ID: 1137629555

View in Genome Browser
Species Human (GRCh38)
Location 16:49932588-49932610
Sequence TTTTAGAGAGGTTTGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137629550_1137629555 6 Left 1137629550 16:49932559-49932581 CCTTTTAGAGAGGTCCTTTTAGA No data
Right 1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG No data
1137629551_1137629555 -8 Left 1137629551 16:49932573-49932595 CCTTTTAGAAAGACCTTTTAGAG No data
Right 1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137629555 Original CRISPR TTTTAGAGAGGTTTGGCAGC TGG Intergenic
No off target data available for this crispr