ID: 1137640257

View in Genome Browser
Species Human (GRCh38)
Location 16:50022814-50022836
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137640248_1137640257 19 Left 1137640248 16:50022772-50022794 CCTTCAAAATGAAGTGGTGGGTG No data
Right 1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137640257 Original CRISPR CTGACAAATGGGAAGGAGGA AGG Intergenic
No off target data available for this crispr