ID: 1137655234

View in Genome Browser
Species Human (GRCh38)
Location 16:50153456-50153478
Sequence CGCGGGCGGCGCGGTCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137655234_1137655245 10 Left 1137655234 16:50153456-50153478 CCTGCGCGACCGCGCCGCCCGCG 0: 1
1: 0
2: 4
3: 41
4: 297
Right 1137655245 16:50153489-50153511 AGCAGCAGCAGCAGCAGCAGCGG 0: 59
1: 141
2: 346
3: 787
4: 2457
1137655234_1137655246 19 Left 1137655234 16:50153456-50153478 CCTGCGCGACCGCGCCGCCCGCG 0: 1
1: 0
2: 4
3: 41
4: 297
Right 1137655246 16:50153498-50153520 AGCAGCAGCAGCGGCAGCAGCGG 0: 7
1: 73
2: 218
3: 657
4: 1828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137655234 Original CRISPR CGCGGGCGGCGCGGTCGCGC AGG (reversed) Intronic
900191721 1:1354967-1354989 GGCGGTCCGCGCGGTCGTGCGGG + Exonic
900307734 1:2019319-2019341 CGAGCGCGGCGCGGGCGCGAGGG - Exonic
900413912 1:2526418-2526440 CGCGGGCTGCGGGGGCGGGCGGG - Intronic
900513054 1:3069412-3069434 CCCGGGCCGCGCGGCCGAGCCGG - Intronic
901007699 1:6179842-6179864 CGGGGGCGGCGCGGCCGGGCTGG - Intronic
901433872 1:9234704-9234726 CGGGGGCGGGGCGGGGGCGCCGG - Intergenic
901629028 1:10639250-10639272 CGGGGGCGGCGGCGTCGGGCGGG + Exonic
901641207 1:10694103-10694125 CTCAGGCGGCGCGGACCCGCGGG - Intronic
901641510 1:10695202-10695224 CGCGGGGTGCGGGGGCGCGCGGG - Intronic
902044289 1:13513596-13513618 CGCGGCCGGCGCGGGCCCCCCGG - Exonic
902286235 1:15410287-15410309 GGCGGGGGGCCGGGTCGCGCGGG - Intronic
902444387 1:16452760-16452782 GGCGGGCGGGGGGGGCGCGCGGG - Intronic
903044289 1:20553887-20553909 CGCGGGCGGCGGGGGCGCCGGGG - Exonic
905179163 1:36156043-36156065 CGCGGACGGCGCGGGCGCGGGGG + Intronic
906078412 1:43068405-43068427 CGGGGGCGGCGGGGGCGGGCTGG + Intergenic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
911114880 1:94237176-94237198 CGAGGGAGGCGCGGACGAGCTGG - Intronic
911626798 1:100133176-100133198 CGCGTGCGGCGACGTCGCGGAGG - Exonic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
914361421 1:146939083-146939105 CGCGAGCGGGGCGGTTGCGCCGG + Intronic
914491184 1:148151627-148151649 GGCGAGCGGGGCGGTTGCGCCGG - Intronic
916106989 1:161440250-161440272 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916108550 1:161447664-161447686 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916110138 1:161455045-161455067 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916111723 1:161462455-161462477 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916113310 1:161469836-161469858 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
918487497 1:185045321-185045343 CCAGGGCGGGGCGGTGGCGCGGG + Intergenic
920655206 1:207869179-207869201 CGTGGGAAGCGCGGGCGCGCGGG - Intergenic
923650134 1:235866500-235866522 CGCGGGGGGCGAGGTCGAGCAGG - Intronic
924527075 1:244863059-244863081 CGCGGGGAGCGCGGGCCCGCGGG - Intronic
1062843863 10:689929-689951 CGCGGGGCGCGAGGACGCGCAGG + Intergenic
