAATCCACTTGAGGAGG - Intronic
1106335955 13:28783655-28783677 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1106358740 13:29010464-29010486 GGAAAGGGAGACCCTTGAGATGG - Intronic
1106655722 13:31744019-31744041 ATCCAGGAAGCCCCTGGGGAGGG - Intronic
1106948480 13:34855227-34855249 TGCCATGAAGACCCTTGAGCAGG - Intergenic
1108224142 13:48270223-48270245 GGCCAGGAAGGCCCCTAAGAGGG - Exonic
1108547946 13:51515143-51515165 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1109294847 13:60517606-60517628 GGCTGGGAAGCCCATAGAGATGG - Intronic
1109331829 13:60940661-60940683 GCCCAAGGAGCCCTTTGAGACGG - Intergenic
1111273496 13:85917228-85917250 GGTCAGGGATCCCCTTGAGGAGG + Intergenic
1113037264 13:106063802-106063824 GGCCAGCAAGCAGCCTGAGAAGG - Intergenic
1113877975 13:113606458-113606480 GGCCAGGGAGCCCCTTTATCAGG + Intronic
1115018078 14:28641101-28641123 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1115276996 14:31620757-31620779 GGTCAGGGACCCCCTTGAGTAGG + Intronic
1115635888 14:35290044-35290066 GGGCAGGAATTCGCTTGAGAGGG + Intronic
1115719793 14:36147985-36148007 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
1116511829 14:45756083-45756105 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1116546031 14:46166578-46166600 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1117104587 14:52384860-52384882 GGTCAGGGACCCTCTTGAGAAGG - Intergenic
1117635678 14:57740824-57740846 GGTCAGGAACCCACTTGAGGAGG - Intronic
1117850004 14:59958103-59958125 GGTCAGGAACCCACTTGAGCAGG + Intronic
1118316520 14:64729332-64729354 GGCCCAGCAGCCCCTTGAGGGGG - Intronic
1119607212 14:76030287-76030309 GGCCAGGGAGAACTTTGAGATGG + Intronic
1119775248 14:77244201-77244223 GGCCAGGAAAGCCAGTGAGAAGG + Intronic
1119991840 14:79207041-79207063 GGCCAGGAAGCAGCTGGGGAGGG - Intronic
1120675685 14:87418997-87419019 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1121021887 14:90585253-90585275 TGCCACGGAGCCCCTGGAGAAGG - Intronic
1121111037 14:91313340-91313362 GGACAGGAAGGCCCTGGAGCAGG - Exonic
1121226234 14:92323653-92323675 GGCGGGGGAGCCCCTTGGGAAGG - Exonic
1202876690 14_KI270722v1_random:9165-9187 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1124084263 15:26532019-26532041 GGTCAGCAACCCACTTGAGAAGG - Intergenic
1124186191 15:27531519-27531541 TGCCAGGAAGCCCACTGAGAAGG + Intronic
1124788295 15:32702180-32702202 GGCCAGAAAGCCCCGTGAGAAGG + Intergenic
1125227230 15:37408808-37408830 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1125352644 15:38783431-38783453 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1125515960 15:40321505-40321527 TGCCAGGAAGGCCCTAGAGCAGG + Intergenic
1126087011 15:45020551-45020573 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1126248741 15:46541697-46541719 GGTCAGGAACCCACTTGAGAAGG + Intergenic
1127157142 15:56139938-56139960 GGCCAGGGACCCACTTGAGGAGG + Intronic
1128379181 15:67098918-67098940 GGTCAGGCAGCCCATGGAGATGG + Intronic
1128395614 15:67222465-67222487 GGCCAGGATGTCAGTTGAGAGGG - Intronic
1129190983 15:73937488-73937510 GGCAGCGAAGACCCTTGAGATGG - Intronic
1130048263 15:80462656-80462678 GGCCAGGAAGCCCCTTGATAAGG - Intronic
1130353778 15:83112250-83112272 GGCCAGGAAATCCATGGAGAAGG - Intronic
1130546040 15:84858096-84858118 GGGCAGGCAGCCCCTGGACAGGG + Exonic
1131092822 15:89634996-89635018 GGTCAGGAACCCACTTGAGGAGG - Intronic
1131733935 15:95312119-95312141 GGGAAGGAAGCCCCTGGACAGGG + Intergenic
1133888013 16:9850050-9850072 TGGCAGAAAGGCCCTTGAGACGG - Intronic
1135069162 16:19337337-19337359 GGCCAAGAAGCCCCCCAAGAAGG + Intergenic
1137486397 16:48895075-48895097 GGGCAGAAAACCCCCTGAGAAGG + Intergenic
1137582289 16:49640760-49640782 TTCCAGGAGGCCCCTTGAGCTGG - Intronic
1137591791 16:49698305-49698327 GCCCAGGATGCCCCGTGAGCAGG - Intronic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1137713087 16:50580501-50580523 GGCCAGGGAACCCTTTGACAAGG - Intronic
1139339225 16:66257097-66257119 GGTCTGGAAGCCTCTTGGGAAGG - Intergenic
1139573727 16:67828677-67828699 GGAGAGGAAGGCTCTTGAGATGG - Exonic
1139983877 16:70882017-70882039 AGCCTGGCAGCCCCCTGAGATGG + Intronic
1141592861 16:85080131-85080153 TGTCAGGAAGGCCCTTGAGGAGG + Intronic
1142285688 16:89170648-89170670 GGTCAGGAAGGTCCTGGAGAGGG - Intergenic
1143316993 17:6040407-6040429 GGCCAGGCAGGCCAGTGAGAAGG + Intronic
1144578298 17:16443652-16443674 GGCCAGGAGGACCCTGGAGGGGG - Exonic
1144876537 17:18400083-18400105 GGCCAGGACCCAACTTGAGAGGG + Intergenic
