ID: 1137649909

View in Genome Browser
Species Human (GRCh38)
Location 16:50110864-50110886
Sequence GAAAATGCTAAGATGACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137649903_1137649909 30 Left 1137649903 16:50110811-50110833 CCTGCATAAATGGATGAACTGGT No data
Right 1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137649909 Original CRISPR GAAAATGCTAAGATGACGCT TGG Intergenic
No off target data available for this crispr