ID: 1137629158

View in Genome Browser
Species Human (GRCh38)
Location 16:49930083-49930105
Sequence CCTTCAGCACAGCTGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137629158_1137629162 2 Left 1137629158 16:49930083-49930105 CCTTGGTCCAGCTGTGCTGAAGG No data
Right 1137629162 16:49930108-49930130 AGATACGCCTTAATATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137629158 Original CRISPR CCTTCAGCACAGCTGGACCA AGG (reversed) Intergenic
No off target data available for this crispr