ID: 1137661654

View in Genome Browser
Species Human (GRCh38)
Location 16:50212344-50212366
Sequence CACCACACTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137661646_1137661654 15 Left 1137661646 16:50212306-50212328 CCTTGGCCTCCCAAAGTGCTAGG 0: 6817
1: 95257
2: 215319
3: 232657
4: 146568
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491
1137661648_1137661654 9 Left 1137661648 16:50212312-50212334 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491
1137661651_1137661654 5 Left 1137661651 16:50212316-50212338 CCAAAGTGCTAGGATTACAGGTG 0: 6033
1: 84644
2: 218857
3: 252033
4: 196794
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491
1137661645_1137661654 18 Left 1137661645 16:50212303-50212325 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491
1137661644_1137661654 19 Left 1137661644 16:50212302-50212324 CCCGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491
1137661650_1137661654 6 Left 1137661650 16:50212315-50212337 CCCAAAGTGCTAGGATTACAGGT 0: 6328
1: 96058
2: 316692
3: 235985
4: 141398
Right 1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG 0: 1
1: 0
2: 5
3: 69
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137661654 Original CRISPR CACCACACTTGGCCTGTTAC TGG Intronic
901315792 1:8307230-8307252 CACCGCACCTGGCCTGTTTCTGG + Intergenic
901620597 1:10583023-10583045 CACCATACCTGGCCTGGTAACGG + Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
903504373 1:23822885-23822907 CACCACGCTTGGCCTGAAGCAGG - Intronic
903640075 1:24853299-24853321 CACCACGCCTGGCCTGTTTGGGG + Intergenic
903733219 1:25513303-25513325 CACCACACCTGGCCAGAAACTGG + Intergenic
904688676 1:32277518-32277540 CACCCCTCTTGGTCTGTTACTGG + Intronic
904939234 1:34153303-34153325 CAGCGCACCTGGCCTGTAACTGG + Intronic
905612444 1:39365962-39365984 CACCTCACCTGGCCTATTTCTGG + Intronic
905669636 1:39783046-39783068 CACCACACCTGGCCGGATACAGG + Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
907006472 1:50919729-50919751 CACCAGCCTTGGCCTTTTACAGG + Intronic
907820442 1:57962581-57962603 CACCACACCTGGCCTCTTCCTGG - Intronic
907899631 1:58726170-58726192 CACCACGCCTGGCCTATTTCAGG - Intergenic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909674811 1:78227174-78227196 TACCACCCTTGGCTTGTTCCAGG + Intergenic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911204162 1:95075843-95075865 GACCACACTTGGCATGTAGCTGG + Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912445818 1:109735461-109735483 AACCACACCTGGCCTGTTTTGGG + Exonic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
914238484 1:145834376-145834398 CACCCCGCTCAGCCTGTTACTGG - Intronic
915202707 1:154244644-154244666 CACCACACCTGGCCCATTACTGG + Intronic
915571905 1:156749472-156749494 CCCCACACTTTGCCTGTCTCTGG - Intronic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918552405 1:185758345-185758367 CACCACACCTGGCCTGGAAGAGG - Intronic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
920011000 1:202867619-202867641 CACCACACCTGGCCTTTTTCAGG + Intergenic
921860269 1:220035909-220035931 CACCACACCTGGCTTGTGATGGG - Intronic
922438935 1:225635332-225635354 CACCACACCTAGCCTGAAACTGG + Intronic
922511776 1:226174474-226174496 CACCACACCTGGCTTTTTCCAGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
923917762 1:238528897-238528919 CACCATGCCTGGCCTGTTTCTGG - Intergenic
924219030 1:241854423-241854445 CACCGTACCTGGCCTGTTAAAGG + Intronic
924744904 1:246822722-246822744 CAGCACACCTGGCCTGGTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1064021405 10:11812339-11812361 CACTGCACCTGGCCTGTGACTGG - Intergenic
1064356181 10:14620303-14620325 CACCGCGCTTGGCCTATTTCTGG + Intronic
1064393224 10:14959415-14959437 CACAACACTTGGCCTCTCGCTGG + Intergenic
1064609794 10:17086250-17086272 CACCGCGCCTGGCCTGTGACTGG + Intronic
1064732498 10:18346883-18346905 CACTGCACCTGGCCTGTTAGTGG + Intronic