1145155689 17:20544337-20544359 GGCCAGGACCCAACTTGAGAGGG - Intergenic
1146298487 17:31670366-31670388 GGTCAGGAGCCCCCTTGAGGAGG + Intergenic
1146440301 17:32887816-32887838 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1146528320 17:33585604-33585626 GGCCAGAAAGCCCCAGGAGTTGG + Intronic
1146561960 17:33877806-33877828 GGTCAGGAACCCACTTGAGGAGG - Intronic
1146766239 17:35524388-35524410 GGCCAGGGACCCACTTGAGGAGG - Intronic
1146843134 17:36168404-36168426 GGCCAGGACCCAACTTGAGAGGG - Intronic
1146855439 17:36256345-36256367 GGCCAGGACCCGACTTGAGAGGG - Intronic
1146865182 17:36332030-36332052 GGCCAGGACCCGACTTGAGAGGG + Intronic
1146871345 17:36380256-36380278 GGCCAGGACCCGACTTGAGAGGG - Intronic
1146882653 17:36452484-36452506 GGCCAGGACCCGACTTGAGAGGG - Intergenic
1147068041 17:37932624-37932646 GGCCAGGACCCGACTTGAGAGGG + Intronic
1147074231 17:37980880-37980902 GGCCAGGACCCGACTTGAGAGGG - Intronic
1147079572 17:38012179-38012201 GGCCAGGACCCGACTTGAGAGGG + Intronic
1147085753 17:38060418-38060440 GGCCAGGACCCGACTTGAGAGGG - Intronic
1147095513 17:38136121-38136143 GGCCAGGACCCGACTTGAGAGGG + Intergenic
1147101700 17:38184384-38184406 GGCCAGGACCCGACTTGAGAGGG - Intergenic
1149638629 17:58189484-58189506 GGCTGGAAAGCCCCTGGAGAGGG + Intergenic
1149846297 17:60010894-60010916 GGCCAGGACCCGACTTGAGAGGG - Intergenic
1150084647 17:62267469-62267491 GGCCAGGACCCGACTTGAGAGGG - Intergenic
1151192137 17:72406364-72406386 GGCCAGGAAACCCAGAGAGAAGG + Intergenic
1152124222 17:78436886-78436908 GGCCAGGAAGGCTGTGGAGAAGG + Intronic
1152521376 17:80858690-80858712 CGCCAGGAAGGGCCTTGAGGGGG + Intronic
1153685521 18:7541039-7541061 AGCCAGCAAGCCCCTTAGGAAGG - Intergenic
1153865573 18:9265323-9265345 GGTCAGGGACCCACTTGAGAAGG - Intronic
1154364115 18:13690451-13690473 GGTCAGGGACCCACTTGAGAAGG - Intronic
1155385002 18:25267442-25267464 GGTCAGGGACCCCCTTGAGGAGG - Intronic
1156471751 18:37381467-37381489 AGGCAGGAAGCTCCTTGAGGTGG + Intronic
1156590366 18:38481235-38481257 GGCCAGAAGACTCCTTGAGATGG + Intergenic
1157000349 18:43515294-43515316 GGCAAGGAAGCTCATCGAGATGG - Intergenic
1157211727 18:45748555-45748577 GGCCAGGGAGCTCCAGGAGAAGG - Intronic
1157336500 18:46742754-46742776 GGTCAGGGACCCCCTTGAGGAGG - Intronic
1157489631 18:48113712-48113734 AGCCGGAAAGCTCCTTGAGATGG - Intronic
1157632035 18:49107849-49107871 GGTCAGGGACCCACTTGAGAAGG + Intronic
1159099392 18:63941048-63941070 GGTCAGGAATCCACTTGAGGAGG - Intergenic
1160036960 18:75310389-75310411 GGCCTGGAAGGCCTTTGTGAGGG - Intergenic
1160753869 19:747779-747801 GGACAGGAAGCCTCTTGGGTTGG + Exonic
1160914179 19:1488959-1488981 GGCCAGGAAGTGCCTTGAACAGG - Intronic
1162015164 19:7841634-7841656 GTCCAGGACCCCCCTTCAGATGG + Intronic
1162362271 19:10227347-10227369 GGCCAGGATGCCCCTTGGAGGGG - Intronic
1163955349 19:20633228-20633250 GGTCAGGGACCCACTTGAGAAGG + Intronic
1164321574 19:24152999-24153021 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1164440120 19:28270390-28270412 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1165049136 19:33130604-33130626 GCCCAGGAAGCCCCATGGGAGGG + Intergenic
1165148978 19:33750069-33750091 GGCCTGGAAGGACCCTGAGAAGG + Intronic
1165332829 19:35150898-35150920 GGCCAGCAAGACCCTAGAGAAGG + Intronic
1165867381 19:38947030-38947052 GACAAGGCAGTCCCTTGAGAAGG - Intronic
1166369583 19:42293483-42293505 GCCCAGCAGACCCCTTGAGAAGG - Intronic
1167385130 19:49158368-49158390 GGCAAGGAACGCCCTTGGGAAGG - Intronic
1167949637 19:53015853-53015875 GGCAAGGAAGCCCCTGGGAAAGG + Exonic
1168302141 19:55411208-55411230 GGCAAGGAAGCCTCAGGAGATGG - Intergenic
1168527465 19:57100270-57100292 GGCCAGGGAGCCCCTTTAGATGG - Intergenic
924967684 2:92954-92976 GGTCAGGGACCCACTTGAGAAGG - Intergenic
925976924 2:9148204-9148226 GGTCAGGAAGCCCCCAGAGATGG - Intergenic
926534963 2:14099816-14099838 GGTCAGGAACCCACTTGAGGAGG - Intergenic
927354453 2:22157126-22157148 GGTCAGGGACCCACTTGAGAAGG - Intergenic
927845910 2:26472890-26472912 GGGCAGAAAGCCCCTTGCGCTGG - Intronic
927864261 2:26578680-26578702 GGACAGGTATCCTCTTGAGATGG + Intronic
928759110 2:34560754-34560776 GGCCAGGGACCCTCTTGAGGAGG + Intergenic
929838073 2:45426515-45426537 GGTCAGGAACCCACTTGAGGAGG - Intronic
931888869 2:66648039-66648061 GGCCAGGGACCCACTTGAGGAGG + Intergenic
933202476 2:79466576-79466598 GGCCAGGGACCCACTTGAGGAGG - Intronic
933574992 2:84057191-84057213 GGCCAAGAAACCCCTGCAGAAGG - Intergenic
936412109 2:112269048-112269070 GGGCAGGAAGCAGCTTGGGAAGG + Intergenic
936481140 2:112885857-112885879 TGCCCGGGAGCACCTTGAGAAGG - Intergenic
