ID: 1137655362

View in Genome Browser
Species Human (GRCh38)
Location 16:50153971-50153993
Sequence AGCCCGGGGCCTGGGCCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 412}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137655351_1137655362 13 Left 1137655351 16:50153935-50153957 CCCTAGAGACGACCAACAACAAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG 0: 1
1: 0
2: 3
3: 46
4: 412
1137655350_1137655362 14 Left 1137655350 16:50153934-50153956 CCCCTAGAGACGACCAACAACAA 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG 0: 1
1: 0
2: 3
3: 46
4: 412
1137655352_1137655362 12 Left 1137655352 16:50153936-50153958 CCTAGAGACGACCAACAACAACA 0: 1
1: 0
2: 0
3: 11
4: 227
Right 1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG 0: 1
1: 0
2: 3
3: 46
4: 412
1137655353_1137655362 1 Left 1137655353 16:50153947-50153969 CCAACAACAACAACAACCACCAC 0: 1
1: 2
2: 140
3: 444
4: 1502
Right 1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG 0: 1
1: 0
2: 3
3: 46
4: 412
1137655349_1137655362 18 Left 1137655349 16:50153930-50153952 CCTGCCCCTAGAGACGACCAACA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG 0: 1
1: 0
2: 3
3: 46
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137655362 Original CRISPR AGCCCGGGGCCTGGGCCCGC CGG Exonic
900214091 1:1471961-1471983 AGCCCGGGGCCGAGGGCGGCGGG + Exonic
900221640 1:1512345-1512367 AGCCCGGGGCCGAGGGCGGCGGG + Exonic
900240549 1:1615474-1615496 AGCCCAGGGCCCGCCCCCGCCGG - Exonic
900313642 1:2046695-2046717 CTCCCGGTGCCTGGGACCGCAGG - Intergenic
900321887 1:2088564-2088586 AGCCCGGGCTCTGGGACCTCCGG - Intronic
900370357 1:2329487-2329509 AGGCGGGGGGCTGGGCCCCCAGG - Intronic
900373424 1:2342608-2342630 AGCCCGGGGCTGGGGACAGCAGG - Intronic
900429796 1:2596197-2596219 AGCCCTGGGCCTTGCCCCGGCGG - Intronic
900513046 1:3069395-3069417 AGCCGGGGGCCCGGAGCCGCAGG - Intronic
900513477 1:3070764-3070786 AGCGCGGGGCCTACGGCCGCGGG - Intronic
900522750 1:3113532-3113554 AGGCCGAGGCCTGAGCCAGCGGG + Intronic
900782425 1:4626752-4626774 AGCCCTGCACCTGGGGCCGCTGG - Intergenic
901204105 1:7484118-7484140 AGACCGTGGCCTGGGGCCGCAGG + Intronic
901595040 1:10378218-10378240 AGCCTGGGGCCCGGGCTCCCTGG - Intronic
901631568 1:10650790-10650812 CGGCCGGGGCCTGGGCCCTGGGG + Intronic
901956144 1:12787295-12787317 ACCCCGGGGCCTGTGCTTGCAGG + Intergenic
901979524 1:13023364-13023386 ACCCCGGGGCCTGTGCTTGCAGG + Intronic
902002559 1:13205574-13205596 ACCCCGGGGCCTGTGCTTGCAGG - Intergenic
902021793 1:13351338-13351360 ACCCCGGGGCCTGTGCTTGCAGG - Intergenic
902329757 1:15725495-15725517 GGCCCAGGCCCTGGACCCGCCGG + Exonic
902404571 1:16175660-16175682 GGCCCTGGGCCTGGGGCAGCAGG + Intergenic
902731673 1:18373938-18373960 AGGCCCGGGCCTGGGCCTGCTGG - Intronic
903907309 1:26696218-26696240 AGCCCGGAGCCTGAGCCGGCGGG + Exonic
904093316 1:27959945-27959967 GGCCCGGGGCCTGGGCCTGGTGG - Exonic
904500108 1:30908500-30908522 CGGCCGGGCCCGGGGCCCGCGGG - Exonic
904676495 1:32201980-32202002 TGCCTGGGGCCTGGGCTGGCTGG - Exonic
905416499 1:37808041-37808063 AGCCGGGCGCCGGGGGCCGCCGG + Exonic
905793326 1:40801818-40801840 AGCCCAGGTCCTGGCCCCGAGGG - Intronic
906475529 1:46167073-46167095 AGCTAGGGTCCTGGGCGCGCGGG - Intronic
906640760 1:47439165-47439187 GGCCCGGGCCCGGGCCCCGCAGG + Exonic
914958882 1:152188968-152188990 AGAACGGGGCCTCGGCTCGCAGG - Intergenic
915283920 1:154841020-154841042 AGGTCGGGGCCTGACCCCGCAGG - Intronic
915324402 1:155073534-155073556 AGCCAGGGGTCTGGGCCCCCAGG - Intergenic
915596350 1:156898446-156898468 TGCCGAGGGCCTGGCCCCGCTGG + Intronic
917202663 1:172533447-172533469 AGACCAGGGCCAAGGCCCGCCGG - Exonic
922749124 1:228062551-228062573 TGCCCTGGGCCTGTGCCCTCAGG - Intergenic
923353476 1:233130901-233130923 AGGGCAGGGCCTGGGCCCTCTGG + Intronic
1062860631 10:806635-806657 AGGCCGCAGCCTGGGCCCGGGGG - Intergenic
1066388757 10:34962315-34962337 AGCCCGGGGCCAGGGCCATAGGG + Intergenic
1066987044 10:42476462-42476484 AGCCCGGGGGGTGGGACCCCAGG - Intergenic
1067116247 10:43437322-43437344 CGAGCGGGGACTGGGCCCGCTGG + Intronic
1067852391 10:49762105-49762127 AGCCCTGAGTCTGGCCCCGCCGG - Intronic
1069604354 10:69730383-69730405 AGCCCTGGCCCTGGTCCTGCTGG - Intergenic