1063458507 10:6201562-6201584 CCCGGGTGGGGCGGGCGCGCGGG + Intronic
1065573970 10:27100236-27100258 CGCGGGAGGCGGGGGCGAGCCGG - Exonic
1065727263 10:28677869-28677891 CGGGGGCGCCGCGGCCGTGCGGG + Exonic
1066429368 10:35336956-35336978 CGCGGGCGGCGGGGGCGTGTGGG - Exonic
1066464234 10:35639512-35639534 CGCGGGCGCCACGGCCGCGGGGG - Exonic
1070800745 10:79243257-79243279 CGCGGGGGGCGGGGGCGCACGGG - Intronic
1071997658 10:91163267-91163289 GGTGGGCGGCGCGGCCGGGCTGG + Intronic
1072169792 10:92848422-92848444 CGGGGGCGGGGCGCTCGGGCCGG - Intronic
1072562182 10:96586702-96586724 CCCGGCCGGCGCGGCCGCCCCGG - Intronic
1073216569 10:101839923-101839945 CGTGGGCGGCGCGGGAGGGCCGG + Intronic
1074377494 10:112951641-112951663 GGCGGGCGGCGCGGGCGGGCGGG - Intronic
1074591927 10:114821886-114821908 CGCGGGCGGCTCGGCGGCTCCGG - Exonic
1075519718 10:123136290-123136312 CGCGGGCTTCGCGCTCTCGCAGG + Exonic
1075519764 10:123136483-123136505 CGGGGACGGGGCGGGCGCGCAGG - Intronic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1076384509 10:130046746-130046768 AGCGGGCGGCGTGGGCGAGCTGG - Intergenic
1076792915 10:132786241-132786263 CGCGGGCGGGGGGGGGGCGCCGG - Intergenic
1076792926 10:132786258-132786280 CGCGGCCGGCGGGGGCGCGCGGG - Intergenic
1076880347 10:133236671-133236693 CGCGGGCGGCGTGGGCGCTGAGG + Intergenic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077107995 11:850145-850167 CGCGGGCGGCGGGGACGCCGGGG + Intronic
1078594421 11:12674490-12674512 GGCGGGCGGCGGGGCCGCGGCGG - Intergenic
1080012361 11:27472090-27472112 TGCGGGCGGCGGGGACGCGAGGG - Intronic
1080383928 11:31799338-31799360 CGCCGGCCGAGCGGCCGCGCTGG + Intronic
1080503832 11:32893343-32893365 GGTGGGCGGCGGGGTCGCGGTGG + Intronic
1083672160 11:64305708-64305730 CTCCGGCAGCGCGGTCGGGCAGG - Intronic
1083747640 11:64744651-64744673 CCAGGGCGGCGCGGGCGGGCTGG - Intronic
1083891849 11:65599524-65599546 AGGGGGCGGCTCGGTCGGGCAGG + Exonic
1083922135 11:65786822-65786844 CCCGGGCGGGGCGGCCGGGCGGG - Intergenic
1084124465 11:67089891-67089913 GCCGGGCGGCGCGGTGGCTCAGG + Intergenic
1084296230 11:68214458-68214480 CGCAGGCGGCCCGGTCCCTCAGG - Intergenic
1084636809 11:70398477-70398499 GGCAGGGGGCGGGGTCGCGCGGG + Intronic
1086337142 11:85811191-85811213 GGCGGGCGGTGCGGTGGGGCCGG + Intergenic
1088314924 11:108498100-108498122 CCCGGGCGGCGGGGACGCGCGGG + Intronic
1090048681 11:123358590-123358612 CCCGAGCGGCGGGGTCGTGCTGG - Intergenic
1090636692 11:128694297-128694319 CGCGGGCGGCGGGGACCGGCCGG + Intronic
1096336922 12:50763957-50763979 CGTGGGCAGCGCGGTGACGCAGG + Intronic
1100963111 12:99984873-99984895 CGCGGGGGGCGTGTGCGCGCGGG + Intergenic
1101716962 12:107319897-107319919 CGCGGCCGCCGCAGTCCCGCCGG + Exonic
1101910543 12:108857593-108857615 CGCGGGCGGCCGGGCCGAGCCGG + Intergenic
1102025977 12:109714513-109714535 CGCGGGCGGAGAGGGCGCCCTGG + Exonic
1102026009 12:109714637-109714659 CGGGGGCCGCGCGGGCGCTCAGG - Exonic
