ID: 1137648098

View in Genome Browser
Species Human (GRCh38)
Location 16:50093499-50093521
Sequence AAATTGCAACTGGTGTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137648091_1137648098 30 Left 1137648091 16:50093446-50093468 CCACCTGGGGACATTTGGCAACG 0: 2
1: 11
2: 147
3: 403
4: 841
Right 1137648098 16:50093499-50093521 AAATTGCAACTGGTGTCTAGAGG 0: 1
1: 0
2: 3
3: 26
4: 217
1137648092_1137648098 27 Left 1137648092 16:50093449-50093471 CCTGGGGACATTTGGCAACGTCT 0: 11
1: 192
2: 574
3: 1071
4: 1351
Right 1137648098 16:50093499-50093521 AAATTGCAACTGGTGTCTAGAGG 0: 1
1: 0
2: 3
3: 26
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137648098 Original CRISPR AAATTGCAACTGGTGTCTAG AGG Intronic
903868441 1:26414785-26414807 AAGATGCAACTGGCTTCTAGTGG - Intronic
904255655 1:29252958-29252980 GACTTGCGACTGGTGTCTGGAGG - Intronic
907247666 1:53118239-53118261 AACTTGCAGCTGGTGCCCAGTGG + Intronic
907573294 1:55503732-55503754 AAGTTGCTACTGGTATCTTGTGG + Intergenic
907791213 1:57666560-57666582 AAATTGCAACTGCATTCTACAGG + Intronic
908602841 1:65759534-65759556 AACTTACAACTGGTGTCTGAAGG + Intergenic
909747975 1:79122687-79122709 AAAATGTAAATGGTGTCTAAGGG + Intergenic
909946433 1:81669130-81669152 AAATTCCAACTTGTGTCTGTTGG - Intronic
910498520 1:87861370-87861392 TAACTGCAACTGGTGTGTACTGG - Intergenic
910680992 1:89864411-89864433 AAATGGTAACTGGTGGATAGTGG - Intronic
910999904 1:93152867-93152889 AAAATGCTTCAGGTGTCTAGGGG - Exonic
911567259 1:99477053-99477075 AAATAGCCACATGTGTCTAGTGG - Intergenic
912964462 1:114225497-114225519 AACTTGCTTCTGGTATCTAGTGG - Intergenic
913041724 1:115033166-115033188 AAATTACAACTGGTGTTAAGGGG - Intronic
913235914 1:116783119-116783141 AAATCGAACCTGGAGTCTAGTGG - Intergenic
913239401 1:116816797-116816819 GGGTTGCTACTGGTGTCTAGTGG + Intergenic
916157939 1:161875777-161875799 AAAGTACAATTGTTGTCTAGAGG - Intronic
917331471 1:173884881-173884903 CAATAGCAACAGGTGGCTAGTGG + Intronic
918634016 1:186753440-186753462 AAATTTCAACTAGAGCCTAGAGG - Intergenic
923203174 1:231732415-231732437 AATTTCCAACTGGTATCTTGAGG - Intronic
924093195 1:240523401-240523423 AAACTGCTACTGGTGTCTAATGG - Intronic
1063248974 10:4253467-4253489 ACATTGCTGCTGGTATCTAGTGG + Intergenic
1063687217 10:8248538-8248560 GGACTGCTACTGGTGTCTAGTGG + Intergenic
1065174743 10:23065360-23065382 AGATGGCATCTGGTGACTAGGGG + Intergenic
1066500384 10:35987815-35987837 ACGTTGCCACTGGTTTCTAGAGG + Intergenic
1069505222 10:68991350-68991372 AAATTGGAACTGGTGTTGATCGG + Intronic
1073617670 10:105013786-105013808 AAATTGCAACAGGTGCTTATAGG + Intronic
1075972456 10:126666201-126666223 AAAATGCTACTGGTGGCTAATGG - Intronic
1077238472 11:1497255-1497277 AAAGTGTTACTGGTGTCTAATGG - Intronic
1077545538 11:3167887-3167909 AGGTTGCTACTGGTGTCTAGTGG + Intergenic
1078859929 11:15237593-15237615 TCAATGCAACTGGTGTCTACTGG + Intronic
1078872652 11:15363366-15363388 ACATTGCAACTGGTAACTAAAGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1081818939 11:45972458-45972480 AAATAGCAACTTGTGGCTAGTGG - Intronic