937898278 2:126995462-126995484 GGCCTGGAAGGCCCCTAAGAGGG - Intergenic
938156812 2:128948736-128948758 GGTCAGGAACCCACTTGAGGAGG + Intergenic
938520756 2:132068319-132068341 GGTCAGGGACCCACTTGAGAAGG + Intergenic
938568045 2:132538524-132538546 GGTCAGGAATCCACTTGAGGAGG + Intronic
939502687 2:143006725-143006747 GGTCAGGAACCCACTTGAGGAGG - Intronic
939782062 2:146461202-146461224 GGCCCAAAAGCCCCTTGAGTTGG - Intergenic
939994955 2:148911471-148911493 GGCCATGAAGCCCTTTAAGAAGG + Intronic
940054476 2:149499690-149499712 GGTCAGGAACCCACTTGAGGAGG + Intergenic
940401835 2:153256774-153256796 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
941239330 2:163017097-163017119 GGCCAGGGACCCACTTGAGGAGG + Intergenic
942639909 2:178050047-178050069 GGTCAGGAAGCCACTTTAGGAGG - Intronic
945677774 2:212876379-212876401 GGTCAGGGACCCACTTGAGAAGG - Intergenic
945953718 2:216065726-216065748 GGCCTGGAACACCCTTGAGTAGG + Intronic
948127153 2:235572580-235572602 GGGCAGGAAGCCCCTATAGGAGG - Intronic
948820914 2:240545178-240545200 GGTCAGGGACCCACTTGAGAAGG - Intronic
948999867 2:241607116-241607138 GGCCAGGAGACCCCTTTAGAAGG + Intronic
1168811551 20:707954-707976 GGCCTGGAAGCCACTTCTGAAGG + Intergenic
1169451577 20:5716455-5716477 TCCCAGGAAGCCCAGTGAGAGGG - Intergenic
1170167830 20:13380551-13380573 GGCCAGGGATCCACTTGAGGAGG + Intergenic
1170292060 20:14781735-14781757 TGCCAAGAAGCTCCTTGATATGG - Intronic
1170483585 20:16793280-16793302 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1170752807 20:19167128-19167150 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1172939706 20:38645964-38645986 GGCCACGATGACCCTGGAGAGGG + Intronic
1173186334 20:40843320-40843342 GGCAAGGATGCCCCTGGGGAGGG - Intergenic
1173418472 20:42879679-42879701 GGCCAGGACCACCCTGGAGACGG + Intronic
1173770479 20:45652132-45652154 GGTCAGGGACCCACTTGAGAAGG - Intronic
1175041011 20:56050557-56050579 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1176088569 20:63309039-63309061 TGCCAGGAAGCTCCTTGCCAGGG - Intronic
1176915599 21:14621822-14621844 GGTCAGGGACCCCCTTGAGGGGG - Intronic
1179217526 21:39380482-39380504 GGCCAGGCAGCCACTTACGAAGG - Exonic
1179272965 21:39865769-39865791 GGGCAGGAGGCCCCTGGGGAGGG + Intergenic
1179419331 21:41223002-41223024 GTCCAGGAAACATCTTGAGATGG - Intronic
1180043308 21:45291655-45291677 GGGCACAGAGCCCCTTGAGATGG + Intergenic
1180177927 21:46099013-46099035 GCCTAGGACGCCCCTGGAGAAGG + Intronic
1180421992 22:12874104-12874126 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1180627960 22:17207278-17207300 TGCAAGGCAGCCCCTGGAGAGGG + Exonic
1181107661 22:20584546-20584568 GGCCAGGAAGCCTCGTGGGCAGG - Intronic
1183188096 22:36304000-36304022 GGCCAGGTAGCCCCTGCAGCAGG + Exonic
1183189763 22:36314369-36314391 GGCCCAGACACCCCTTGAGAAGG + Intronic
1183336340 22:37249263-37249285 GACGAGGAGGCCCCTGGAGATGG - Intergenic
1183599568 22:38832161-38832183 GGCCAGGAAGGCCATGGAGGAGG + Intronic
1184671196 22:46013042-46013064 GGCCAGGAAGCCCCGAGAGGAGG - Intergenic
1184692734 22:46124563-46124585 GGCCAGGAAGCCTCTGGGGCTGG - Intergenic
1184887770 22:47356848-47356870 GGCCAGGAATCCCCAAGAGAAGG - Intergenic
1184935503 22:47717485-47717507 GTCCAAGAAGACCCTTGAGCAGG - Intergenic
949154334 3:810063-810085 GGTCAGGGACCCACTTGAGAAGG - Intergenic
949804040 3:7934852-7934874 GGCCAGGGACCCACTTGAGGAGG - Intergenic
950194257 3:10998192-10998214 CACCAGGTAGCCCCTTGAGAAGG + Intronic
950308546 3:11935775-11935797 GGCTAGGAAGCCCCCAGACATGG - Intergenic
950313058 3:11975766-11975788 TCCCAGGAAGCCCCTTGGTATGG - Intergenic
950585610 3:13890300-13890322 ACCCAGGAAGCCCCTGGAGCAGG + Intergenic
950591078 3:13935987-13936009 GGTCTGGCAGCCCCTTGAGAAGG + Intergenic
950597391 3:13996757-13996779 GGTCAGGGAGCCACTTGAGGAGG + Intronic
950712168 3:14820383-14820405 GGTCAGGCGGCCCCTGGAGAAGG + Exonic
952049202 3:29362491-29362513 GGTCAGGAACCCACTTGAGGAGG + Intronic
952837683 3:37618405-37618427 GGCCAGGGACCCACTTGAGGAGG + Intronic
953315923 3:41926014-41926036 GGTCAGGGACCCACTTGAGAAGG - Intronic
954070398 3:48138837-48138859 GGCCAAGAAGGCCTTTGAGCTGG + Intergenic
954613370 3:51957725-51957747 GGCCAGGAAGCCCTAAGGGATGG + Exonic
955428476 3:58816959-58816981 GGCCAGGGACCCACTTGAGGAGG - Intronic
957565458 3:81878809-81878831 GGTCAGGGACCCACTTGAGAAGG - Intergenic
957604104 3:82375742-82375764 GGTCAGGGACCCTCTTGAGAAGG + Intergenic
957727565 3:84087321-84087343 GGTCAGGGACCCACTTGAGAAGG - Intergenic