1103749780 12:123150868-123150890 AGCAGGCGGCGGGGGCGCGCGGG - Intergenic
1107086287 13:36431410-36431432 GGCGGGCGGCCCGGCCGCGTGGG - Intergenic
1108541988 13:51453351-51453373 CGCGCGCGGGGCGGCCGCGGCGG + Intronic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1113417343 13:110138510-110138532 GGCGGGCGGCGCGCGCGCCCAGG + Intergenic
1115474416 14:33800062-33800084 CGCAGGCGAGGCGGGCGCGCAGG + Exonic
1115576252 14:34714697-34714719 AGCGGGCGGGGCGGTCACGTGGG + Intronic
1116018247 14:39432076-39432098 CCCGGGTGGCGCGGTGGCGGCGG - Exonic
1116152112 14:41154417-41154439 TGAGGGCGGCGCGGGCGAGCCGG + Intergenic
1119223827 14:72929064-72929086 TGCGGGCGGCACGGACGCCCGGG + Intronic
1120881307 14:89417034-89417056 CGCGGGCGGCAGGGGCGCGGGGG + Intronic
1121226207 14:92323531-92323553 CGCTGGCGGCCCGGGCTCGCAGG - Intronic
1121368033 14:93332674-93332696 CGCGGGAGGCGCTGGGGCGCCGG - Intronic
1121616985 14:95319915-95319937 CGCGGGCGGGGCGCGGGCGCGGG + Intergenic
1122162330 14:99793426-99793448 CGGCGGCGGCGCGGCCGGGCCGG + Exonic
1122582079 14:102777383-102777405 CGCGGGCGGCGGGGGCGGGGCGG + Intergenic
1122602460 14:102928509-102928531 CGCGGGTGAGGCGGTCGGGCAGG + Exonic
1122978569 14:105181101-105181123 CGCGGGGGACGCGGGGGCGCGGG + Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124469210 15:29968566-29968588 GGCGGCCGGGGCGGTCGGGCGGG - Intronic
1125674758 15:41495964-41495986 GGAGGGCGGCGGGGTCGCCCAGG - Intronic
1126668425 15:51094703-51094725 CGCGGGCGGCGCGGGCTGGGCGG + Intronic
1128501404 15:68229696-68229718 CGAGGGCCGCGCGCTCTCGCCGG - Exonic
1130076677 15:80695584-80695606 CGGGGCCGGGGCGGACGCGCCGG - Exonic
1130335298 15:82952728-82952750 CGGGGGCTGGGCGGCCGCGCTGG + Exonic
1130955001 15:88621403-88621425 CCGGGGCGGCGGGGTCGGGCGGG + Intronic
1131517614 15:93089323-93089345 CGCGGGCGGGGGGCGCGCGCGGG + Intergenic
1132111521 15:99105329-99105351 CGCGGCCGGCGCGGGCGAGAGGG + Exonic
1132255553 15:100373440-100373462 GGCGGAGGGCGCGGGCGCGCGGG - Intergenic
1132596286 16:751964-751986 CACGGGCTGCGAGATCGCGCAGG + Intronic
1132683605 16:1153411-1153433 CCCGGGCGGCGCGGTCACCGCGG - Exonic
1132741333 16:1414759-1414781 CGCGGGGGGCGTGGCCGCGGGGG - Intergenic
1132885113 16:2179087-2179109 CACGTGCAGCGCGGGCGCGCCGG + Exonic
1134149832 16:11797057-11797079 CGCGGGGGGGGCGGGGGCGCGGG + Intronic
1135517656 16:23149127-23149149 CGCGGCCGGCCCGGACGCCCCGG + Exonic
1136247481 16:28984251-28984273 CGCGGGTGGAGCGGCCCCGCTGG - Exonic
1136428180 16:30183176-30183198 CGCGGGGGGCGCGGGCGAGGAGG - Intronic
1136455628 16:30378316-30378338 CGCGGGTGCCGCCCTCGCGCGGG - Exonic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1140927614 16:79599275-79599297 CGCGGGCAGCGCGGCCGCCTCGG - Exonic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1141957798 16:87383951-87383973 CACGGGCGGCGCCCTCACGCTGG - Intronic
1142005980 16:87689811-87689833 CGCGGGCGGCGGGGTGGCCGCGG - Exonic
1142136348 16:88453562-88453584 GGCGGGCGGCGGGGGCGCGGCGG - Exonic