1082016765 11:47494805-47494827 AAATAGCCACTTGTGGCTAGTGG - Intronic
1083039948 11:59676147-59676169 GACTTGCAACTGGTGTCTGGGGG + Intergenic
1087205430 11:95388935-95388957 CATTTTCAACTGGTGACTAGGGG - Intergenic
1087409340 11:97770945-97770967 AAATTTCAACTGGAGACTTGAGG + Intergenic
1088611465 11:111581343-111581365 AGGGTGCTACTGGTGTCTAGTGG + Intergenic
1088902568 11:114129094-114129116 AAATTGTACCTGGTGCCAAGTGG - Intronic
1090417996 11:126554133-126554155 AAAATGGAAATGGTTTCTAGAGG - Intronic
1092470141 12:8770813-8770835 GACTTGCAACTGGTGTCTGAAGG - Intronic
1093445281 12:19250037-19250059 GAAATGTTACTGGTGTCTAGTGG - Intronic
1093700095 12:22210577-22210599 GACTTGCAACTGATGTCTAAGGG - Intronic
1094742315 12:33303602-33303624 GACTTGCAACTGGTGTGTTGGGG + Intergenic
1095259847 12:40085364-40085386 AATTTGCAACCGGTGTCTGAAGG + Intronic
1095579800 12:43784437-43784459 AACTTACAACTGGTGTCTGGTGG - Intronic
1095730970 12:45506382-45506404 GACTTGCAACTTGTGTCTGGGGG + Intergenic
1098973723 12:76880105-76880127 AGGTTGCAACTGGCATCTAGTGG - Intergenic
1102443092 12:112978507-112978529 AAACTGAAACTGAAGTCTAGAGG - Exonic
1102990986 12:117316021-117316043 CAATTGCCACATGTGTCTAGTGG - Intronic
1104427168 12:128687379-128687401 GATTTGCAACCGGTATCTAGGGG - Intronic
1106207703 13:27615135-27615157 CACTTGCGACTGGTGTCTGGTGG - Intronic
1106383280 13:29260862-29260884 AGATTGCTACTGGCATCTAGTGG + Intronic
1106626080 13:31422304-31422326 AAAATGCTACAGGTGTCCAGAGG - Intergenic
1106734986 13:32579743-32579765 AAATTGATACTTGTATCTAGAGG + Intergenic
1107018781 13:35730816-35730838 AAATTGCAACTGGCATCTGAGGG - Intergenic
1107139514 13:36982272-36982294 TATTTGCATTTGGTGTCTAGAGG + Intronic
1107265846 13:38553468-38553490 AAAATGCAACTGGGGTATTGAGG - Intergenic
1107868727 13:44728205-44728227 GACTTGCAACTGGTGCCTGGGGG - Intergenic
1109251943 13:60030752-60030774 AAATAGCCACATGTGTCTAGAGG - Intronic
1111104937 13:83632653-83632675 AATTTGCCACTGCAGTCTAGAGG + Intergenic
1115420352 14:33186889-33186911 GAATTGCTACTGGCATCTAGTGG + Intronic
1115796956 14:36948669-36948691 CAATTGCCACTTGTGGCTAGTGG - Intronic
1117309021 14:54503685-54503707 AAGTTGCTACTGGCCTCTAGTGG - Intergenic
1120945168 14:89987951-89987973 GACTTGCAACTGGTGTCTGAGGG - Intronic
1121090022 14:91174768-91174790 GACTTGCAACTGGTGTCTGTAGG + Intronic
1121909719 14:97777765-97777787 AAAGTGCAACTGACATCTAGTGG - Intergenic
1124226559 15:27900167-27900189 AAATTGCACATGCTCTCTAGAGG - Intronic
1126205217 15:46037729-46037751 AGATTGCATCTGGTGTCTGCAGG + Intergenic
1128624486 15:69185850-69185872 GATTTGCAACTGGTGTCTGAAGG - Intronic
1129595604 15:76961600-76961622 CAATTCCAACTGGTTGCTAGGGG - Intergenic
1130056258 15:80528554-80528576 ATGTTGGAAGTGGTGTCTAGTGG + Intronic
1133299277 16:4772327-4772349 GAGTTGCTACTGGTGTCTGGTGG + Intergenic
1133542667 16:6771704-6771726 ATAATGCTACTGGCGTCTAGCGG + Intronic
