ID: 1137660766

View in Genome Browser
Species Human (GRCh38)
Location 16:50204103-50204125
Sequence CAGTGTTACCATAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137660766 Original CRISPR CAGTGTTACCATAAGGAGGT TGG Intronic
901328993 1:8390046-8390068 GGATGTTAACATAAGGAGGTGGG + Intronic
905344485 1:37302173-37302195 GGGTGTCACCATAAGGAGGCTGG - Intergenic
911665904 1:100551344-100551366 CAGTGTTAACATCATGTGGTAGG + Intergenic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG + Intergenic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1066030406 10:31417229-31417251 GAATGTTACCATAAGGAGACTGG - Intronic
1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG + Intergenic
1069049638 10:63778945-63778967 CAGTTTTTCCATAATGGGGTGGG - Intergenic
1070495262 10:77015589-77015611 CAGTGATATCATAAGGCGGTTGG - Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072245858 10:93543212-93543234 CAGTGTTACCATCTGCAGGCAGG - Intergenic
1074892062 10:117744041-117744063 CAGTGGTTCCATCAGTAGGTGGG - Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075732866 10:124646693-124646715 CAGAGTTCACATAAGGGGGTTGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1078346991 11:10558915-10558937 CAGGGTTACAATAAGGAGAAGGG + Exonic
1078682965 11:13497511-13497533 TAGGGTTACCATAAGGAAGAAGG + Intergenic
1081300285 11:41443130-41443152 CAGTGTTAATATGATGAGGTTGG - Intronic
1081951070 11:47043442-47043464 CACTGTACCCCTAAGGAGGTTGG - Intronic
1083039302 11:59670173-59670195 TAGTGTTACCATCATGAGGCAGG - Intergenic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1086643297 11:89186761-89186783 CAGTGTGACTATTTGGAGGTAGG + Intronic
1095514505 12:42991114-42991136 GAGTATCAGCATAAGGAGGTGGG - Intergenic
1096566978 12:52490242-52490264 CAGTGGTGCCATAATGAGGATGG - Intronic
1099194409 12:79598201-79598223 CAGTGCAAACATCAGGAGGTAGG + Intronic
1099923252 12:88985278-88985300 CTGCTTTGCCATAAGGAGGTAGG - Intergenic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG + Intergenic
1111420537 13:88005208-88005230 CAGTGGTGCGGTAAGGAGGTGGG + Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1117949380 14:61066198-61066220 TATTTTTTCCATAAGGAGGTAGG + Intronic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1123825940 15:24082170-24082192 CAGTTTTACCTTAAGCAGTTAGG + Intergenic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1133407045 16:5532945-5532967 CAGCATTACCATAAAGATGTAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138973310 16:62172129-62172151 CAGTGTCTCCCTAAGAAGGTTGG - Intergenic
1140664503 16:77215084-77215106 CAGTGTTGCCAAAAGGCGGAAGG + Intergenic
1141719575 16:85748664-85748686 CTGGGTTACGATAAGGAGTTTGG + Intronic
1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG + Intronic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1144648050 17:16988646-16988668 TAGTTTTACCCTAAGGAGGTAGG - Intergenic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG + Intronic
1158254202 18:55527181-55527203 CAGTGTTGCCTTAAGGATGCGGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
927536180 2:23861180-23861202 CAGTATTGCAAAAAGGAGGTAGG + Intronic
928032910 2:27796829-27796851 CAATGTTGCCATAGGGAGGCTGG + Intronic
928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG + Intronic
936592127 2:113814113-113814135 CTGTGTTACCATATGGTGGGAGG + Intergenic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
938951047 2:136254780-136254802 CAGTGTGATCTTAATGAGGTAGG + Intergenic
941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG + Exonic
941836000 2:170021550-170021572 CAAGGTTAGTATAAGGAGGTGGG - Intronic
946562937 2:220933582-220933604 GAGTGAAACCATAAGGATGTGGG - Intergenic
1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG + Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1174645939 20:52085383-52085405 AAGTGTTGTCATTAGGAGGTTGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1177023190 21:15888527-15888549 CAGAATTACCATGAGCAGGTAGG - Intergenic
1177036130 21:16045307-16045329 CTGTTTTGCCAAAAGGAGGTTGG - Intergenic
1182898361 22:33877000-33877022 CAGTGGTACCATTAGATGGTGGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG + Intronic
950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG + Intronic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
954056798 3:48033049-48033071 CACTTTTAAAATAAGGAGGTTGG - Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955620098 3:60854145-60854167 CAGTGTTACCATATGCTTGTGGG - Intronic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
959496555 3:107058676-107058698 CAGTGTTACCATTTGGTGGCTGG - Intergenic
960680245 3:120240013-120240035 GAGTGTGACTACAAGGAGGTGGG + Intronic
960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG + Exonic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
969412968 4:7042010-7042032 CAGTGGTACCACCAGGAGCTGGG - Exonic
973196609 4:47450472-47450494 CAGTGATTCAATAAGGAGCTTGG - Intergenic
974112633 4:57543261-57543283 AATTGTTAACATAATGAGGTGGG - Intergenic
976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG + Intergenic
976602189 4:86948239-86948261 CAAGTTTACCATAAGGAGGAGGG - Intronic
978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG + Intronic
981457377 4:144968905-144968927 CACTGTTACAATACGTAGGTAGG - Intronic
983165003 4:164464719-164464741 TAGTGTTTCCATAAGAAGATGGG - Intergenic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
986014227 5:3743713-3743735 CACTGTCACCATAAAGAGGGGGG + Intergenic
987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG + Intronic
992778540 5:80108252-80108274 AAGTGATGGCATAAGGAGGTGGG + Intergenic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1003233410 6:4274968-4274990 CTGTGTTGCCATATAGAGGTTGG - Intergenic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1014488934 6:122037556-122037578 AAGTTATACCATAAGGAGGCCGG - Intergenic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1020884035 7:13800511-13800533 CTGTGTGACCCTAATGAGGTGGG + Intergenic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1030512696 7:110503948-110503970 CAATGATACCAAAAGGAGGGAGG - Intergenic
1031147240 7:118010365-118010387 CATTATAACCATAAGAAGGTAGG + Intergenic
1038993701 8:32898155-32898177 GAGTGATACCATAAGAAGGTGGG + Intergenic
1044392383 8:91666571-91666593 GAGTGCTACCATGAGGAAGTAGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1056469799 9:86894289-86894311 CAGCGTTCCCAAAAGGAGCTGGG - Intergenic
1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG + Intronic
1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG + Intergenic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1191731780 X:64344045-64344067 CAGAGTTAGCATAAGTGGGTGGG - Intronic
1195640484 X:107169413-107169435 CACTGTTACCTTAAGGAAATTGG - Intronic
1200242771 X:154506561-154506583 CAGTGTTACGAAAAGGAGGCGGG + Exonic
1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG + Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1200749253 Y:6929618-6929640 TAGTGTTCCCATCAGGAGCTGGG - Intronic
1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG + Intergenic