1142271830 16:89093909-89093931 CGCGCGCGCCGGGGTCGGGCCGG - Exonic
1142434414 16:90047603-90047625 CGCGGGCGTCGCAGTCCGGCAGG - Intergenic
1142631369 17:1228751-1228773 GGCGCGCGGCGGGGTCGAGCGGG + Intronic
1142876308 17:2853683-2853705 CGCGGGCGGCGCGTCTGAGCGGG + Intronic
1143223751 17:5282675-5282697 CGAGGGCGGCGCGGGCGCCCCGG + Intronic
1144057772 17:11557794-11557816 CGCGGGCAGCCAGGTCGGGCAGG - Exonic
1145031315 17:19507359-19507381 CGCGGGGGACGCGGGGGCGCGGG - Intronic
1145912802 17:28552308-28552330 CGCGGGCGGCGCTCCCTCGCGGG + Intronic
1145937987 17:28726289-28726311 GGCGGGCGGGGCGGGGGCGCGGG - Intronic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146439041 17:32877279-32877301 CCTGGGCGGCGCGCACGCGCGGG + Intergenic
1146794273 17:35770149-35770171 CGCGCGCGGCGCGGGCGAGTGGG + Exonic
1147440334 17:40443671-40443693 GGCGGGGAGCGCGGGCGCGCGGG - Exonic
1148090259 17:45019094-45019116 CGAGGGCGGCGCGGGCGGCCCGG + Intergenic
1149461461 17:56833434-56833456 CGCGGGCGAGGGGGTAGCGCAGG + Intronic
1149490970 17:57085137-57085159 GGCCGGCGGCGCGCACGCGCAGG + Intronic
1151783818 17:76265565-76265587 CGCGGGCTGCGCGGCCGACCAGG + Exonic
1152349801 17:79778201-79778223 GGCGGGCGCCGCGGTCGGGCTGG + Exonic
1152360982 17:79832851-79832873 GGTGGGCGGCGCGGACACGCGGG - Intergenic
1152627311 17:81393642-81393664 CTCGGGAGTGGCGGTCGCGCGGG - Intergenic
1152628603 17:81399646-81399668 CGCGGGCGGCGCAGAGGCGGCGG - Exonic
1153596467 18:6729963-6729985 CCAGGGCGGCGCAGTCGCGCTGG + Intronic
1156171703 18:34493858-34493880 CGCGGCCGGCGCCGGCGCACAGG - Intronic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1158954763 18:62526838-62526860 CGGGGGCGGGGCCGGCGCGCCGG - Intronic
1160453184 18:78979285-78979307 AGCGGGCGGGGCGGGCGCTCCGG + Intergenic
1160668351 19:344280-344302 CGCGGGCGGCGGAGGCGCGGTGG + Intronic
1160668519 19:344716-344738 GGCGGGGGGCGCGGACGCGCGGG + Intronic
1160696814 19:488946-488968 GGCGGGCGGCGCGGACGCCCTGG - Intergenic
1160858978 19:1229708-1229730 CGCGGGCTGCGGGGCCGGGCGGG + Exonic
1160991866 19:1863397-1863419 CGCGGGCGGCCCGGCCCCGAGGG - Exonic
1161063899 19:2228259-2228281 CGCGGACGGCCCCGTGGCGCTGG - Intronic
1161175826 19:2841718-2841740 CGCGGGAGGCGGGGCCGGGCGGG - Intronic
1161233233 19:3186005-3186027 GGCCGGCGGCGGGGCCGCGCGGG - Exonic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161388106 19:4007673-4007695 CGCGGGCGGGGCCGCCGCCCGGG - Exonic
1161487525 19:4543915-4543937 CGTGGGAGGCGCGGCCGGGCCGG + Exonic
1161959551 19:7516202-7516224 GGCGGCCGGCGCGGGCGCGGCGG + Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162470951 19:10871735-10871757 CGCGGGCGGCGCGGGGTCGGCGG + Exonic
1162809119 19:13153761-13153783 CGCGGGCGGCGCCGTCGGAGGGG - Exonic
1163118365 19:15201056-15201078 GGCGGGGGGCGGGGGCGCGCTGG - Intergenic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163757884 19:19117521-19117543 CGCGGTGGGCGCGGTGGCTCAGG + Intergenic