1133894164 16:9909454-9909476 CAATGGCAACAGGTGACTAGTGG - Intronic
1134357881 16:13501203-13501225 GAAGTGCAACTGGCATCTAGTGG + Intergenic
1134649003 16:15893441-15893463 AACTTGCGACTGGTGTCTGAAGG + Intergenic
1135069677 16:19340922-19340944 GACTTGCAACTGGTGTCTAGGGG + Intergenic
1137648098 16:50093499-50093521 AAATTGCAACTGGTGTCTAGAGG + Intronic
1138004487 16:53318702-53318724 AAGATGCTACTGGTATCTAGTGG + Intronic
1139786915 16:69400707-69400729 AAATAGCCACTTGTGGCTAGTGG + Intronic
1143369780 17:6431936-6431958 AAATTGAAAGTGGGGTCTAGAGG - Intronic
1146401284 17:32501906-32501928 GACTTGCAACTGGTGTCTAGGGG + Intronic
1146683154 17:34823003-34823025 GGAGTGCTACTGGTGTCTAGTGG - Intergenic
1148394424 17:47296679-47296701 AAGGTGCTACTGATGTCTAGAGG + Intronic
1149097029 17:52855582-52855604 AAATTGCAACCTCTTTCTAGAGG - Intergenic
1149913262 17:60585436-60585458 GAAATGCTACTAGTGTCTAGTGG - Intronic
1150602916 17:66665979-66666001 ACATTGGAATTGGTCTCTAGGGG - Intronic
1151029240 17:70716729-70716751 AAATTTCAGCTGGTTTCTCGTGG + Intergenic
1151901436 17:77018238-77018260 CATTTGCAGCTGGTGTCTGGTGG + Intergenic
1152051284 17:77980659-77980681 GACTTGCAACTGGTGTCTCAAGG - Intergenic
1155777567 18:29786348-29786370 AAATTTCAACTCGAGTTTAGGGG - Intergenic
1156254570 18:35382814-35382836 AATTAGCCACAGGTGTCTAGTGG - Intergenic
1156362248 18:36393434-36393456 GCATTGCAACTGGCATCTAGTGG - Intronic
1161823441 19:6545671-6545693 GACTTGCAACTGGTATCTAGGGG - Intergenic
1163137358 19:15322213-15322235 GGATTGCAATTGGTGTATAGGGG - Intronic
1164516404 19:28940184-28940206 AAATTGCAACTTCTGTGTACTGG + Intergenic
1164519051 19:28963562-28963584 AACTTGCAACTGGTGACTGAAGG + Intergenic
1165071814 19:33260315-33260337 AAATTGTTCCTGGTGTCTAGTGG + Intergenic
1165551376 19:36589264-36589286 GACTTGCAACTGGTGTCTGAAGG + Intronic
1167830252 19:52013961-52013983 AAATTGCAAAAGCAGTCTAGAGG - Exonic
924981555 2:227013-227035 AGAATGCATATGGTGTCTAGTGG + Intronic
925645492 2:6031529-6031551 AGATTGTTACTGGTATCTAGTGG + Intergenic
928976647 2:37094329-37094351 AAAGTGCAACTGGTATCTGGTGG - Intronic
929884534 2:45866678-45866700 AAATAGCCACAGGTGGCTAGTGG - Intronic
932632230 2:73354887-73354909 AACTTGCAACTAGTGTCTGAAGG - Intergenic
933294975 2:80479336-80479358 GAGATGCTACTGGTGTCTAGTGG + Intronic
933364009 2:81325143-81325165 GACTTGCAACTGGTGTCTTGGGG - Intergenic
935242394 2:101190037-101190059 GACTTGCAACTGGTGTCTGAAGG + Intronic
935733142 2:106082827-106082849 AAAATGCAAGTGCTGTCTGGAGG - Intergenic
935960841 2:108424107-108424129 AAACTGCATCTGTTGTATAGTGG + Intergenic
936588256 2:113777894-113777916 AAAATGCTACTGGCATCTAGTGG + Intergenic
936997436 2:118430292-118430314 GAAATGCTACTGGTATCTAGTGG - Intergenic
937115911 2:119404853-119404875 AAACTGCCACTGGTGTTGAGTGG - Intergenic
938648109 2:133352023-133352045 AAAATGCAACTGGCCTCTGGAGG + Intronic
939061005 2:137421338-137421360 GAGTTGCAACTGGTGCCTGGAGG - Intronic
939211123 2:139176044-139176066 ACATTGGAATTGGTGTCCAGAGG - Intergenic
