ID: 1137622793

View in Genome Browser
Species Human (GRCh38)
Location 16:49887359-49887381
Sequence TACCCACAGATTCCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137622791_1137622793 -1 Left 1137622791 16:49887337-49887359 CCGCTTGCCATTTTACATAACAT No data
Right 1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG No data
1137622789_1137622793 8 Left 1137622789 16:49887328-49887350 CCTTAATTCCCGCTTGCCATTTT No data
Right 1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG No data
1137622790_1137622793 0 Left 1137622790 16:49887336-49887358 CCCGCTTGCCATTTTACATAACA No data
Right 1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG No data
1137622792_1137622793 -8 Left 1137622792 16:49887344-49887366 CCATTTTACATAACATACCCACA No data
Right 1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG No data
1137622788_1137622793 26 Left 1137622788 16:49887310-49887332 CCTTAATTTCATCTGCAACCTTA 0: 5
1: 65
2: 183
3: 297
4: 626
Right 1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137622793 Original CRISPR TACCCACAGATTCCAGAGAC TGG Intergenic
No off target data available for this crispr