ID: 1137624377

View in Genome Browser
Species Human (GRCh38)
Location 16:49898497-49898519
Sequence GGCTGCTGCTTGGGTAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137624377_1137624383 2 Left 1137624377 16:49898497-49898519 CCTCTTCTACCCAAGCAGCAGCC No data
Right 1137624383 16:49898522-49898544 AGATGGTCAATTAAAACGCAGGG No data
1137624377_1137624385 20 Left 1137624377 16:49898497-49898519 CCTCTTCTACCCAAGCAGCAGCC No data
Right 1137624385 16:49898540-49898562 CAGGGTAAGATCAGGCACAGTGG No data
1137624377_1137624384 12 Left 1137624377 16:49898497-49898519 CCTCTTCTACCCAAGCAGCAGCC No data
Right 1137624384 16:49898532-49898554 TTAAAACGCAGGGTAAGATCAGG No data
1137624377_1137624382 1 Left 1137624377 16:49898497-49898519 CCTCTTCTACCCAAGCAGCAGCC No data
Right 1137624382 16:49898521-49898543 CAGATGGTCAATTAAAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137624377 Original CRISPR GGCTGCTGCTTGGGTAGAAG AGG (reversed) Intergenic
No off target data available for this crispr