939563481 2:143759099-143759121 AAATTGCTACTGGTGTCTAATGG - Intronic
940108953 2:150129275-150129297 AATTTGCATCAGGTGTATAGTGG + Intergenic
940327590 2:152441991-152442013 AAATAGGAAATGGTGGCTAGGGG + Intronic
946165850 2:217863370-217863392 GAAATACTACTGGTGTCTAGTGG + Intronic
946735168 2:222746764-222746786 AAGATGCCACTGGTATCTAGTGG - Intergenic
1169230248 20:3883572-3883594 AAATAGCCACAGGTGTCTAGTGG - Intergenic
1170127739 20:12984814-12984836 AAATAGCCACTTGTGGCTAGTGG - Intergenic
1170409499 20:16073393-16073415 AAATTGCCACATGTGGCTAGTGG + Intergenic
1171092096 20:22294927-22294949 AAATGGCCACAGGTGACTAGTGG + Intergenic
1171321050 20:24244713-24244735 AAATTGCAGCTGGTGTCTGAAGG + Intergenic
1172590728 20:36116153-36116175 AAAATGCAACTGGAGTTTAGAGG + Intronic
1172595994 20:36151623-36151645 TAATTGCAACTGATGCCTATGGG + Intronic
1173113666 20:40219804-40219826 GAGTTGCCACTGGTATCTAGTGG + Intergenic
1174373598 20:50111231-50111253 AAATGTCAGCTGCTGTCTAGTGG - Intronic
1174622511 20:51886845-51886867 AAATTGCCACATGTGGCTAGTGG - Intergenic
1175564648 20:59963539-59963561 AAATTGCCACATGTGACTAGAGG - Intronic
1180610347 22:17092429-17092451 GACTTACCACTGGTGTCTAGGGG + Intronic
1181278180 22:21700003-21700025 AAATTGAGAATGGTGTCTAGTGG - Exonic
1182752366 22:32651902-32651924 GAATTGCTACTGGCATCTAGCGG + Intronic
1182852552 22:33488162-33488184 AAATTGCCACATGTGGCTAGTGG - Intronic
1184043735 22:41959168-41959190 CAATTGCAACTGGCATCTACTGG - Intergenic
1184133687 22:42533370-42533392 AATTTGCTACTGCTATCTAGAGG - Intergenic
1184136294 22:42551896-42551918 AATTTGCTACTGCTATCTAGAGG + Intergenic
949670304 3:6392317-6392339 AAACTGCTACTGGCATCTAGTGG - Intergenic
950648572 3:14393087-14393109 AACTTGAACCTGGTCTCTAGAGG - Intergenic
950823354 3:15787391-15787413 AATTTGAAACTGGAATCTAGAGG + Intronic
950829177 3:15858189-15858211 AAATTGCTACATGTGGCTAGTGG + Intronic
951011729 3:17689800-17689822 AACTTGCATCTGGTGAGTAGTGG + Intronic
952246074 3:31594353-31594375 GACTTTCAACTGGTGTCTGGGGG - Intronic
952497759 3:33930922-33930944 AAATTGTCACTGTTGTCTAATGG - Intergenic
953016036 3:39077270-39077292 CATTTGCAACTGGCGTCTACAGG - Intronic
953882449 3:46697684-46697706 GACTGGCAACTGGTGTCTTGGGG + Intergenic
954510948 3:51124426-51124448 AAATAGCAATTTGTGGCTAGTGG + Intronic
956407592 3:68944258-68944280 GAAATGCTATTGGTGTCTAGTGG - Intergenic
956617855 3:71190701-71190723 AAATTGCAGCTGTTTTCTAGTGG + Intronic
956658058 3:71571300-71571322 AAATTAAAACTGCTGTCTAATGG + Intronic
958657600 3:97022222-97022244 ATATAGCAATTGGTGTCTTGAGG + Intronic
962111348 3:132452538-132452560 AACTTGCATTTGGTGTCTAGAGG - Intronic
965757929 3:172043250-172043272 AAATTTCCACTTGTGGCTAGTGG + Intronic
966056459 3:175697172-175697194 AAATTTAAACTGGTCTCTAGAGG + Intronic
966531584 3:180987775-180987797 AAAGTGAAACTTGGGTCTAGTGG + Intronic
968404712 4:329951-329973 ATTTTGCTACTGCTGTCTAGAGG + Intergenic
968559119 4:1267818-1267840 ATTTTGCTACTGCTGTCTAGAGG + Intergenic
