ID: 1137629551

View in Genome Browser
Species Human (GRCh38)
Location 16:49932573-49932595
Sequence CTCTAAAAGGTCTTTCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137629551_1137629555 -8 Left 1137629551 16:49932573-49932595 CCTTTTAGAAAGACCTTTTAGAG No data
Right 1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG No data
1137629551_1137629556 26 Left 1137629551 16:49932573-49932595 CCTTTTAGAAAGACCTTTTAGAG No data
Right 1137629556 16:49932622-49932644 TTGCCCCTACATGTGACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137629551 Original CRISPR CTCTAAAAGGTCTTTCTAAA AGG (reversed) Intergenic
No off target data available for this crispr