1069639239 10:69944192-69944214 AGCCAGGGGCCTGGGCGGCCAGG + Intronic
1069814625 10:71185959-71185981 AGCCTGGGGCCTGGGGCCTGGGG + Intergenic
1069849831 10:71397473-71397495 GGCCAGGGGCCTGGGACCGAAGG - Intronic
1069872672 10:71542773-71542795 AGCCTGGAGCCTGGCCCTGCTGG - Intronic
1070610020 10:77926646-77926668 GGGCCGGGGCCTGGGCGGGCTGG + Intergenic
1070782003 10:79143107-79143129 AGCCCGGGGCCTGGCCTGGAGGG - Intronic
1071309531 10:84329044-84329066 AGCGCGGGGCCTCGGGCCGCGGG + Intronic
1073136752 10:101224560-101224582 GGCCCTGGGCCTGGCCCCGCTGG - Intergenic
1073289389 10:102405848-102405870 AGCCCCGGGCCTGCCTCCGCTGG + Intronic
1074377400 10:112951330-112951352 GGCGCGGGGCCGGGGCGCGCGGG - Intronic
1074815091 10:117137019-117137041 AGCCCAGAGCTGGGGCCCGCAGG - Intronic
1074832108 10:117256305-117256327 AGCCCGGGGCCTGGCAAAGCAGG - Intronic
1074859777 10:117501576-117501598 GGCCAGGGGCCTGGGCGGGCAGG + Intergenic
1075702421 10:124478101-124478123 AGCCCGGGGCTTGGGAGGGCAGG - Intronic
1076372303 10:129963596-129963618 GGGCCGGGGCCAGGGCGCGCGGG + Intronic
1076402451 10:130192979-130193001 AGCCCTGGGACTGGGCACCCTGG + Intergenic
1076807860 10:132868070-132868092 CGCCCTGGGGCTGGGCCTGCTGG - Intronic
1076986101 11:236904-236926 AGGCCGGGGGCGGGCCCCGCTGG - Intronic
1077150457 11:1070778-1070800 AGCCCAGGGCCAGGGCCATCAGG - Intergenic
1077183926 11:1228197-1228219 AGCCCTGGGCCTGGGGACGGAGG + Intronic
1077298973 11:1838538-1838560 AGCCGGGGAGCTGGCCCCGCAGG + Intergenic
1077324321 11:1957180-1957202 AGCCCCGGGCCTGTGCCCGACGG - Intronic
1078364116 11:10692711-10692733 AGCCCGGGGTCTGGGACCCCTGG - Intronic
1080871110 11:36237751-36237773 AGCCTGGGGCCTGGGACAGATGG + Intergenic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1083653805 11:64219566-64219588 AGCCCTGGGTCTGTGCCAGCCGG - Exonic
1083667915 11:64285452-64285474 GGCCCGGGGGCGGGGCCCGGGGG + Intronic
1083741300 11:64712928-64712950 CGCCCGGTGCCTGGGCGCGGGGG - Intronic
1083755426 11:64789424-64789446 AGCCCAGGCCCTGGCCCTGCTGG - Exonic
1083901755 11:65646736-65646758 AGCTCGGCGCCTGGGCCCCGAGG - Exonic
1083970536 11:66071074-66071096 AGCCCGGGGCCGAGGCCAGAAGG - Intronic
1083995328 11:66268855-66268877 AGCCGGGGTCCTGGGGCCCCTGG - Intronic
1084037270 11:66519758-66519780 AGGTCTGGCCCTGGGCCCGCTGG + Intronic
1084128820 11:67118591-67118613 AGCCGCCGGGCTGGGCCCGCGGG - Intergenic
1084179360 11:67438748-67438770 AGCCCGGGGCCATGGCGGGCCGG + Exonic
1084275842 11:68050524-68050546 AGGCCTGGGCCTGGGCCGGGAGG + Exonic
1084450104 11:69231752-69231774 AGCCCAGAGCCTGGGCCTCCTGG - Intergenic
1084757990 11:71251492-71251514 CGCCCGGGGCCGGGGCCACCCGG + Intronic
1084910365 11:72382547-72382569 AGCTTGGAGCCTGGGCCCACTGG - Intronic
1085016499 11:73177492-73177514 AGCCCAGGGGCTGGGCCTGTGGG + Intergenic
1085485561 11:76860661-76860683 AGCCGGGGGCCTGGGCTTCCTGG - Intergenic
1088420161 11:109636279-109636301 GGCCTGGAGCCTGGGCCTGCAGG + Intergenic
1088981802 11:114871036-114871058 AGCACGGGGCCAGGGCCCACAGG - Intergenic
1090317121 11:125803162-125803184 AGCCAGGTGCCTGGGTCCACAGG + Intergenic
1090375072 11:126282837-126282859 AGCCCGTGGCCAGGGTCCCCCGG - Intergenic
1090377787 11:126303769-126303791 ACCCCGGGGCGTGGGCCTGGGGG + Exonic
1202807302 11_KI270721v1_random:12357-12379 AGCCCCGGGCCTGTGCCCGACGG - Intergenic
1092256361 12:6928399-6928421 CGCCTGGGCCCCGGGCCCGCGGG + Intronic
1092861892 12:12725634-12725656 GGCGCGGGGGCTGGGGCCGCGGG - Intergenic
1095559884 12:43552055-43552077 AGCGCGGGCCCTGGGCCGGCTGG + Intergenic
1095789465 12:46148448-46148470 AGCCCGGGGGCTGGGAACGTGGG - Intergenic
1096496364 12:52041624-52041646 TGCCTGGGGCCTCGGCCCCCAGG + Intronic
1097209894 12:57359202-57359224 AGCCAGGGGACTGGGCGCGGTGG - Intronic
1098320739 12:69240256-69240278 GCCCCGGGGACTGGGCGCGCGGG - Intronic
1099640558 12:85279508-85279530 AGCTCGGGGTCCGGGCCAGCTGG - Intergenic
1101150374 12:101877734-101877756 AACCCGGCGCCCGGCCCCGCTGG + Exonic
1101493966 12:105236176-105236198 CGGCCGGGGGCTGGGCCGGCGGG - Intronic
1102035477 12:109768550-109768572 CGCCCGGGGCCTGGCACTGCTGG - Exonic
1102430005 12:112875696-112875718 AGACCGGGTCCTGGGCCAGCAGG + Exonic