1163807055 19:19405831-19405853 GGCCGGCGGCGCGGGCGGGCGGG + Intronic
1163843931 19:19628223-19628245 CGCGGGAGGCGGGGTCTCCCCGG + Intronic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1166121628 19:40690490-40690512 CGCGGGAGGCGGGGGCGCCCGGG - Exonic
1166857970 19:45792627-45792649 TGCGAGCGGCGCCGTCGCCCGGG + Exonic
1166869751 19:45864224-45864246 CGAGGGCGGCGCGCTCGGACTGG - Intronic
1166891321 19:45995514-45995536 CGCGGGAGTGGCGGTTGCGCGGG + Intronic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1168076382 19:53982725-53982747 CGCGGGCGGGGCGGGCGGCCCGG - Exonic
1168297331 19:55383807-55383829 GGCGGGCGGCGGGGGCGCGCGGG + Exonic
1168307314 19:55442647-55442669 CGCGGGCGGGGCGGGCGCGGCGG - Exonic
1168332679 19:55579249-55579271 CGCGGGCGGCGAGGTCGAGCTGG - Exonic
925155918 2:1648909-1648931 CGTGGGCGGCCCGGTGGCGAAGG + Exonic
926285316 2:11482988-11483010 AGCGGGCGGAGCGGGGGCGCGGG + Intergenic
926727981 2:16013345-16013367 CGCGGGCGGCGTTGTCGCGGTGG - Intergenic
927751429 2:25673633-25673655 CCCCGGCCGCGCGCTCGCGCTGG - Exonic
927929115 2:27032949-27032971 AGAGTGCGGCGCGCTCGCGCCGG + Exonic
927935062 2:27071706-27071728 GGCGGGGGGCGCGGTCGGGACGG + Exonic
927943317 2:27119064-27119086 CGCGGGCGCAGCGGGGGCGCTGG - Exonic
927971209 2:27307193-27307215 CGAGGGCGGGGCGGTGGTGCCGG + Exonic
928093767 2:28392157-28392179 AGCGGGCGCCCCGGGCGCGCAGG - Intergenic
930089416 2:47520951-47520973 CTCGGGCGGCGTGGGCGCGCTGG - Exonic
932757908 2:74421674-74421696 CGCGGGCGGCGCGGTTGCCGGGG - Intronic
935622896 2:105144296-105144318 CTCGGGCGGTGCCGGCGCGCGGG + Intergenic
940883316 2:158968509-158968531 CGCGGGAGGCGCGGCCGGGGCGG + Intergenic
941808635 2:169734185-169734207 CGCGGGCAGCGAGGCCGCGCGGG + Intronic
942368664 2:175257188-175257210 CGCGGGCGGGCCGGTAGTGCTGG + Intergenic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
942928123 2:181457465-181457487 CGCGGGCGGAGCGTTCGGGCCGG - Exonic
942965772 2:181891661-181891683 CGCGCGGGGCGCGGTAGGGCGGG - Intergenic
945080925 2:206085669-206085691 CGCGGGCGGCGACGGCGGGCGGG - Intronic
947765211 2:232633534-232633556 GGCGGGCGGGGCGGTCGGGGCGG - Exonic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
948945700 2:241217977-241217999 CGGGGGCAGCGGGGGCGCGCAGG + Intronic
948958558 2:241314985-241315007 CGCGGGCGGCTCCGGCCCGCGGG - Intronic
1168804423 20:664150-664172 CGCGGGGCGCGCGGGGGCGCAGG - Exonic
1168804445 20:664204-664226 CGGGGGCGGCGGGGACGCGGGGG - Exonic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169278480 20:4248843-4248865 CGCGGGCGGCGCGGCCCCCTCGG - Exonic
1173548129 20:43914739-43914761 CGCGGGCGGGGCGGGGGCGGGGG + Intergenic
1173791933 20:45833752-45833774 CTCGGGCGGCTCGGGCGAGCGGG + Intergenic
1173803977 20:45912093-45912115 GGGGGGCGGCGCGGTCACGTGGG + Intronic
1174449277 20:50609662-50609684 TGCTGGAGGCGCCGTCGCGCAGG + Exonic
1174812654 20:53660279-53660301 CGCGGGCGGCGTGGACGCTGCGG - Intergenic