957948784 3:87097687-87097709 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
958011277 3:87882992-87883014 GGTCAGGAACCCACTTGAGGAGG - Intergenic
958037032 3:88182613-88182635 GGTCAGGAACCCACTTGAGGAGG - Intergenic
959567698 3:107849386-107849408 GGACAGGAAGACCCCAGAGAGGG + Intergenic
959650961 3:108750076-108750098 GGTCAGGAACCCACTTGAGGAGG - Intronic
959744410 3:109759961-109759983 GGTCAGGAACCCACTTGAGGAGG - Intergenic
959763954 3:110001821-110001843 GGCCAGGGACCCACTTGAGGAGG + Intergenic
959812639 3:110637346-110637368 GGTCAGGGAGCCACTTGAGGAGG + Intergenic
959910433 3:111758051-111758073 GGCCAGGGACCCACTTGAGGAGG + Intronic
960615978 3:119596403-119596425 AGCCAGGAAGCGCCTTTAGATGG - Intergenic
960850383 3:122047241-122047263 GGTCAGGGACCCACTTGAGAAGG + Intergenic
961484371 3:127206901-127206923 TGCCAGGAAGCCACTTGGCAAGG - Intergenic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
961806119 3:129490581-129490603 AGCTAGAAAGACCCTTGAGAGGG + Intronic
962341426 3:134587651-134587673 GGTCAGGAACCCACTTGAGGAGG + Intergenic
963485356 3:145928456-145928478 GGTCAGGAACCCACTTGAGGAGG - Intergenic
965030329 3:163357174-163357196 GGTCAGGGACCCACTTGAGAAGG + Intergenic
965402669 3:168231623-168231645 GGCCAGGAAGCCCCTAAACATGG - Intergenic
965621878 3:170650619-170650641 GGCCAGGGACCCACTTGAGGAGG + Intronic
965641029 3:170829193-170829215 GGCTAAGAAGCCCATTGAGCTGG + Intronic
966477616 3:180368020-180368042 GGTCAGGAACCCACTTGAGGAGG - Intergenic
966637851 3:182156182-182156204 GGTCAGGAACCCACTTGAGGAGG + Intergenic
967374241 3:188782902-188782924 GGCCAGGGCATCCCTTGAGAAGG - Intronic
967962990 3:194940262-194940284 CGCCAGGGAGGCGCTTGAGAGGG - Intergenic
968262542 3:197336786-197336808 GACTAGGAAGCTCTTTGAGAAGG - Intergenic
968619262 4:1596494-1596516 GGCCAGGAGGGTCCTTGAGGTGG - Intergenic
968620337 4:1601060-1601082 GGGCAGGAGGGCTCTTGAGATGG - Intergenic
969333822 4:6495111-6495133 GGCCACGTAGCCCCTTGGCAGGG - Intronic
969562363 4:7957558-7957580 GGCCAGGAAGAGGCTGGAGAGGG + Intergenic
970159989 4:13178705-13178727 GGCTCAGTAGCCCCTTGAGATGG - Intergenic
970458144 4:16246045-16246067 AGCCTGAAAGCCGCTTGAGAAGG - Intergenic
970985036 4:22147105-22147127 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
971943143 4:33241108-33241130 GGCCAGGGACCCACTTGAGCAGG + Intergenic
972119514 4:35682610-35682632 GGCCAGGGACCCACTTGAGGAGG + Intergenic
972219381 4:36936282-36936304 GGTCAGGAACCCACTTGAGGAGG - Intergenic
972373422 4:38448235-38448257 GGTCAGGAACCCACTTGAGGAGG + Intergenic
973321876 4:48818086-48818108 GGTCAGGGACCCACTTGAGAAGG - Intronic
973715164 4:53669292-53669314 GGTCAGGAACCCACTTGAGGAGG + Intronic
973736634 4:53877799-53877821 GGTCAGGAACCCACTTGAGGAGG - Intronic
973935530 4:55842421-55842443 GGTCAGGAACCCACTTGAGGAGG - Intergenic
974503140 4:62732266-62732288 GGCCAGGGACCCACTTGAGGAGG + Intergenic
975034232 4:69661078-69661100 GGTCAGGGACCCACTTGAGAAGG + Intergenic
975157640 4:71089839-71089861 GGTCAGGAACCCACTTGAGGAGG + Intergenic
975484119 4:74915666-74915688 GGTCAGGGATCCACTTGAGAAGG + Intergenic
975726871 4:77300936-77300958 GGTCAGGGACCCACTTGAGAAGG + Intronic
975764748 4:77655405-77655427 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
976114918 4:81715892-81715914 GGTCAGGGACCCACTTGAGAAGG - Intronic
976363117 4:84203280-84203302 GGTCAGGAACCCACTTGAGGAGG - Intergenic
976487709 4:85627516-85627538 GGTCAGGGAGCCACTTGAGGAGG + Intronic
976552537 4:86413360-86413382 GGCCAGGGACCCGCTTGAGGAGG + Intronic
976629129 4:87219843-87219865 GGCCAGCAAGCCCCCCGAGTGGG + Intronic
978148770 4:105409582-105409604 GGTCAGGGACCCACTTGAGAAGG - Intronic
978179476 4:105775824-105775846 GGTCAGGGACCCACTTGAGAAGG + Intronic
978418467 4:108503807-108503829 GGCCAGGGACCCACTTGAGGAGG - Intergenic
979315336 4:119255179-119255201 GGTCAGGAATCCACTTGAGGAGG + Intronic
979600176 4:122578942-122578964 TGCCATAAAGCCCCTAGAGAGGG + Intergenic
980226407 4:129992789-129992811 GGACAAGAAGGCCCTTTAGAAGG + Intergenic
980494113 4:133569797-133569819 GGTCAGGAAACCACTTGAGGAGG + Intergenic
980513435 4:133823212-133823234 GGCCAGGGACCCACTTGAGGAGG + Intergenic
982035679 4:151343499-151343521 GGCCAGGAAGAGCAATGAGAAGG + Intergenic
982581125 4:157180212-157180234 GGTCAGGAACCCACTTGAGGAGG + Intergenic
983137338 4:164101432-164101454 GGTCAGGAACCCACTTGAGGAGG - Intronic
983446436 4:167858569-167858591 GGTCAGGAACCCACTTGAGGAGG - Intergenic
983704382 4:170639910-170639932 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
