ID: 1137629208

View in Genome Browser
Species Human (GRCh38)
Location 16:49930463-49930485
Sequence GCGTTTTTTGCCTACCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137629208_1137629216 22 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629216 16:49930508-49930530 TAGGTGGTGCAGCATAGAGCAGG No data
1137629208_1137629212 3 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629212 16:49930489-49930511 TTCCAGCTGCCTAGCGGGGTAGG No data
1137629208_1137629210 -2 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629210 16:49930484-49930506 GCAACTTCCAGCTGCCTAGCGGG No data
1137629208_1137629218 30 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629218 16:49930516-49930538 GCAGCATAGAGCAGGCACATGGG No data
1137629208_1137629214 6 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629214 16:49930492-49930514 CAGCTGCCTAGCGGGGTAGGTGG No data
1137629208_1137629209 -3 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629209 16:49930483-49930505 CGCAACTTCCAGCTGCCTAGCGG No data
1137629208_1137629217 29 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629217 16:49930515-49930537 TGCAGCATAGAGCAGGCACATGG No data
1137629208_1137629211 -1 Left 1137629208 16:49930463-49930485 CCAGAGGGGTAGGCAAAAAACGC No data
Right 1137629211 16:49930485-49930507 CAACTTCCAGCTGCCTAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137629208 Original CRISPR GCGTTTTTTGCCTACCCCTC TGG (reversed) Intergenic
No off target data available for this crispr