ID: 1137622546

View in Genome Browser
Species Human (GRCh38)
Location 16:49885637-49885659
Sequence TGCACCACTGTCCCAGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137622546_1137622549 0 Left 1137622546 16:49885637-49885659 CCACATGCTGGGACAGTGGTGCA No data
Right 1137622549 16:49885660-49885682 CCCCAACTCCATGGAGACAGAGG No data
1137622546_1137622547 -9 Left 1137622546 16:49885637-49885659 CCACATGCTGGGACAGTGGTGCA No data
Right 1137622547 16:49885651-49885673 AGTGGTGCACCCCAACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137622546 Original CRISPR TGCACCACTGTCCCAGCATG TGG (reversed) Intergenic
No off target data available for this crispr