1064860385 10:19818439-19818461 CACAACACTTCGCCTGTCCCTGG + Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1065447876 10:25821861-25821883 CACCACACCTGGCCTTCTTCGGG + Intergenic
1065685150 10:28276902-28276924 CACCACACCTGGCCTGTAGAAGG - Intronic
1065873388 10:29975487-29975509 CACCACACTTGGCCTTCTTATGG + Intergenic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069393709 10:67965058-67965080 CACCACACCTGGCCTAATGCTGG + Intronic
1069711656 10:70493271-70493293 CACCACTCATAGCCTGTTTCTGG + Intronic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1070403674 10:76075804-76075826 CACCACAGTAGGCCAGATACTGG - Intronic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071942783 10:90607742-90607764 GACCGCCCTTGGCCTGTTACTGG - Intergenic
1072162327 10:92780138-92780160 CACCACACCTGGCCAGTATCTGG - Intergenic
1072863616 10:99033492-99033514 CACTGCGCCTGGCCTGTTACTGG - Intronic
1073126638 10:101154757-101154779 CACCACACCTGGCCTCTTCATGG + Intergenic
1073233481 10:101992980-101993002 CACCGCGCCTGGCCTGATACTGG - Intronic
1073261157 10:102191423-102191445 CACCACACCTGGCCAGGAACTGG + Intergenic
1073352131 10:102827514-102827536 CACCACACTTGGCCTCCTGCAGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073696592 10:105876527-105876549 CACCATGCCTGGCCTGTTAAAGG + Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1077051006 11:566924-566946 CACCACACCCGGCCTCTCACTGG + Intergenic
1077534884 11:3119297-3119319 CACCACGCCTGGCCTTTGACAGG + Intronic
1078223901 11:9374720-9374742 CACCACGCCTGGCCAGTTAAAGG - Intergenic
1078240025 11:9522780-9522802 CACCACACCTGGCCTATTTGGGG + Intronic
1078272558 11:9809832-9809854 CACCACGCCTGGCCTATTTCAGG + Intronic
1078428920 11:11272315-11272337 CATCACACTTGCCCTGGTTCAGG + Intronic
1078838067 11:15051302-15051324 CACCACACCTGGCCAGTTTTTGG - Intronic
1078948887 11:16105412-16105434 CACCACACTTGGCCAGCTGTAGG - Intronic
1079366112 11:19811570-19811592 TACCACATTTAGCCTTTTACAGG + Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080658874 11:34279940-34279962 CACCACACCTGGCCAGAGACAGG + Intronic
1080973622 11:37308269-37308291 CATCACACTTGGCATTTTTCTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087111730 11:94477006-94477028 CAGCACGCCTGGCCTGTTCCAGG + Intronic
1087738470 11:101860721-101860743 CACCACAGTTGTCCTGCTTCAGG + Intronic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1089006392 11:115094943-115094965 CACCACACCTGGCCCCTAACTGG + Intergenic
1089851791 11:121503693-121503715 CACTGCACCTGGCCTGTTTCTGG + Intronic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090588751 11:128242204-128242226 CACCACACTCGGCCGGTTTGTGG - Intergenic
1091026628 11:132147375-132147397 CATCACACTTGGCCACTTTCTGG + Intronic
1091455356 12:603123-603145 CACCACACTGGGCCTGTTTGCGG + Intronic
1091875798 12:3931792-3931814 CAGCACACTTCGCTTGTTAAAGG - Intergenic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092250911 12:6895892-6895914 CACCACCCCTGGCCTGAGACAGG - Intronic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1094609252 12:31977473-31977495 CACCATGCCTGGCCTGTTTCTGG + Intronic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096058351 12:48674660-48674682 CACCACACCTGGCCCTTTGCTGG - Intronic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1096729271 12:53594597-53594619 CACCGCACTTGGCCTGGGACTGG - Intronic
1096750611 12:53756544-53756566 CACTGCACTTGGCCTCTTTCAGG + Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098251467 12:68574082-68574104 CACCACACCTGGCCTCTTTAGGG + Intergenic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1100237164 12:92672510-92672532 CACCACGCCTGGCCTGCCACAGG - Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1100487289 12:95042499-95042521 CACCGCACCTGGCCTGTCAAAGG + Intronic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101765372 12:107693464-107693486 CACCACACCTGGCCTCATAGAGG + Intronic