1175429476 20:58891544-58891566 CGCGGGGCGCGCGGACGGGCGGG - Intronic
1175997088 20:62816841-62816863 GGCGGGCGGCGCGTTCTCTCCGG - Intronic
1176156941 20:63626810-63626832 CGGGGGAGGGGCGGCCGCGCGGG - Intronic
1176234482 20:64048100-64048122 CGCGGTCGGATCGGTCGCGGGGG + Exonic
1176566745 21:8392040-8392062 CCCGGGCGGGGCGGGCGCGCCGG + Intergenic
1178351093 21:31873511-31873533 CGCGGGGGGCGTGATCGCGGCGG + Exonic
1179968065 21:44818222-44818244 CGCGCCCGACGGGGTCGCGCGGG - Intronic
1180090306 21:45530882-45530904 CGCGGGCGTCACGGCCACGCAGG - Exonic
1180092878 21:45541986-45542008 CGCGGGGGTCGCGGTGGCCCGGG - Intronic
1180093250 21:45543007-45543029 GGCGGGCGGCGGGGTCCCGGGGG - Intronic
1180187241 21:46145832-46145854 CGGGGGCGGCTCGGTGGCGGCGG - Exonic
1180650048 22:17369795-17369817 GGAGGGCGGCGCGGCCGGGCTGG + Exonic
1181283446 22:21735916-21735938 CGCGCGGGGCGGGGGCGCGCGGG - Intergenic
1181457967 22:23070371-23070393 GGCGGGCGGCGCGGGAGGGCGGG + Exonic
1181457976 22:23070412-23070434 CGCGGGCGGCGCACACGCTCCGG - Exonic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1183444426 22:37843880-37843902 CGCGAGCGGCGCGGGGGCCCGGG - Intronic
1183780241 22:39994861-39994883 CGCGGGCGTGGCCGTCGGGCGGG - Intergenic
1184034109 22:41910491-41910513 CGCGGGCCGCGCGGGGGCCCCGG + Exonic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184557423 22:45240890-45240912 CGCGGGCGGCGGCGGCGCGGAGG - Intergenic
1184568880 22:45309901-45309923 CGCGGCTGGGGCGGGCGCGCGGG + Intronic
1184593913 22:45502990-45503012 AGCGCGCCGCGCCGTCGCGCCGG + Exonic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185374115 22:50474482-50474504 TGGGGGCGGCGTGGCCGCGCGGG - Intronic
949105859 3:198358-198380 CGCGCACGGCGCGTTCCCGCGGG - Intronic
952377802 3:32781575-32781597 AGCGGCCGGCGCGGCGGCGCCGG + Intergenic
953404720 3:42654641-42654663 CGGGGGCAGCGCGATCCCGCGGG + Intronic
954367704 3:50155172-50155194 CCCGGGCCGGGCGGCCGCGCTGG - Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
961252691 3:125520204-125520226 CGCGGGCGCGGCGGCGGCGCAGG - Intergenic
962808878 3:138945715-138945737 CGCGGGCGCCGGGGGCGCGGCGG + Exonic
963234988 3:142947507-142947529 CGCAGGCGGCGGGGTCGGCCTGG - Intergenic
964452594 3:156826311-156826333 GACTGGCGGCGCGGTCGCCCGGG + Intronic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
967795375 3:193593353-193593375 CGCCGGCGGGGAGGTCACGCAGG - Exonic
968010437 3:195270849-195270871 CGCGGGCGGCGAGGGCGCGGCGG + Exonic
968729223 4:2261858-2261880 GGCGGGCGGCGGGGCCGTGCCGG - Intronic
968965569 4:3767548-3767570 CGCGGGCGGTGCGGACGGGCAGG + Exonic
969715854 4:8867795-8867817 TGGGGGCGGCGCGGGCGCGGCGG + Exonic
970574567 4:17414463-17414485 CGAGTGCGGCGCGGGCGGGCAGG + Intergenic
975622072 4:76306234-76306256 CGCGGGCGTCGGTGACGCGCGGG - Intronic
975701911 4:77075410-77075432 CGCGGCCGGCGTCGACGCGCTGG - Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
