ID: 1137628968

View in Genome Browser
Species Human (GRCh38)
Location 16:49928612-49928634
Sequence CATGCACGTGATGCTATCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137628968_1137628970 8 Left 1137628968 16:49928612-49928634 CCAACGATAGCATCACGTGCATG No data
Right 1137628970 16:49928643-49928665 CAGACTACACTGTGAACTTCTGG No data
1137628968_1137628971 11 Left 1137628968 16:49928612-49928634 CCAACGATAGCATCACGTGCATG No data
Right 1137628971 16:49928646-49928668 ACTACACTGTGAACTTCTGGAGG No data
1137628968_1137628972 17 Left 1137628968 16:49928612-49928634 CCAACGATAGCATCACGTGCATG No data
Right 1137628972 16:49928652-49928674 CTGTGAACTTCTGGAGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137628968 Original CRISPR CATGCACGTGATGCTATCGT TGG (reversed) Intergenic
No off target data available for this crispr