1104354172 12:128070784-128070806 AGGCCTGGGCATGGGCCCGGTGG - Intergenic
1104649632 12:130522373-130522395 AGACTGGGGCCTGGGCTGGCCGG - Intronic
1104772021 12:131369448-131369470 AGCTCCAGGCCTGGCCCCGCTGG - Intergenic
1104971294 12:132532081-132532103 AGCCAGGGTCCTGTGCCGGCAGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113628316 13:111862981-111863003 TTCCCGGGGCCTGGGCCTGGCGG - Intergenic
1113846431 13:113394213-113394235 AGCCCGAGGCCTGTCCCTGCAGG + Intergenic
1113893487 13:113748838-113748860 AGCCCTGTCCCTGGGCCCTCAGG - Intergenic
1114417661 14:22555106-22555128 AGCCCAAGGCCTTGGCTCGCAGG - Intergenic
1114626394 14:24132764-24132786 AGCCCATGGCCTGGGCTCCCTGG - Exonic
1116958206 14:50944697-50944719 AGCCCGGGACCTGGGCTCGGAGG + Exonic
1118355253 14:65008427-65008449 AGCCCTGGGCCTGCCCCTGCTGG + Intronic
1118749429 14:68795449-68795471 GGCCCAGGGCCTGTCCCCGCGGG + Intronic
1119189984 14:72674704-72674726 TGCCTGGGGCCTGGGCCCACAGG - Intronic
1119325182 14:73755580-73755602 AGCCTGGGGCCTGGGCGGGTAGG + Intronic
1119767875 14:77201834-77201856 GGCCCTGGGGCTGGGCCCCCAGG + Intronic
1121559671 14:94865015-94865037 AGCCCGGGGCCTGGGGCCGGTGG + Intergenic
1121890215 14:97583309-97583331 GACCAGGGGCCTGGGCCCTCCGG + Intergenic
1122030023 14:98905360-98905382 AGTCCCGGGTCTGGGCCCTCAGG - Intergenic
1122129266 14:99595715-99595737 AACCCGGAGCCTGTGCCAGCCGG - Intronic
1122205448 14:100145892-100145914 AGCCCGGGGGCTGGCCGGGCAGG - Exonic
1122230868 14:100305878-100305900 AGCCCGGGACCTCGGCGCGGGGG + Intronic
1122270693 14:100567471-100567493 AGCCCGGGGGCTGGGGCGGGTGG + Intronic
1122558357 14:102593204-102593226 GGCGCGGGGCCCGGGGCCGCGGG - Intronic
1122637713 14:103138224-103138246 TGCCCGGCTCCTGGACCCGCCGG + Intergenic
1122718217 14:103707807-103707829 GGCCTGGGGCCTGGGCCGGGAGG + Intronic
1122788827 14:104175974-104175996 ACCCCGAGGCCAGGGCCCGCAGG - Exonic
1122791567 14:104186026-104186048 AGACCTGGGCCTGGGCCTGCAGG - Intergenic
1122793833 14:104195746-104195768 GGCGTGGGGCCTGGGCCCACAGG + Intergenic
1122977734 14:105177841-105177863 GGCTCGTGGCCTGGGCCCACGGG + Intronic
1123018120 14:105385106-105385128 AGACCAGAGCCTGGGCCAGCTGG + Intronic
1123412978 15:20074340-20074362 AGCCGGGGCCCCAGGCCCGCCGG - Intergenic
1123500448 15:20877306-20877328 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123522320 15:21081453-21081475 AGCCGGGGCCCCAGGCCCGCCGG - Intergenic
1123557693 15:21450999-21451021 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123593920 15:21888280-21888302 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123709937 15:22980087-22980109 AGCCCGGGGCCGGGACCTGGGGG + Intronic
1123716742 15:23039310-23039332 AGCCCGGGGTCGGGGCGCGCTGG - Intronic
1125760517 15:42093091-42093113 AGAGCGGGACCTGGGCCAGCAGG - Intronic
1126436743 15:48645198-48645220 CGCCCGGGGCTTAGGACCGCTGG - Intronic
1127267932 15:57376394-57376416 GGCCGGGGGCCTGGACCCGCCGG - Intronic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1128115490 15:65102386-65102408 CGGCCGGGGCCGGGGCTCGCCGG + Exonic
1129111577 15:73340169-73340191 AGCCCTGGGCCTGAGCTCCCAGG + Intronic
1129424884 15:75455664-75455686 AGCTCGGTCCCAGGGCCCGCAGG + Intronic
1129612285 15:77070687-77070709 AGCCGGGAGCCTGGGCGCGGAGG - Intronic
1129803851 15:78438165-78438187 AGCCCCGGGTCTGCGCTCGCGGG - Intronic
1130546106 15:84858333-84858355 AGCCTGGTGCCTGGGTCCCCAGG + Exonic
1131170406 15:90174359-90174381 AGCCCTGGGGCTGGGCGCGGTGG - Intronic
1132055894 15:98649872-98649894 TGCGCGGAGCCAGGGCCCGCGGG - Intronic
1132320158 15:100919520-100919542 AGCCCGCGCCCGGCGCCCGCGGG + Intronic
1132402783 15:101523621-101523643 CGCCAGGCTCCTGGGCCCGCTGG + Intronic
1202966045 15_KI270727v1_random:178171-178193 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1132522267 16:397270-397292 GGCTCGGGCCCGGGGCCCGCGGG - Exonic
1132527753 16:426018-426040 AGCCCGGGGGCGAGGCCGGCGGG - Exonic
1132602359 16:779376-779398 AGCCCAGAGCCTGGCCCCACAGG - Intronic
1132666281 16:1082720-1082742 GGCCCGGGGCCGGGGCCCCAGGG + Intergenic
1133034669 16:3028140-3028162 CGCCTGGGCCCCGGGCCCGCCGG - Exonic
1133329984 16:4966906-4966928 TGCCAGGGGCCAGGGCCTGCAGG - Intronic