977536569 4:98261392-98261414 TGCAGGCGGCGCGGCCGCGGCGG - Intronic
980930277 4:139177434-139177456 CGAGGGCGGCGGGGCCCCGCGGG - Intergenic
981429843 4:144646007-144646029 CCCGGGGGACGCGCTCGCGCGGG + Exonic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
984155881 4:176195614-176195636 TGCTGGCGGCGCGGTCTCGTGGG + Exonic
985549186 5:524558-524580 CGCGGGCGGGGCGGGCGTGCCGG - Intergenic
985550201 5:528827-528849 CCGGGGCGGCGCGGTCCCTCCGG - Intergenic
985595164 5:784698-784720 CGCGCGCGGCCGGGTCGCGGGGG - Intergenic
985727549 5:1523986-1524008 CGTGGGCGGAGCGGGAGCGCCGG + Intergenic
985749825 5:1667580-1667602 CGCGCGGGGCGGGGGCGCGCAGG + Intergenic
986330703 5:6714210-6714232 CGCGGCGGGCGCGGTGGGGCCGG - Intergenic
987373719 5:17216738-17216760 CGGGGGAGGCGCGGTCGCCGAGG - Intronic
990041501 5:51383085-51383107 CGCAGGCGGCGCGGCCGGGAAGG + Intergenic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
993901166 5:93584951-93584973 CGCGGGGCGCGCGGGCGCGCTGG - Exonic
997302108 5:132813762-132813784 TGCGGGCGGCGCGGCCCCGCGGG - Exonic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1001395899 5:171419593-171419615 CGCGGGCGGCGAGGGGGCGGGGG - Intergenic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1002888247 6:1313676-1313698 CGCGTACGGCGCGGGCGAGCCGG + Exonic
1003290857 6:4776857-4776879 GTCGGGCGGCGCGGCCGGGCCGG - Intronic
1003569472 6:7246761-7246783 CGCCGGGGGCGCGGCCTCGCAGG + Exonic
1003942653 6:11044304-11044326 CGCGGGCGCCGAGATAGCGCCGG - Exonic
1004216781 6:13711251-13711273 CGGGGGCGGCGGGGCCGCGGTGG + Exonic
1004216935 6:13711763-13711785 CGGGGGCGACGCGGGAGCGCGGG + Intergenic
1005327883 6:24720256-24720278 TGCGGGCGGAGCGGTGGCGGCGG + Exonic
1006351088 6:33521692-33521714 CGCGGGCGGCCCGGCAGTGCTGG + Intergenic
1006477155 6:34263688-34263710 AGCGGGCGGCGCGGCGGCGTCGG - Intergenic
1006860703 6:37170115-37170137 CGCCGGCGGGGAGGGCGCGCGGG - Intergenic
1008932550 6:56955220-56955242 CGCGGACGGCGCGGACTGGCGGG - Intronic
1010249877 6:73696307-73696329 CGGGGGGCGCGCGGGCGCGCGGG + Intronic
1011734260 6:90296399-90296421 TGCGGGGGGAGCGGGCGCGCGGG - Intronic
1015440407 6:133241192-133241214 CGCGGGGGGCGGCGGCGCGCGGG - Intronic
1016992264 6:149938436-149938458 CGCGAGCGGCGGGGTCGGGGAGG + Intergenic
1017007462 6:150038176-150038198 CGCGAGCGGCGGGGTCGGGGAGG - Intergenic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019486102 7:1290053-1290075 GGCGGGGGGCGCGGTGGGGCTGG - Intergenic
1019828199 7:3301165-3301187 CGCGGGCGGCGCGTGCGGCCGGG + Intergenic
1020234986 7:6348515-6348537 CGCGGGCGAGGCGGGCGCTCGGG + Intronic
1021983670 7:26079117-26079139 CGCGGGCGGTGTGGGCGCGTCGG - Intergenic
1022096271 7:27143362-27143384 GGCGGGCGCCGCGCTGGCGCTGG + Exonic
1023881938 7:44325671-44325693 GGCGGGCGGGGCGGGCGCGGCGG - Intronic
1023918298 7:44606903-44606925 GGCGGGCTCCGAGGTCGCGCGGG + Intronic
1027138245 7:75639317-75639339 CGGGGGAGGCGCGGCCCCGCCGG + Intronic