968963242 4:3756324-3756346 GAAGTGCTCCTGGTGTCTAGTGG + Intergenic
970529941 4:16971186-16971208 GACTTGCAACTGGTGTCTAAGGG - Intergenic
971789874 4:31155693-31155715 AAATAGCTACTTGTGGCTAGTGG - Intergenic
972757293 4:42061325-42061347 AAATTGCCACATGTGGCTAGTGG + Intronic
973676930 4:53273552-53273574 AAATTGAAAGAGGTGTCCAGAGG + Intronic
974086243 4:57264273-57264295 TATTAGCAACTGGTGTGTAGAGG - Intergenic
976264281 4:83175390-83175412 GAATTGCTACTGGCATCTAGTGG + Intergenic
976587481 4:86815235-86815257 AGATGGAAAGTGGTGTCTAGAGG - Intergenic
979085132 4:116399102-116399124 AAATTGCTAATGGTCTCTTGTGG + Intergenic
979782123 4:124665394-124665416 AAATTGCACCTTGTGTCCAAAGG - Exonic
981541648 4:145852720-145852742 ATAATGCTACTGGTATCTAGTGG - Intronic
982389734 4:154851300-154851322 AAATTGCAGCTGGGGGCAAGGGG + Intergenic
982545575 4:156728478-156728500 AAAATACAAATGTTGTCTAGGGG + Intergenic
986087075 5:4462474-4462496 AAAATGCTGCTGGTTTCTAGTGG + Intergenic
986468946 5:8054467-8054489 AAAATGTAGGTGGTGTCTAGGGG + Intergenic
987185164 5:15410149-15410171 AAATAGCAACATGTGGCTAGTGG - Intergenic
989170828 5:38469271-38469293 AAGATGCAAATGGTGTCCAGAGG + Intergenic
989748129 5:44856802-44856824 AAATTGCCACATGTGTCTAATGG - Intergenic
990355475 5:54962252-54962274 GACTTGCGACTGGTGTCTGGGGG - Intergenic
991378319 5:65989788-65989810 AAATAGCCACATGTGTCTAGTGG + Intronic
995379646 5:111517869-111517891 GACTTGAAACTGGTGTCCAGGGG + Intergenic
997018392 5:129965047-129965069 AAATTCCAACTGATGTCATGAGG - Intronic
998833708 5:146184409-146184431 AAATTGCCACATGTGGCTAGTGG - Intergenic
999094986 5:148969761-148969783 ACATGGCAACTGGCTTCTAGTGG - Intronic
999329324 5:150662020-150662042 ATTGTGCAACTGGAGTCTAGTGG - Intronic
999841010 5:155426478-155426500 AAATTCCTACTGGCATCTAGTGG - Intergenic
999935626 5:156482978-156483000 AAACAGCATCTGGTGGCTAGAGG - Intronic
1000645666 5:163757405-163757427 GACTTGTAACTGGTGTCTGGGGG + Intergenic
1003197511 6:3928238-3928260 GGAGTGCTACTGGTGTCTAGTGG - Intergenic
1003438802 6:6121041-6121063 AAGTTGGAACTGGGGCCTAGTGG + Intergenic
1005945530 6:30592647-30592669 AAAATGCAAATGGTGGGTAGTGG + Intronic
1008537007 6:52514039-52514061 AATATGCTACTGGTATCTAGTGG - Intronic
1009518700 6:64654369-64654391 AACATGCTACTGTTGTCTAGAGG + Intronic
1011047126 6:83096941-83096963 AGTTTGGAACTGGTCTCTAGTGG + Exonic
1011780908 6:90788464-90788486 GAAATGCTGCTGGTGTCTAGTGG - Intergenic
1012491464 6:99787340-99787362 GAAATGCAACTGGCATCTAGTGG - Intergenic
1015417699 6:132968529-132968551 AAATTGCTACTGGCATCTACTGG + Intergenic
1015812961 6:137179444-137179466 AAAGTGCAAATGCTGTCTATGGG - Intergenic
1018181610 6:161228089-161228111 AAATTGGAATTTGTGTCCAGGGG - Intronic
1018340977 6:162850868-162850890 GACTTGCAAATGGTGTCTGGGGG + Intronic
1021487722 7:21185226-21185248 AAATTGCAAGTGGTTTCAAAAGG + Intergenic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1023265454 7:38400455-38400477 AAATTTAAACTGGTGTTTAGGGG - Intronic