1134094049 16:11407164-11407186 AGCCCAGGGCCGGAGCACGCTGG - Intronic
1134195578 16:12156802-12156824 AGCCCAGGGCATGGTCCCTCTGG + Intronic
1134771889 16:16816212-16816234 AGCCCGGGCCCTGGGACTCCTGG - Intergenic
1134797685 16:17056847-17056869 AGCCTGGAGCCTGGGCCTGCAGG + Intergenic
1135135835 16:19884935-19884957 GGCCCGGGGGCGGGGCCGGCCGG - Intronic
1135423765 16:22322310-22322332 AGGCCGGGGCCTTGGACAGCAGG - Intronic
1135994234 16:27236181-27236203 AGCCCGTGGCCGGGGACAGCAGG + Intronic
1136153603 16:28367914-28367936 CGCCCGCGGCTTGGACCCGCAGG + Intergenic
1136209484 16:28747353-28747375 CGCCCGCGGCTTGGACCCGCAGG - Intergenic
1136483145 16:30555302-30555324 GGCCCGGGGCCGGGGGCCACAGG - Exonic
1136534987 16:30893995-30894017 GGCGCGGAGCCTGAGCCCGCCGG - Exonic
1136556485 16:31010472-31010494 AGGCCGGGGTCTGGGGGCGCCGG + Exonic
1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG + Exonic
1139521076 16:67483096-67483118 TGCCCCAGGCCTGGGCCTGCGGG - Exonic
1139544712 16:67644895-67644917 AGCCGGGGGCAAGGACCCGCTGG + Intergenic
1139775093 16:69311744-69311766 GGCCCTGGGGCTGGGCCAGCCGG - Intronic
1140223723 16:73063039-73063061 AGCCTGGGGCACGGGCCGGCTGG - Intergenic
1140478750 16:75251488-75251510 AGCCGGGGCCCCAGGCCCGCCGG - Intronic
1141479914 16:84299685-84299707 AGCCCCTGGCCTGGGCAGGCTGG + Intronic
1141634960 16:85309764-85309786 AGCCCTGGGTCTGGGCCGGCTGG + Intergenic
1141840015 16:86568197-86568219 AGCCCGGGGGCCGGACGCGCGGG + Exonic
1141997960 16:87647205-87647227 AGCCCAGGGGCTGGGCCGGGAGG + Intronic
1142233810 16:88912073-88912095 AGCCCTGGGCCGGGGCCCGGAGG - Intronic
1142260385 16:89040012-89040034 AGCCCAGGGCCAGGCCCCTCGGG - Intergenic
1142420057 16:89964462-89964484 AGCCCTTGGCCTGGCACCGCTGG - Exonic
1142480491 17:215670-215692 AGCCCGGGGCGGGGTCCCCCTGG + Exonic
1142696061 17:1634605-1634627 TGCCAGGGGCCTGGGCCAACTGG + Exonic
1142764453 17:2057570-2057592 AGCCCGGGACCCGAGCCCCCCGG + Exonic
1143034982 17:3989607-3989629 TGGCCGGGGCCTCGGCCTGCAGG + Intergenic
1143119494 17:4598108-4598130 AGCCCGTGGCCTGGGTGCGGAGG + Intronic
1143512734 17:7405186-7405208 GGCCCGGGGCCCGGGAGCGCAGG - Intronic
1143786128 17:9257049-9257071 AGCTCCTGCCCTGGGCCCGCTGG + Intronic
1144522619 17:15963985-15964007 AGCCCGGGGCCAGGGCCTCCTGG + Intronic
1145881746 17:28357409-28357431 TGCCCACGGCCAGGGCCCGCCGG + Exonic
1145907551 17:28524626-28524648 GGCCCAGGGCCGGGGCCGGCTGG - Exonic
1146901469 17:36592090-36592112 GGCCCGGGCCCTGGTCCAGCAGG + Exonic
1147683981 17:42276208-42276230 AGCCCTGGGCCCGGGGCCGGGGG - Intronic
1148150664 17:45395027-45395049 AGCACAGGGCCAGGGCCCACAGG + Exonic
1148159338 17:45441247-45441269 AGCCCTGGGTCTGGGCCTCCGGG + Intronic
1149855416 17:60078660-60078682 GGGCCGGGGCCGGGGCCAGCAGG + Intronic
1150326534 17:64262871-64262893 TGCCCGGGGCCGGGGACCGCAGG + Intronic
1150337686 17:64342417-64342439 ATCCCGGGGTCTGGGCTCTCAGG - Intronic
1152161908 17:78674325-78674347 AGGCCAGGGCCCGGGCCAGCTGG + Exonic
1152362432 17:79838964-79838986 AGCCCCGCGCCTCGGCCCCCGGG + Intronic
1152378280 17:79929691-79929713 GGCCTGGGGCCAGGGCCCGGTGG + Intergenic
1152649206 17:81484140-81484162 CGCCCGGGGCCTGAACGCGCCGG - Intergenic
1152719902 17:81918353-81918375 AGCACTGGGCCTGGCCCCCCGGG - Exonic
1153017509 18:596999-597021 ACCCCGCGGCCCGGGCCTGCAGG - Exonic
1155508013 18:26549886-26549908 CGCCCGGAGCCTGGGCGCGCCGG - Intronic
1156448418 18:37253489-37253511 AGCCCTGGGCCTGCGCCTCCGGG - Intronic
1157563283 18:48663500-48663522 AGCCATGGGCCTGGGGCAGCAGG + Intronic
1158137561 18:54224141-54224163 AGCGCGGGGCCGGGGCCCAGGGG - Exonic
1158954275 18:62524045-62524067 GGCCCGGGGCGAGGGCTCGCGGG + Exonic
1159966163 18:74597993-74598015 AGCGCGGGGCCTGGGGGCGGTGG + Intronic
1160662392 19:307140-307162 AGCCCGGGGGCCGGGCACGTGGG + Exonic
1161017475 19:1990531-1990553 AGTCCGGGGCCTTGGCCAGGAGG - Intronic
1161103022 19:2430635-2430657 AGCCCAGGGCCAGGACCCGGAGG - Exonic
1161105747 19:2443223-2443245 TGCCCGGGGCCTGGGGCTCCAGG - Intronic
1161221811 19:3121273-3121295 GGGCCGGGGCCTCTGCCCGCGGG + Exonic
1161238992 19:3211408-3211430 ACCCCGGAGCATGGGGCCGCTGG + Intergenic
