ID: 1137629550

View in Genome Browser
Species Human (GRCh38)
Location 16:49932559-49932581
Sequence TCTAAAAGGACCTCTCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137629550_1137629552 -6 Left 1137629550 16:49932559-49932581 CCTTTTAGAGAGGTCCTTTTAGA No data
Right 1137629552 16:49932576-49932598 TTTAGAAAGACCTTTTAGAGAGG No data
1137629550_1137629555 6 Left 1137629550 16:49932559-49932581 CCTTTTAGAGAGGTCCTTTTAGA No data
Right 1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG No data
1137629550_1137629553 -1 Left 1137629550 16:49932559-49932581 CCTTTTAGAGAGGTCCTTTTAGA No data
Right 1137629553 16:49932581-49932603 AAAGACCTTTTAGAGAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137629550 Original CRISPR TCTAAAAGGACCTCTCTAAA AGG (reversed) Intergenic
No off target data available for this crispr