984009016 4:174348088-174348110 GGTCAGGGACCCACTTGAGAAGG + Intergenic
984893192 4:184511847-184511869 GTCATGGAAGCCCCTGGAGAAGG + Intergenic
985209339 4:187575407-187575429 GGCTAGGAAGCCCCATGATCTGG - Intergenic
1202752852 4_GL000008v2_random:25024-25046 GGTCAGGAACCCACTTGAGGAGG - Intergenic
985827056 5:2200291-2200313 GGCCGGGGAGCATCTTGAGATGG - Intergenic
986005954 5:3669397-3669419 GGTCAGGAACCCACTTGAGGAGG + Intergenic
986255699 5:6100786-6100808 GGTCAGGAGGCCCATGGAGAGGG - Intergenic
987983593 5:25119056-25119078 GGCCAGGGACCCACTTGAGGAGG + Intergenic
988945160 5:36189663-36189685 GGTCAGGGACCCACTTGAGAAGG + Intergenic
989320655 5:40130526-40130548 GGTCAGGAACCCACTTGAGGAGG + Intergenic
989349871 5:40474206-40474228 GGTCAGGAACCCACTTGAGGAGG + Intergenic
989618984 5:43366621-43366643 GGTCAGGGACCCACTTGAGAAGG + Intergenic
989674100 5:43953570-43953592 GGTCAGGAACCCACTTGAGGAGG - Intergenic
990681965 5:58254842-58254864 GGTCAGGGACCCACTTGAGAAGG + Intergenic
991021460 5:61983876-61983898 GTCCAGCAAGCCCTTTCAGAAGG + Intergenic
991103431 5:62817975-62817997 GGCCAGGGACCCACTTGAGGAGG - Intergenic
991451051 5:66750965-66750987 GGTCAGGGACCCACTTGAGAAGG - Intronic
992038812 5:72808503-72808525 GGTCAGGAACCCACTTGAGGAGG + Intergenic
992740558 5:79769777-79769799 GGTCAGGGACCCACTTGAGAAGG + Intronic
992976835 5:82129819-82129841 GGTCAGGGAGCCACTTGAGGAGG + Intronic
993438263 5:87924420-87924442 GGTCAGGGATCCACTTGAGAAGG + Intergenic
994299938 5:98135528-98135550 GGCCAGGGACCCACTTGAGGAGG - Intergenic
995252213 5:110006471-110006493 GGCCAGGGACCCACTTGAGGAGG + Intergenic
995695802 5:114876884-114876906 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
996856777 5:128017045-128017067 GGCCAGGAAGACCCTGGATCAGG - Intergenic
997217790 5:132128879-132128901 GGTCAGGGACCCACTTGAGAAGG + Intergenic
998374527 5:141682098-141682120 GCCCACGAAGGCCCTCGAGAAGG + Intronic
998976870 5:147658488-147658510 GGTCAGGAACCCACTTGAGGAGG + Intronic
999542320 5:152587037-152587059 GGTCAGGGATCCACTTGAGAAGG - Intergenic
999641151 5:153674489-153674511 GTCCATGAAGCCCTGTGAGAGGG - Exonic
1000214335 5:159140213-159140235 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1000291878 5:159878312-159878334 GGGCAGGAGGCCCCTTGAACTGG - Intergenic
1000444529 5:161303731-161303753 GGGCAGGAACCCCTTTGAGAAGG - Intronic
1001076427 5:168631383-168631405 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1001103502 5:168833553-168833575 GGCCTGGAAGGCCCTAGAAAGGG + Intronic
1001289766 5:170448500-170448522 GGGCTGCAAGCCCCTTGAGTGGG + Intronic
1002234076 5:177791612-177791634 GGTCAGGAACCCACTTGAGGAGG + Intronic
1002303122 5:178268744-178268766 GGCCTGGAAGTCCCTGGAAAAGG + Exonic
1002383846 5:178850842-178850864 GGCCAGGAAGCCCCCTAAATGGG - Intergenic
1004976252 6:20970202-20970224 AGCCTGGAAGCCACTTGAGGGGG - Intronic
1005100897 6:22171801-22171823 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1006730249 6:36230928-36230950 GGCCAGGCAGCCCCTCAAGAAGG - Exonic
1007247308 6:40471872-40471894 GCAAAGCAAGCCCCTTGAGAGGG + Intronic
1007756097 6:44100813-44100835 GGGCAGCAAACCCTTTGAGAGGG + Intergenic
1008176152 6:48270507-48270529 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1008719204 6:54328132-54328154 GGTCAGGAACCCACTTGAGGAGG - Intronic
1008798808 6:55341221-55341243 GGTCAGGGACCCACTTGAGAAGG - Intronic
1008896779 6:56565673-56565695 CGTCAGGAACCCACTTGAGATGG + Intronic
1009410561 6:63361099-63361121 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1009777008 6:68218101-68218123 GGCCAGGAACCCACTTGAGGAGG + Intergenic
1009782116 6:68284563-68284585 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1010263279 6:73840732-73840754 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1010837942 6:80612793-80612815 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1010869219 6:81017507-81017529 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1011245132 6:85314441-85314463 GGTCAGGACCCCCCTTGAGGAGG + Intergenic
1011408216 6:87038633-87038655 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1011760768 6:90562771-90562793 GGTCAGGGACCCACTTGAGAAGG - Intronic
1012969794 6:105716807-105716829 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
1013197659 6:107860042-107860064 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1013320179 6:108980467-108980489 GGCCAGGGAACCACTTGAGGAGG + Intergenic
1013551000 6:111207853-111207875 GGACAGGAAGCAGCTTGGGAAGG + Intronic
