ID: 1137618845

View in Genome Browser
Species Human (GRCh38)
Location 16:49862692-49862714
Sequence TTCTCTGGTTTCTGTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137618841_1137618845 0 Left 1137618841 16:49862669-49862691 CCGGGTGTGGGAACCTCCTTGTC No data
Right 1137618845 16:49862692-49862714 TTCTCTGGTTTCTGTTCAGCTGG No data
1137618838_1137618845 14 Left 1137618838 16:49862655-49862677 CCAAAAACAATAAGCCGGGTGTG No data
Right 1137618845 16:49862692-49862714 TTCTCTGGTTTCTGTTCAGCTGG No data
1137618835_1137618845 21 Left 1137618835 16:49862648-49862670 CCTGGTGCCAAAAACAATAAGCC No data
Right 1137618845 16:49862692-49862714 TTCTCTGGTTTCTGTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137618845 Original CRISPR TTCTCTGGTTTCTGTTCAGC TGG Intergenic
No off target data available for this crispr