1161944815 19:7429006-7429028 GGCCCGTGGCCTAGGCCTGCGGG - Intronic
1161998975 19:7731233-7731255 AGCCGGGCGCCTGGGCCCCCGGG - Intronic
1162007193 19:7788388-7788410 AGCCGGGCGCCTGGGCGCCCGGG + Intergenic
1162030771 19:7916418-7916440 AGCCAGGGGCCGGGCGCCGCGGG - Exonic
1162285612 19:9736403-9736425 AGTCCGGGGCCAGGGCGCGGTGG - Intergenic
1162361924 19:10225683-10225705 AGCCAGGCGGCTGGGCCCGGTGG - Intronic
1162471020 19:10871974-10871996 GGCCCGGGGCGGGGGCCGGCGGG + Intronic
1162768884 19:12937426-12937448 AGCCCTGGACCTGGGAGCGCGGG - Intergenic
1163445061 19:17341210-17341232 GGACCGGGACCTGGGCCCTCCGG - Exonic
1163514236 19:17753527-17753549 AGCCTCGGGCCTGGCCCTGCAGG - Intronic
1163547748 19:17949675-17949697 AGCCCAGGGCCAGGGACCCCTGG - Intergenic
1163692574 19:18745521-18745543 AGCTCGGGGCCAGCGCCCGCCGG - Intronic
1163695622 19:18761909-18761931 GCCCTGGGCCCTGGGCCCGCGGG + Intronic
1165468191 19:35987403-35987425 AGCGCGGGGGCGGGGGCCGCAGG - Intergenic
1165749870 19:38253189-38253211 AGCCCGATGCCTGGGCCCATGGG + Intronic
1166230974 19:41425731-41425753 AGCCCTGGGCCTGGTGCCCCAGG - Exonic
1166317886 19:41998899-41998921 CGGCCGCGGCCTGGCCCCGCCGG - Exonic
1166704421 19:44900856-44900878 AGCCTGGCGCCTGGGTCCGAGGG + Intronic
1166857924 19:45792491-45792513 GGCCCGGGTCCGGGGCCTGCGGG + Exonic
1166938768 19:46350536-46350558 AGCAAGGGGCCTGGGCCAGCAGG - Intronic
1166939409 19:46353685-46353707 AGCCCAGGGCCTGTCCTCGCAGG + Intronic
1166944837 19:46390389-46390411 AGCCCAGGGCCTGGGTCCGGTGG - Exonic
1166965638 19:46528167-46528189 AGCGAGGGGCCTGGGCCAGCAGG + Intronic
1167043987 19:47039427-47039449 GGCCCAGGGCGTGGGCCCGAAGG - Exonic
1167044725 19:47042883-47042905 AGCCCGGGGCCAGAGCCCACAGG + Exonic
1167738834 19:51312047-51312069 ACGCCGGGGTCTGGGCCCGGGGG + Intronic
1168317409 19:55490221-55490243 AGACGGAGGCCTGGGCCCCCAGG + Intronic
1168322618 19:55518869-55518891 TGCCCGGGGTCTGGGGCAGCTGG + Exonic
1202648035 1_KI270706v1_random:158745-158767 AGCCCCTGCCCTGGGCCCCCTGG + Intergenic
927714269 2:25342073-25342095 GGGCGGAGGCCTGGGCCCGCGGG - Intronic
929565192 2:42979572-42979594 AGCCAGAGGCCTGGTCTCGCTGG - Intergenic
930102022 2:47610741-47610763 AGGCAGGGGCCTGGGTCCTCTGG + Intergenic
932456447 2:71852621-71852643 AGCCCGGAGCCTGGACCTGCGGG + Intergenic
932775339 2:74525097-74525119 AGCCCGGAGCCTGGCTCTGCGGG - Exonic
933847568 2:86337778-86337800 AGCCGGGGGCCAGGGCGAGCGGG - Intronic
934559743 2:95306972-95306994 AGGCTGCGGCCTGGGCCCTCAGG - Intronic
935237481 2:101151045-101151067 AGCCCGGGACTGGGGGCCGCGGG + Intronic
935265145 2:101387364-101387386 AGCCCGCGGCCGGGGACAGCAGG + Exonic
935645375 2:105329799-105329821 AGCCAGGCGGCAGGGCCCGCGGG - Exonic
936392529 2:112088025-112088047 AGGCCTGAGCCTGGGCCCCCGGG - Intronic
937028972 2:118722192-118722214 AGCAGAGGGCCTGGGCCCGCCGG - Intergenic
937907429 2:127059035-127059057 GGCCCCGGGCGTGGCCCCGCCGG + Exonic
937974075 2:127570530-127570552 AGCCCGTGGCCTCGGCCCCAAGG + Intronic
938073927 2:128322233-128322255 GGGCCGGGGCCGGGCCCCGCGGG - Intergenic
939629600 2:144516693-144516715 ACCCCGGGGTCTGGGCGCGATGG + Intronic
940009403 2:149038589-149038611 AGCCCCGGGCCCGGCTCCGCTGG - Exonic
945649291 2:212538697-212538719 GGCCCCGGCCCTGGACCCGCGGG - Exonic
947726798 2:232406394-232406416 TGCCAGGAGCCTGGGCCCGGTGG - Intergenic
948578425 2:238968795-238968817 ATCCTGGGGGCTGGGCCTGCTGG + Intergenic
948621944 2:239240986-239241008 AGTGGGGGGCCTGGGCCCTCCGG - Intronic
948645310 2:239400661-239400683 AGCCCCGGCCCGGCGCCCGCGGG - Exonic
1169011654 20:2256187-2256209 AGCTGGGGGCCTGGGCCCCCTGG - Intergenic
1171233987 20:23509696-23509718 AGCCAGGGGCCTGGGACAGATGG + Intergenic
1171459205 20:25289091-25289113 AGGCCGGGGCCTGGGGGTGCTGG + Intronic
1172272057 20:33660263-33660285 AGCCATGGGCCTGGGCCTCCAGG + Exonic
1173708576 20:45135278-45135300 AGCCTGGTGCCTGGGTCAGCAGG + Intergenic
1173749992 20:45469470-45469492 AGCCCTGAGCCTTGGCCCTCAGG + Intergenic
1175256822 20:57652739-57652761 AGCCCAGAGCCTGATCCCGCGGG + Intronic
1175399594 20:58692875-58692897 GGGCCGGGGCGTGGGCCGGCAGG + Exonic
1175466122 20:59192157-59192179 GGCCCGGGGCCAGGGGTCGCAGG + Exonic
1175820702 20:61907339-61907361 TGCCCGGGGCCTGGCCGCCCAGG + Intronic