1023592021 7:41790677-41790699 AAATGCCAACTGGTGTCCAGGGG + Intergenic
1023594749 7:41817091-41817113 AACTTGTGACTGGTGTCTAAAGG - Intergenic
1026462099 7:70623439-70623461 AAATAGCCACAGGTGGCTAGTGG - Intronic
1027496592 7:78894629-78894651 AAATTTAAACTGGTTTCTTGGGG - Intronic
1028971379 7:96862534-96862556 AAATAGCCACAGGTGGCTAGCGG + Intergenic
1031137127 7:117897027-117897049 GGAGTGCTACTGGTGTCTAGAGG - Intergenic
1031994343 7:128219403-128219425 AAATTGTAAATGGTGTCTTCAGG - Intergenic
1032288439 7:130563003-130563025 AAATAGCCACTGGTGGCTAATGG + Intronic
1033961920 7:146924273-146924295 AAGTTGATCCTGGTGTCTAGAGG + Intronic
1035866129 8:3084109-3084131 AAATTGCATATGGTGTGTTGTGG - Intronic
1038569524 8:28648592-28648614 AAATTGGAAGTGGTGCATAGTGG - Intronic
1038608545 8:29036134-29036156 AATTGGCAAGTGGGGTCTAGTGG + Intronic
1042162024 8:65905997-65906019 AAAGTGCTACTGGTATCTAGTGG - Intergenic
1043654506 8:82645713-82645735 GGTTTGCAACTGGTGTCTGGGGG - Intergenic
1047638965 8:126797724-126797746 GGATTGCCACTGGTGTCTAGTGG - Intergenic
1048610949 8:136022571-136022593 TAATTGCTACTGGTATTTAGTGG + Intergenic
1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG + Intergenic
1050673408 9:8024126-8024148 AAACTGGAACTGGTGTGTTGGGG - Intergenic
1052480083 9:29012865-29012887 AAATTGCAGGTGGTTTCTAGTGG - Intergenic
1052629618 9:31020539-31020561 AGATAGAAATTGGTGTCTAGGGG + Intergenic
1052949087 9:34193519-34193541 GACATGCAACTGGTGTCCAGGGG - Intronic
1053559780 9:39179194-39179216 ATATTGCAGCTGGAGTCCAGAGG - Intronic
1053823891 9:41999438-41999460 ATATTGCAGCTGGAGTCCAGAGG - Intronic
1054137336 9:61439749-61439771 ATATTGCAGCTGGAGTCCAGAGG + Intergenic
1054606681 9:67187929-67187951 ATATTGCAGCTGGAGTCCAGAGG + Intergenic
1056651229 9:88465442-88465464 AAATAGCAACTGCTGACTAAGGG - Intronic
1057301033 9:93882442-93882464 AAAGTGCATATGGTCTCTAGAGG + Intergenic
1057568533 9:96185792-96185814 AGATTGCTACTGGTGTGTAGTGG - Intergenic
1058888032 9:109337687-109337709 AAATAGCCACAGGTGGCTAGTGG - Intergenic
1186255062 X:7709190-7709212 GACTTGCAACTGGTGTCTCAGGG + Intergenic
1186694117 X:12011455-12011477 CAATAGCCACTTGTGTCTAGTGG + Intergenic
1186844741 X:13519354-13519376 AAAGTGCTACTGGAATCTAGTGG + Intergenic
1186966203 X:14788655-14788677 AAATAGCTACTTGTGGCTAGTGG - Intergenic
1187109515 X:16282411-16282433 AGATTGCTACTGGCATCTAGTGG + Intergenic
1187247307 X:17564326-17564348 ACAGTGCAACTGGCATCTAGTGG - Intronic
1188673204 X:32905830-32905852 TGTTTGCTACTGGTGTCTAGTGG - Intronic
1189139521 X:38587090-38587112 AAGGTGCAACTGGCATCTAGTGG + Intronic
1189821167 X:44872056-44872078 AAAATGTTACTGTTGTCTAGGGG + Intergenic
1190116520 X:47629262-47629284 GAATTGCTACTGGCATCTAGTGG + Intronic
1192345397 X:70299492-70299514 AAATAGCCACTTGTGGCTAGTGG - Intronic
1193862613 X:86688960-86688982 AAATAGCCACAGGTGACTAGTGG + Intronic
1196112306 X:111959996-111960018 AAATAGCCACTTGTGGCTAGTGG - Intronic
1198998652 X:142606556-142606578 AATTTGCTACTGCTATCTAGAGG + Intergenic