ID: 1137619225

View in Genome Browser
Species Human (GRCh38)
Location 16:49865584-49865606
Sequence TGGCTGAGACTCTGCTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137619221_1137619225 -5 Left 1137619221 16:49865566-49865588 CCTTTTCAGTAATGGGTATGGCT No data
Right 1137619225 16:49865584-49865606 TGGCTGAGACTCTGCTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137619225 Original CRISPR TGGCTGAGACTCTGCTGAGG GGG Intergenic
No off target data available for this crispr