ID: 1137619221

View in Genome Browser
Species Human (GRCh38)
Location 16:49865566-49865588
Sequence AGCCATACCCATTACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137619221_1137619225 -5 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619225 16:49865584-49865606 TGGCTGAGACTCTGCTGAGGGGG No data
1137619221_1137619223 -7 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619223 16:49865582-49865604 TATGGCTGAGACTCTGCTGAGGG No data
1137619221_1137619224 -6 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619224 16:49865583-49865605 ATGGCTGAGACTCTGCTGAGGGG No data
1137619221_1137619227 26 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619227 16:49865615-49865637 AGGAAGTAAGCTCTTTTGCAAGG No data
1137619221_1137619222 -8 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619222 16:49865581-49865603 GTATGGCTGAGACTCTGCTGAGG No data
1137619221_1137619226 6 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619226 16:49865595-49865617 CTGCTGAGGGGGTGCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137619221 Original CRISPR AGCCATACCCATTACTGAAA AGG (reversed) Intergenic
No off target data available for this crispr