1027232581 7:76281484-76281506 CGCGGGCGGCGTGGGTGCGGCGG - Exonic
1029360100 7:100082023-100082045 GGCGGGCGGCGGGGGCGCGCGGG + Intronic
1029457217 7:100677425-100677447 CGCGGGCTGCGGGGTGGGGCAGG + Intronic
1029536998 7:101162953-101162975 CGCGCGCGGCGGGGGCGCGCGGG + Exonic
1029735707 7:102464827-102464849 CGCGGACGGCGCGATGGCGGCGG - Exonic
1031051852 7:116953369-116953391 CGCGCGGGCCGCGGGCGCGCCGG - Exonic
1031997244 7:128240927-128240949 CGCGCGGGGCGCGGTCGGGGCGG - Intergenic
1032174560 7:129612307-129612329 GGCGGGCGGCGCGGTGGGGCCGG + Intronic
1033033161 7:137846592-137846614 CGAGGGCGGCGCGGACCCGCGGG - Exonic
1034414721 7:150958401-150958423 CGCGGGCGGCGCGGGCGCCCCGG - Exonic
1035581040 8:738986-739008 CGGCGGCGGCGGCGTCGCGCAGG - Intergenic
1035752007 8:2002733-2002755 CGCAGGCGGCGGGGCCGAGCGGG + Exonic
1036928638 8:12931480-12931502 CGAGAGCGGCGCGGGCGGGCCGG + Intergenic
1037897662 8:22668929-22668951 CTGGGGCGGAGGGGTCGCGCGGG + Intronic
1038798161 8:30727604-30727626 CGGGGGCGGCTCGGGCGGGCTGG - Exonic
1039864590 8:41490299-41490321 TGCGGCCGGCGCGAGCGCGCGGG - Intergenic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1041686840 8:60652269-60652291 CGCGCGCCGCGCGGCCCCGCAGG - Intergenic
1043388185 8:79768092-79768114 CGCGGGCGGCGGGGAGGCGCGGG + Intergenic
1044988715 8:97776504-97776526 TGCGGACGGAGCGGTCGCGGAGG + Intronic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1045510150 8:102807166-102807188 CGGGGGCGCCTCGGGCGCGCTGG - Intergenic
1048553962 8:135457583-135457605 CGCGGGCGGCGCGGTTAGGCGGG - Exonic
1049396346 8:142402942-142402964 GGCGGGGGGCGGGGCCGCGCCGG - Intronic
1049803162 8:144527420-144527442 CGAGGGCAGCGCAGGCGCGCCGG + Exonic
1053306156 9:36986140-36986162 CCCGGGGGGCGCGGGCGCGGCGG - Intronic
1057489641 9:95511127-95511149 CGCTGGCTGCCCGGGCGCGCTGG + Intronic
1060114375 9:120928915-120928937 CGCGGGCGCCCCGGCCCCGCAGG - Intronic
1060796201 9:126514419-126514441 CGCGGCCGGGGCGTTCCCGCAGG - Intergenic
1061307026 9:129738053-129738075 CGCGGGCGGGGCAGCCCCGCAGG + Intergenic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061502021 9:131009406-131009428 CGTGGGCGCCGCGGGCGCGGGGG + Exonic
1061540632 9:131276556-131276578 CGAGGGTGGCGCGGCCGCGCGGG - Intergenic
1061583940 9:131554664-131554686 CGCGGGCGGCGCGGGAGCTGCGG - Intergenic
1062022543 9:134326291-134326313 CGCGGGCCGAGCGGTGGCGGCGG + Intronic
1185736649 X:2500945-2500967 CGCGGGCGGCGCGGAAGCGGCGG - Exonic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185835882 X:3345866-3345888 CCCGGGCGGCGGGGACTCGCAGG - Intronic
1189374330 X:40454883-40454905 GCCGGGCGGCGCGGTGGCTCAGG - Intergenic
1189446661 X:41086265-41086287 CCCGGGCTGGGCGGGCGCGCGGG + Intronic
1189491391 X:41473933-41473955 CGAAGGCGGCGAGTTCGCGCAGG - Exonic
1192237552 X:69305707-69305729 GGCAGGCGGCGAGGCCGCGCCGG - Intergenic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic