ID: 1137622127

View in Genome Browser
Species Human (GRCh38)
Location 16:49883060-49883082
Sequence CAAGGTTACCTCTATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137622114_1137622127 28 Left 1137622114 16:49883009-49883031 CCCTGTTCAGTGGGAAGAGGGCC No data
Right 1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG No data
1137622122_1137622127 7 Left 1137622122 16:49883030-49883052 CCAGGGCAGGCTTGGGCTCTGGA No data
Right 1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG No data
1137622115_1137622127 27 Left 1137622115 16:49883010-49883032 CCTGTTCAGTGGGAAGAGGGCCA No data
Right 1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137622127 Original CRISPR CAAGGTTACCTCTATGAGGA TGG Intergenic
No off target data available for this crispr