ID: 1137623662

View in Genome Browser
Species Human (GRCh38)
Location 16:49893751-49893773
Sequence GGGATTGTGCCCAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137623662_1137623672 0 Left 1137623662 16:49893751-49893773 CCAAGGGCCCTGGGCACAATCCC No data
Right 1137623672 16:49893774-49893796 CGGTCCCGGCACATGTTGGTGGG No data
1137623662_1137623671 -1 Left 1137623662 16:49893751-49893773 CCAAGGGCCCTGGGCACAATCCC No data
Right 1137623671 16:49893773-49893795 CCGGTCCCGGCACATGTTGGTGG No data
1137623662_1137623673 1 Left 1137623662 16:49893751-49893773 CCAAGGGCCCTGGGCACAATCCC No data
Right 1137623673 16:49893775-49893797 GGTCCCGGCACATGTTGGTGGGG No data
1137623662_1137623676 15 Left 1137623662 16:49893751-49893773 CCAAGGGCCCTGGGCACAATCCC No data
Right 1137623676 16:49893789-49893811 TTGGTGGGGCCATTAGTTCTTGG No data
1137623662_1137623667 -4 Left 1137623662 16:49893751-49893773 CCAAGGGCCCTGGGCACAATCCC No data
Right 1137623667 16:49893770-49893792 TCCCCGGTCCCGGCACATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137623662 Original CRISPR GGGATTGTGCCCAGGGCCCT TGG (reversed) Intergenic