1175889911 20:62311436-62311458 GGCCCGGGGTCTGGGCTTGCAGG + Exonic
1175890795 20:62315055-62315077 GGCCCAGGTCCTGGCCCCGCAGG + Exonic
1176069091 20:63216683-63216705 AGCCCTGGGCCCGGTCCCGGAGG + Intergenic
1176189894 20:63803552-63803574 AGCCCGGGGCCTGGGCAGCCCGG - Intronic
1176308031 21:5134584-5134606 AGCCAGGGGTCTGTGCCCTCGGG - Intronic
1176869028 21:14072261-14072283 AGCCCCTGCCCTGGGCCCGAGGG - Intergenic
1178617320 21:34145429-34145451 AGCCAGGGGGCAGGGCCCACTGG - Intergenic
1179732551 21:43375803-43375825 TGCTTGGGGCCTGGGCCCTCGGG - Intergenic
1179813195 21:43885219-43885241 AGGCCTGGGCCTGGGCCAGACGG + Intronic
1179849029 21:44127448-44127470 AGCCAGGGGTCTGTGCCCTCGGG + Intronic
1179876566 21:44271888-44271910 AGCCCTGGCCCTGAGCCCCCAGG - Intergenic
1180703559 22:17794899-17794921 GACACGGGGCCTCGGCCCGCGGG + Intronic
1181082924 22:20426061-20426083 CGCCCCGGGCCCGGGCCGGCCGG + Exonic
1181086046 22:20439846-20439868 AGCCCGGAGCCCTGGCCTGCTGG + Intronic
1181173478 22:21023124-21023146 AGTTCTGGGCCTGGGCCAGCAGG - Exonic
1181269598 22:21651596-21651618 AGACCGGGTCCTGGGCCCCGTGG - Intergenic
1181580330 22:23824619-23824641 CACCCGGGGCCTGGGCCCTCTGG + Intronic
1182295969 22:29311449-29311471 ATCCCGGGGCCTGGGGCAGGGGG - Intronic
1182524441 22:30906624-30906646 AGCCCATGGCCCGGGCCAGCCGG - Exonic
1183685206 22:39357644-39357666 CGCCCGGGTCCGGGGCCAGCAGG - Intronic
1184034052 22:41910251-41910273 GGGCCGGGGGCGGGGCCCGCTGG + Intronic
1184373158 22:44095579-44095601 TGCCCGCGGCCTGGGCTTGCAGG + Intronic
1184412109 22:44331529-44331551 AGCCGGGAGCCGGCGCCCGCGGG + Intergenic
1184669530 22:46005515-46005537 AGCACAGGGCCTGGGCTTGCAGG + Intergenic
1185079900 22:48703847-48703869 AGGGCAGGGCCTGGGCCAGCAGG - Intronic
1185269651 22:49923131-49923153 AGCCCGTGGCCAGGGCCGGCTGG - Intronic
1185332884 22:50259525-50259547 AGCCCAGGGGGTGGGCCCACAGG + Intronic
952919564 3:38275497-38275519 GGGCCTGGGCCTGGGCCTGCTGG - Intronic
953391509 3:42536375-42536397 AGCCCCGGCCCTGGGCTCGGAGG + Exonic
953907579 3:46875989-46876011 AGCCCTGGGCTGGGGCCCACAGG + Intronic
953909244 3:46883412-46883434 GCCCCGGGGCCTCGGGCCGCCGG + Exonic
954300686 3:49699372-49699394 ACCCCGGGGCCTGGGCTCTAGGG - Intronic
954305671 3:49724099-49724121 AGACCCGGGCCGGGACCCGCGGG + Intergenic
954450203 3:50567547-50567569 AGCCCGGCGTCTGGGGCTGCGGG + Exonic
954778868 3:53045329-53045351 AGCCCGGGGGGCGGGTCCGCGGG + Intronic
960844405 3:121993387-121993409 CTCCCGGGGGCTGGGCCTGCGGG + Exonic
962530786 3:136277891-136277913 AGCCAGGTGCCTGGCCCTGCAGG - Intronic
963103435 3:141625725-141625747 AGCCTGAGGCCTGGGCCTGGAGG - Intergenic
965913627 3:173814079-173814101 AGCCCCTGAGCTGGGCCCGCAGG + Intronic
966919371 3:184602039-184602061 GCCCCGGGGCTGGGGCCCGCGGG + Intronic
968284346 3:197499292-197499314 CCCCCAGGGCCTGGGGCCGCTGG - Intergenic
968356677 3:198113640-198113662 GGGCCGAGGGCTGGGCCCGCGGG + Intergenic
968475564 4:805120-805142 AGCCCGGGGCCTGGAGCGGGAGG + Intronic
968628126 4:1637252-1637274 AGCACGGGGCCTGTGACTGCAGG + Intronic
968809497 4:2793462-2793484 CGCACGGGGCCTGGGCACGGCGG + Intronic
968890173 4:3364634-3364656 AGCCCAGGGCCTGGGGCAGCTGG + Intronic
968943179 4:3649958-3649980 TGCCCAGGGCCTGGCCCCTCGGG + Intergenic
968977145 4:3827891-3827913 AGTCAGGGGCCTGGGCTCCCTGG - Intergenic
969214593 4:5711614-5711636 AGCCGGGGCTCCGGGCCCGCAGG - Intronic
969425823 4:7123069-7123091 AGCCTGGGGGCTGGTCCCACAGG + Intergenic
969610975 4:8227674-8227696 AGGCCCGGGCCTCGGCCTGCAGG - Exonic
969711201 4:8845154-8845176 AGCCCAGGGCGTGGGGCAGCCGG - Intergenic
976389739 4:84496458-84496480 AGCCCGGGGACTGTGGCAGCCGG - Intronic
978384464 4:108166913-108166935 AGCCCAGGCGCTGGGGCCGCAGG + Intronic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
985620582 5:952768-952790 AGCCCGGGGCCTGTGTTCACTGG - Intergenic
985658225 5:1142953-1142975 GGCCCGGGGCCTGGGGCCCAGGG - Intergenic
985824385 5:2181771-2181793 ACCCCAGGGCCTGGCACCGCAGG + Intergenic
992269989 5:75053758-75053780 GGCCCGGGGACTGGGAGCGCAGG - Intergenic
992444129 5:76819303-76819325 AGCTGGGGTCCTGGGCACGCTGG + Intronic
998374143 5:141680360-141680382 AGCCCGGGGCCTGGGCCACGAGG - Exonic