1014076862 6:117245434-117245456 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1014278909 6:119418625-119418647 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1014605847 6:123472762-123472784 GGTCAGGGACCCACTTGAGAAGG - Intronic
1014979264 6:127926885-127926907 GGTCAGGAACCCACTTGAGAAGG - Intergenic
1015623337 6:135155820-135155842 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1016402447 6:143695130-143695152 GACCAGGAATTGCCTTGAGATGG + Intronic
1018061007 6:160089711-160089733 GGGGAGAAAGCCTCTTGAGAGGG + Intronic
1018797588 6:167199353-167199375 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1019257855 7:63179-63201 GGCCAGGAAGCCCCTGCCCATGG - Intergenic
1020557781 7:9691613-9691635 GGTCAGGAATCCACTTGAGGAGG - Intergenic
1020595970 7:10207998-10208020 GGCCAGAAAGCCACTTGAGAAGG + Intergenic
1020881375 7:13766325-13766347 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1021166943 7:17353922-17353944 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1021238696 7:18174908-18174930 GGCCAGGGACCCACTTGAGGAGG + Intronic
1021798136 7:24278441-24278463 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
1023024700 7:36040140-36040162 GGCCAGGTGGTCCCTTTAGATGG + Intergenic
1024130034 7:46341775-46341797 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1024380032 7:48685628-48685650 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1024552610 7:50576277-50576299 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1025601128 7:62998650-62998672 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1026495374 7:70897236-70897258 GTCCAGAACGCCCCTTGGGATGG - Intergenic
1027054766 7:75042524-75042546 GGCCAGGAAGGGCCATGAGCAGG + Exonic
1028080365 7:86567842-86567864 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1028159107 7:87465598-87465620 GGTCAGGGACCCACTTGAGAAGG - Intronic
1028643802 7:93073255-93073277 GGTCAGGGACCCCCTTGAGGAGG + Intergenic
1029059877 7:97786289-97786311 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1029206901 7:98875040-98875062 GACCAGGAAGACTCTTGGGATGG - Intergenic
1031173272 7:118317795-118317817 GGTCAGGAACCCACTTGAGCAGG + Intergenic
1031397682 7:121292995-121293017 GGTCAGGAACCCACTTGAGGAGG + Intronic
1031423817 7:121581790-121581812 AGCTAGGGAGCCCCTAGAGATGG + Intergenic
1031585395 7:123527637-123527659 GGCCAGGGACCCACTTGAGGAGG + Intronic
1031848199 7:126831153-126831175 GGTCAGGGACCCACTTGAGAAGG + Intronic
1031919684 7:127591517-127591539 GGCCAGGAAGCCCCTTCCATAGG - Exonic
1032202361 7:129831105-129831127 TGGGAGGAAGCCCTTTGAGAAGG - Exonic
1032853937 7:135818500-135818522 GGACAGGAGGCCACTTGGGAAGG + Intergenic
1033680106 7:143585066-143585088 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1033691729 7:143744376-143744398 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1033776245 7:144614846-144614868 GGTCAGGAACCCACTTGAGGAGG - Intronic
1034239226 7:149597036-149597058 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1034354487 7:150442122-150442144 GGCCAGGAAGCCCTGAGAGAAGG - Intergenic
1035231297 7:157467600-157467622 CGCCAGGAAGCACCTTGACTTGG + Intergenic
1035270863 7:157719142-157719164 GAGCAGGAAGCCCCATGAGAGGG + Intronic
1035886176 8:3294266-3294288 GGTCAGGGACCCCCTTGAGGAGG + Intronic
1036671634 8:10792354-10792376 GGGCAGGAACCCACCTGAGAGGG + Intronic
1036812952 8:11880179-11880201 GTCCCTGAAGCCCCTTCAGAGGG - Intergenic
1037545393 8:19915445-19915467 GGTCAGGGACCCACTTGAGAAGG + Intronic
1038211640 8:25523706-25523728 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1040431697 8:47349421-47349443 GGTCAGGGACCCCCTTGAGGAGG + Intronic
1041377680 8:57219493-57219515 GGCCTGGAAGCATCTGGAGAAGG + Intergenic
1042349413 8:67761781-67761803 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1042638554 8:70906072-70906094 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1042763092 8:72291728-72291750 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1043059682 8:75484446-75484468 TTCCAGGGAGGCCCTTGAGATGG - Intronic
1044546623 8:93467005-93467027 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1044648256 8:94467655-94467677 GGCCAGGCAGGCCCATAAGAGGG - Intronic
1045199727 8:99967897-99967919 GGTCAGGGACCCACTTGAGAAGG - Intronic
1046115200 8:109776411-109776433 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1046153283 8:110256282-110256304 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1046524863 8:115371032-115371054 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1047346855 8:124037408-124037430 GGCAAGGGAGCCCCTTAAAATGG - Intronic
