ID: 1137621052

View in Genome Browser
Species Human (GRCh38)
Location 16:49876777-49876799
Sequence CGCCCCGGGAGGCGTCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137621046_1137621052 -1 Left 1137621046 16:49876755-49876777 CCAGGGCAAGCAGCTGGAGACCC No data
Right 1137621052 16:49876777-49876799 CGCCCCGGGAGGCGTCTGAGAGG No data
1137621045_1137621052 0 Left 1137621045 16:49876754-49876776 CCCAGGGCAAGCAGCTGGAGACC No data
Right 1137621052 16:49876777-49876799 CGCCCCGGGAGGCGTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137621052 Original CRISPR CGCCCCGGGAGGCGTCTGAG AGG Intergenic
No off target data available for this crispr