999248342 5:150167171-150167193 AGCCCGGTGCCGGCGCCCCCTGG + Exonic
1001480600 5:172086673-172086695 GACCAGGGGCCTGGGCCAGCAGG + Intronic
1001556551 5:172641195-172641217 AGCCACCGGCCCGGGCCCGCCGG - Intergenic
1001878090 5:175218160-175218182 AGCCCAGGGCCTGGGTTTGCTGG - Intergenic
1002195191 5:177497400-177497422 AGGCAGGGGCCAGGGCCAGCGGG + Intronic
1002296249 5:178232817-178232839 CGCCCCGGGCCTCGCCCCGCAGG + Intergenic
1002432283 5:179210598-179210620 AGACAGGGGCCTGGGCCACCTGG + Intronic
1004690355 6:17987726-17987748 AGAGCTGCGCCTGGGCCCGCCGG - Intergenic
1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG + Intronic
1005987744 6:30884732-30884754 AGCCCCAGGCCTCCGCCCGCGGG - Intronic
1006180373 6:32150490-32150512 AGCCAGGGGCCTGGGCAGTCTGG + Exonic
1006284256 6:33080973-33080995 CGCCCTGGGCACGGGCCCGCGGG - Intronic
1006472960 6:34238258-34238280 GACCCGGGGCCAGGGCGCGCGGG - Intronic
1006599155 6:35214291-35214313 AGCCCCCGGCCTGGCCCCGGCGG + Intergenic
1006787512 6:36678586-36678608 AGCCAGGAGCCTGGGCCCCGGGG + Intronic
1011277018 6:85642181-85642203 AGCCTGTGGCCTGGCGCCGCCGG - Intronic
1012465854 6:99515518-99515540 CGCCCGGGGCCCGGGAGCGCGGG + Intronic
1013014083 6:106145353-106145375 AGCCCGGGGCTCGGGCGAGCTGG + Intergenic
1015554960 6:134451734-134451756 AGGCAGGGGCCTGGGCCTGCAGG - Intergenic
1015880509 6:137866788-137866810 ACCCTGGCGCCCGGGCCCGCAGG - Intergenic
1015938238 6:138424158-138424180 GGCCGGGGGCCTGGGGCTGCAGG + Exonic
1016433076 6:144008175-144008197 AGCGCGGGGCCTTGGCGCGCGGG - Intronic
1017954834 6:159169316-159169338 GGGCCGGGGCCAGGGCCGGCGGG - Intergenic
1018020889 6:159761807-159761829 AGGCCGGGGTCTGGGCTTGCGGG - Exonic
1018396154 6:163379566-163379588 AGCCCAGGGACTGGGCCTGGGGG - Intergenic
1018628675 6:165804632-165804654 ACCCGGGGGCCTTGGCCTGCAGG + Intronic
1018757390 6:166862342-166862364 AGCGCGGGGCCTGCGCCGGCCGG + Exonic
1019015441 6:168876651-168876673 AGCACGGGGCCAGGGCCCAGAGG + Intergenic
1019016708 6:168885366-168885388 AGCCCGGGGCCTGGCCCCATGGG + Intergenic
1019442609 7:1055084-1055106 AGGCCGTGGCCTCTGCCCGCAGG - Intronic
1020278257 7:6637392-6637414 ACACCGGGGCCGGGGCCTGCGGG - Exonic
1021450345 7:20778288-20778310 GGGCCGGGGCCAGGGCTCGCGGG + Intergenic
1021992505 7:26152133-26152155 CGCCCGGGGCCCGCGCCCGTGGG - Intergenic
1023984115 7:45085411-45085433 AGGCTGGGGCCTGTCCCCGCAGG - Exonic
1023989885 7:45122379-45122401 AGGCCTGGGCCTGGGGCCCCTGG + Intergenic
1027025883 7:74851401-74851423 AGTCCGAGGCCTGGGCCACCGGG + Exonic
1027061876 7:75092709-75092731 AGTCCGAGGCCTGGGCCACCGGG - Exonic
1027229010 7:76261454-76261476 AGCCCTGGCCCTGGGCCCCACGG - Intronic
1029445873 7:100612611-100612633 GGCCCTGGGCCTGGGTCTGCGGG + Exonic
1029456609 7:100675158-100675180 AGCCTGCGGGCTGGGCCCCCCGG + Intronic
1029743997 7:102506721-102506743 GGCCAGGGGCCCGGGCCTGCCGG - Exonic
1029761986 7:102605884-102605906 GGCCAGGGGCCCGGGCCTGCCGG - Exonic
1031088276 7:117324071-117324093 AGAGAGGGGCTTGGGCCCGCGGG + Intergenic
1032082396 7:128866202-128866224 AGCCTGAGGCCAGGGCCCACTGG - Intronic
1032193493 7:129777470-129777492 AGGCTGGGGCCTGGGCCCTAGGG + Intergenic
1033253252 7:139777962-139777984 AGCGCGCGGCCAGGGCCGGCGGG + Intronic
1033306581 7:140230262-140230284 AGCCCAGGGCCCGCGCCCGGAGG - Intergenic
1034179384 7:149126086-149126108 CGGCCGGGGCCTGGGCCTGGGGG - Intronic
1034218123 7:149423098-149423120 AGCCCGGGGTCGCCGCCCGCGGG + Intergenic
1034274892 7:149819717-149819739 TGCCCGGGGGCTGGTCACGCTGG + Intergenic
1034338978 7:150340516-150340538 AGCCCAGCGCCGGGGCCTGCAGG - Exonic
1034441118 7:151086577-151086599 AGCCGGGGGCCGGGGGCCGGAGG - Intronic
1034578935 7:152025951-152025973 CGCGCGGGGCCTGGGCAGGCTGG + Intronic
1035404474 7:158588412-158588434 AGCCCACGCCCTGGGCCCTCCGG - Intergenic
1035431984 7:158829388-158829410 CGCCCGGGGCGAGGGCCCGGAGG - Exonic
1035760626 8:2066133-2066155 AGCCCGTGCCCTGGTCCAGCCGG + Intronic
1037143007 8:15540321-15540343 AGCCCGCTGGCTGGGCCCTCCGG - Exonic
1037910299 8:22740107-22740129 AGCCCCAGGCCTGGGCCCATTGG - Intronic
1038883588 8:31640026-31640048 AGCCGGGGCGCTGGGCCCGGGGG - Intronic