1048184097 8:132223305-132223327 GGACAGCAAGCCCCTTGAGGAGG - Intronic
1048697095 8:137040417-137040439 GGTCAGGGAGCCACTTGAGGAGG + Intergenic
1049612355 8:143561520-143561542 GGCCGGGCAGCCCCCTGAGGCGG + Intronic
1049714533 8:144083589-144083611 GGCCAGGAAGCTCAGTGGGAGGG + Intronic
1050422157 9:5477272-5477294 GGACAGGAACCCACTTGAGGAGG + Intergenic
1050504768 9:6336532-6336554 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1050509283 9:6376954-6376976 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1050689033 9:8204418-8204440 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1051005144 9:12334684-12334706 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1051142731 9:13995457-13995479 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1051321881 9:15914119-15914141 GGTCAGGGACCCCCTTGAGGAGG + Intronic
1051330269 9:16018094-16018116 GTGCAGGAAGACCCCTGAGAAGG + Intronic
1051597944 9:18844485-18844507 GGTCAGGGACCCACTTGAGAAGG + Intronic
1051863329 9:21651328-21651350 GGTCAGGGACCCACTTGAGAAGG + Intergenic
1051917501 9:22225773-22225795 GGCCAGGAACCCACTTGAGGAGG + Intergenic
1052329450 9:27252151-27252173 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1052478349 9:28990548-28990570 GGTCAGGGAGCCACTTGAAAAGG - Intergenic
1052640462 9:31160391-31160413 GGTCAGGAACCCACTTGAGAAGG + Intergenic
1052645585 9:31229955-31229977 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1052647388 9:31254106-31254128 GGCCAGGTTGCCCCTCCAGAAGG - Intergenic
1055894870 9:81163067-81163089 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1055990737 9:82102605-82102627 GGCCAGGCAGGGCCTTGGGAGGG + Intergenic
1056003466 9:82242475-82242497 GGTCAGGGAGCCACTTGAGGAGG + Intergenic
1056398925 9:86208407-86208429 GGCCAGGGAGTCCTCTGAGATGG + Intergenic
1057120966 9:92573543-92573565 GGTCAGGGACCCACTTGAGAAGG + Intronic
1057892492 9:98880037-98880059 GCCAAGGCAGCCCCTGGAGAGGG + Intergenic
1058072808 9:100619086-100619108 GGTCAGGGACCCACTTGAGAGGG + Intergenic
1058327926 9:103721418-103721440 GGGCTGGAAGCCTCTTTAGATGG + Intergenic
1060016556 9:120091607-120091629 GGGCAGGAATGCCTTTGAGAGGG - Intergenic
1060516681 9:124270324-124270346 GTCCAAGAAGCCTCTTGGGAAGG + Intronic
1060600690 9:124875554-124875576 GGGCAGGAAGCCCTTAGAGCTGG - Intronic
1060757302 9:126223097-126223119 GCCCAGGGGGCTCCTTGAGAGGG - Intergenic
1061450992 9:130666916-130666938 GGCCTGGACGCCCCCTGAGCCGG + Intronic
1061773813 9:132947104-132947126 GGTCAGGAAGCCCCGTCACAGGG - Intronic
1061909401 9:133714822-133714844 GCCCAGGGAGCACCTTGGGAGGG + Intronic
1203717583 Un_KI270742v1:168504-168526 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1203533643 Un_KI270743v1:9729-9751 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1186246262 X:7619830-7619852 GGCCAGGAGGCCCCTTGGGAAGG - Intergenic
1186866480 X:13725290-13725312 GGTCAGGGACCCCCTTGAGGAGG - Intronic
1188561182 X:31470624-31470646 GGTCAGGACCCCACTTGAGAAGG + Intronic
1188954532 X:36418318-36418340 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1190554887 X:51623815-51623837 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1190593172 X:52025886-52025908 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1191012396 X:55774356-55774378 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1191135302 X:57058066-57058088 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1191187055 X:57624259-57624281 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1191194624 X:57707914-57707936 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1191579350 X:62742980-62743002 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1191608890 X:63090334-63090356 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1191707934 X:64114056-64114078 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1191982696 X:66943474-66943496 GGTCAGGGACCCCCTTGAGGAGG - Intergenic
1192049271 X:67709083-67709105 GGTCAGGGAGCCACTTGAGGAGG + Intronic
1192290388 X:69788614-69788636 GGTCAGGGAGCCACTTGAGGAGG + Intronic
1192293995 X:69828022-69828044 GGTCAGGGAGCCACTTGAGGAGG + Intronic
1192383361 X:70639588-70639610 GGTCAGGGAGCCACTTGAGGAGG - Intronic
1192674927 X:73185530-73185552 GGTCAGGGAGCCACTTGAGGAGG - Intergenic
1193029325 X:76880667-76880689 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1193059044 X:77185150-77185172 AGCCAGGGACCCCCTTGAGGAGG - Intergenic
