ID: 1137618841

View in Genome Browser
Species Human (GRCh38)
Location 16:49862669-49862691
Sequence GACAAGGAGGTTCCCACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137618841_1137618846 1 Left 1137618841 16:49862669-49862691 CCGGGTGTGGGAACCTCCTTGTC No data
Right 1137618846 16:49862693-49862715 TCTCTGGTTTCTGTTCAGCTGGG No data
1137618841_1137618845 0 Left 1137618841 16:49862669-49862691 CCGGGTGTGGGAACCTCCTTGTC No data
Right 1137618845 16:49862692-49862714 TTCTCTGGTTTCTGTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137618841 Original CRISPR GACAAGGAGGTTCCCACACC CGG (reversed) Intergenic
No off target data available for this crispr