1039864697 8:41490652-41490674 GGCGCGGGGCCTGGGCCAGGCGG + Exonic
1039973327 8:42338689-42338711 AGCACCGGGCCGGGCCCCGCTGG + Intronic
1040278368 8:46025333-46025355 AGCCCCTGGGCTGGGCCCGGAGG - Intergenic
1042591524 8:70402859-70402881 AGCCGGGGGCCGGGCCCCGGCGG - Intronic
1047259223 8:123241157-123241179 AGGCCGGGGCCGGGGCCCCGCGG + Intronic
1049148659 8:141020328-141020350 ACCTGGGAGCCTGGGCCCGCGGG + Intergenic
1049171941 8:141166965-141166987 AGGCCGGGGCCTTGACCCCCAGG + Intronic
1049221827 8:141432010-141432032 AGGCCTGGACCAGGGCCCGCCGG + Exonic
1049426574 8:142540551-142540573 AGCGAGGGGCCTGGGCCTGGGGG + Intronic
1049439263 8:142601786-142601808 AGCCCGGGACCTGGGCCCCCAGG + Intergenic
1049668303 8:143858640-143858662 TGCCCTGGGCCAGGTCCCGCAGG + Exonic
1049668719 8:143860239-143860261 TGCCCTGGGCCAGGTCCCGCAGG + Exonic
1049669134 8:143861841-143861863 TGCCCTGGGCCAGGTCCCGCAGG + Exonic
1049669549 8:143863443-143863465 TGCCCTGGGCCAGGTCCCGCAGG + Exonic
1049669959 8:143865036-143865058 TGCCCTGGGCCAGGTCCCGCAGG + Exonic
1049721077 8:144115860-144115882 TGCGCGGGGCCTGCGCCGGCGGG + Intronic
1049761434 8:144333675-144333697 CGCGCGGGGCCAGGGGCCGCAGG - Exonic
1050437924 9:5629174-5629196 AGCTCGGGGCATCTGCCCGCTGG - Exonic
1051730701 9:20139894-20139916 GGTCAGGGGCCTGGGCCTGCTGG - Intergenic
1053199306 9:36141973-36141995 AGCCCTGGGCCTGGCTCCCCAGG - Intronic
1053362794 9:37501286-37501308 AGCCCAGGGGCAGGGCCTGCGGG - Intronic
1053503704 9:38622033-38622055 ACCCCTGGTCCTGGGGCCGCGGG - Intergenic
1056510364 9:87298836-87298858 AGCCAGGAGCCTGGGCCAGGTGG + Intergenic
1057054312 9:91949490-91949512 AGCCCGGGTCCTGGGACCCTCGG + Intronic
1057186104 9:93058500-93058522 AGCCGGCTGCCTTGGCCCGCTGG + Intergenic
1058013422 9:100003763-100003785 AGCCTGGTGCCTGGGTCCACTGG + Intronic
1059123390 9:111661879-111661901 AGCCGGGGGCCCGGGCCTGACGG + Intronic
1060793220 9:126499362-126499384 AGCGCCGGGCCTGCGCCCTCTGG - Intronic
1060964951 9:127707187-127707209 AGCCCGGTGCGTGGGCTGGCGGG + Exonic
1061130523 9:128705522-128705544 GGCCCTGGGCCTGGCCCAGCTGG + Exonic
1061395134 9:130339753-130339775 AGCCCAGGGCCTGGGTGCCCAGG - Intronic
1061955473 9:133959222-133959244 AGCCAGGGGCTTGGCCCAGCAGG - Intronic
1062016347 9:134293157-134293179 AGACCAGGGCCTGGGACTGCCGG - Intergenic
1062049085 9:134437983-134438005 AGCCCGGGGGCAGAGCCTGCGGG - Intronic
1062139158 9:134945850-134945872 GGCCCGGAGCCTGGGGCCACAGG + Intergenic
1062153214 9:135032125-135032147 AGCCACTGGCCTGGGCTCGCAGG + Intergenic
1062190265 9:135244334-135244356 AGCCCGGGGCGAAGACCCGCTGG - Intergenic
1062204131 9:135326371-135326393 AGCCCAGGCCCTGGACACGCAGG + Intergenic
1062374013 9:136253934-136253956 AGCCGGGCGCCTGGGCCTGGTGG - Intergenic
1062393483 9:136343213-136343235 AGGCCCGGGCCTGTGCCCTCTGG - Intronic
1062395642 9:136351585-136351607 TGCCCTGGGTCTGGGCCAGCAGG + Intronic
1062648405 9:137562686-137562708 AGCCCAGGGGCTGGGCACGGTGG + Intronic
1062652824 9:137587076-137587098 AGCCCGGGGCCACGCCCCCCCGG + Exonic
1186480692 X:9894655-9894677 CGCCTGCGGCCTGGGCCTGCCGG - Exonic
1190056867 X:47186203-47186225 AGCCCGGGGCCGGGGCCGGCAGG + Intronic
1190265895 X:48827018-48827040 GGCCCGGGGCCTCAGCCCGCGGG - Intergenic
1190968314 X:55323597-55323619 AGCCCAGGGCCTGGGGCTTCTGG + Intergenic
1191025468 X:55908739-55908761 GCCCCGGGGCCTGGGCCGACGGG - Intergenic
1191249625 X:58254204-58254226 AGCCCTGGCGCTGGGCCCCCGGG - Intergenic
1191251918 X:58263897-58263919 AGCCCCTGTGCTGGGCCCGCGGG + Intergenic
1192214709 X:69150306-69150328 GGCCCTGGGCCTAGGCCTGCTGG + Intergenic
1192251658 X:69418624-69418646 AGCCAGGGGCCTGTGTCCACAGG + Intergenic
1192274751 X:69616936-69616958 AGCCCGCAGCCAGGGGCCGCGGG - Intronic
1195135835 X:101906653-101906675 AGCCTGGGACCTGGGCACACAGG - Intronic
1195135888 X:101906886-101906908 AGCCTGGAGCCTGGGTCCTCTGG - Intronic
1195564265 X:106323442-106323464 AGCCTGAGGCCTGGGACCACTGG - Intergenic
1198096457 X:133384593-133384615 AGCCCGGGGCCTGAGCCTTCTGG - Intronic
1198636888 X:138711253-138711275 AGCCCCGGGCCCGGGATCGCGGG + Exonic
1200161945 X:154014092-154014114 GGGCCTGGGCCTGGGCCAGCTGG - Exonic
1201063552 Y:10069139-10069161 AGCCCGGGGCATGTGCCCTGAGG - Intergenic