1193071952 X:77315343-77315365 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1193079409 X:77390865-77390887 GGTCAGGAACCCACTTGAGAAGG - Intergenic
1193394534 X:80968268-80968290 GGTCGGGAAGCCACTTGAGGAGG - Intergenic
1194419994 X:93661374-93661396 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1194879631 X:99235297-99235319 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1195104007 X:101585486-101585508 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1195833674 X:109088734-109088756 GGTCAGGAAACAACTTGAGAAGG + Intergenic
1195997666 X:110747128-110747150 GGTCAGGAACCCCTTTGGGAAGG - Intronic
1196077496 X:111594023-111594045 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1196179216 X:112671796-112671818 GGCCAGGAAGTCCATTCAGCTGG - Intronic
1196350698 X:114725837-114725859 GGTCAGGAACCCACTTGAGGAGG + Intronic
1196442085 X:115727458-115727480 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196442746 X:115730412-115730434 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196443477 X:115733456-115733478 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196445801 X:115845376-115845398 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196446472 X:115848357-115848379 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447141 X:115851338-115851360 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447812 X:115854321-115854343 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196448480 X:115857300-115857322 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449151 X:115860291-115860313 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449822 X:115863282-115863304 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196450491 X:115866265-115866287 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451161 X:115869250-115869272 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451832 X:115872229-115872251 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196452503 X:115875216-115875238 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453173 X:115878185-115878207 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453843 X:115881178-115881200 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454510 X:115884187-115884209 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454923 X:115886289-115886311 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196455587 X:115889249-115889271 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196896816 X:120344934-120344956 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1196901719 X:120390516-120390538 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1197319169 X:125006532-125006554 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1198584558 X:138105952-138105974 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1198976230 X:142338805-142338827 GGTCAGGAACCCACTTGAGGAGG - Intergenic
1199004062 X:142674852-142674874 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1199195167 X:145020654-145020676 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1199978990 X:152910868-152910890 AGCCAGGAAGACCCTTGCTACGG - Intergenic
1200117433 X:153775498-153775520 GGCCAGGAAGCCCCAGCAGGTGG + Intronic
1200323637 X:155216001-155216023 GGGCAGGAAGCTCCCTGGGATGG + Intronic
1201171742 Y:11273442-11273464 GGTCAGGAACCCACTTGAGGAGG + Intergenic
1201450149 Y:14102819-14102841 GGTCAGGGACCCACTTGAGAAGG - Intergenic
1201462324 Y:14239962-14239984 GGCCAGGCACCCACTTGAGGAGG - Intergenic
1201466118 Y:14282849-14282871 GGCCAGGGACCCACTTGAGAAGG - Intergenic
1201498627 Y:14617585-14617607 GGTCAGGGACCCACTTGAGAAGG + Intronic
1201789894 Y:17827688-17827710 GGCCATGGATCCACTTGAGAAGG - Intergenic
1201795290 Y:17890227-17890249 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1201806266 Y:18015758-18015780 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1201811660 Y:18078301-18078323 GGCCATGGATCCACTTGAGAAGG + Intergenic
1201848492 Y:18450711-18450733 GGTCAGGGATCCACTTGAGAAGG + Intergenic
1201884824 Y:18869664-18869686 GGTCAGGGATCCACTTGAGAAGG - Intergenic
1201933351 Y:19378610-19378632 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1202351541 Y:23997439-23997461 GGCCATGGATCCACTTGAGAAGG - Intergenic
1202356725 Y:24059309-24059331 GGCCAGGGACCCACTTGAGGAGG - Intergenic
1202514053 Y:25610801-25610823 GGCCAGGGACCCACTTGAGGAGG + Intergenic
1202519238 Y:25672680-25672702 GGCCATGGATCCACTTGAGAAGG + Intergenic