1101893969 12:108740672-108740694 CACCACACCTGGCCTGATGTAGG + Intergenic
1102137798 12:110589646-110589668 CACCACACCTGGCCAGTTTTTGG - Intergenic
1102274147 12:111567211-111567233 CACCACGCCCGGCCTGTTTCTGG - Intronic
1102787408 12:115616082-115616104 CACCACACTTGGCCTCATGCAGG + Intergenic
1103442141 12:120971097-120971119 CACCACACCTGGCCGCTTGCAGG + Intergenic
1103861986 12:124022887-124022909 CACCGCGCCTGGCCAGTTACTGG + Intronic
1103935232 12:124472539-124472561 CACCCCACGTTGCCTGGTACTGG + Intronic
1105434030 13:20362049-20362071 CACCACACCTGGCCTGCCCCGGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1106730173 13:32533011-32533033 CACCACACCTAGCCTGTTTCTGG + Intronic
1107036266 13:35905655-35905677 CACCACACCTGGCCTGGCTCTGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109790521 13:67241740-67241762 CACCACACCTGGCCCATTTCTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111162956 13:84419902-84419924 CACCACCCTTGGCCTATTTTAGG - Intergenic
1111881380 13:93961100-93961122 CACCGCACTTGGCCTATTGCTGG + Intronic
1112398993 13:99059270-99059292 CACCTCAATGGGCCTGTTCCAGG + Intronic
1113850956 13:113417681-113417703 CAGCTCACTTAGCCTGTTGCGGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1116000660 14:39239255-39239277 CACCACACCTGGCCTTAGACTGG - Intronic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116842894 14:49837361-49837383 CACCACACTTGGCCTTCCCCTGG - Intronic
1117196997 14:53350205-53350227 CACCACACCCGGCCTGGCACTGG + Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117884991 14:60351549-60351571 CAACACACTTGTTCTATTACTGG - Intergenic
1118779339 14:68996440-68996462 CACCACACTTGGCCAGCTGTGGG - Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119274357 14:73340127-73340149 CTACACACTTGGCCTCTCACTGG + Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120641132 14:87014386-87014408 CACCAAGCTTGACTTGTTACTGG + Intergenic
1122564758 14:102645115-102645137 AACCACACTTAGCCTGTTTGTGG + Intronic
1122914373 14:104850792-104850814 CACCACACCTGGCCTGTGCCTGG - Intergenic
1124170752 15:27370537-27370559 CAGCAGACTTGGTCTGTTAGTGG + Intronic
1125693622 15:41616835-41616857 CACCGCACCTGGCCTATTACAGG + Intergenic
1126050012 15:44676821-44676843 CACCACACTCGGACGGTGACTGG - Intronic
1126142192 15:45447842-45447864 CACCACACCTGGCCAGTTTGAGG + Intronic
1126147980 15:45494997-45495019 CACCACACTTGGCCAATTTTGGG - Intronic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1126608736 15:50506992-50507014 CACCACACTTGGCCTAAAACTGG - Exonic
1126635162 15:50772516-50772538 CACCACACCTGGCCAGTAAATGG - Intergenic
1128467188 15:67922579-67922601 CACCACACCTGGCCTCTTTATGG + Intergenic
1130688582 15:86060616-86060638 CACCGCGCCTGGCCTGATACTGG + Intergenic
1130969868 15:88723945-88723967 CACCGCACCTGGCCCGATACTGG - Intergenic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132200211 15:99947847-99947869 CACCACACCTGGCCCATTATAGG + Intergenic
1132601872 16:776412-776434 CACCACACCTGGCCTGCTTTTGG - Intronic
1134479231 16:14603214-14603236 CATCACACCTGGCCTCTAACTGG + Intronic
1134684008 16:16146234-16146256 CACCTCACTGGGCCCCTTACTGG - Intergenic
1135415199 16:22263678-22263700 CTCCACACTTGCCCCGTTACTGG - Intronic
1135922357 16:26662628-26662650 CACCACGCCTGGCCTGTCATTGG + Intergenic
1135971222 16:27073455-27073477 CACTACACTTGGCCTGAGACAGG - Intergenic
1136053804 16:27672891-27672913 CACCAAACATGGCCAGTTTCAGG - Intronic
1136845844 16:33574895-33574917 TACCACACCTGGCCTATTCCTGG + Intergenic
1137255822 16:46774511-46774533 CACCGCACTTGGCCTGGGAGGGG - Intronic
1137661654 16:50212344-50212366 CACCACACTTGGCCTGTTACTGG + Intronic
1138521228 16:57572185-57572207 CACCACGCCTGGCCTGTTTTTGG - Intronic
1138714308 16:59004074-59004096 CACCTCACTTGGGCTGTGTCAGG + Intergenic
1139419820 16:66843453-66843475 CACCACTCCTGGCCTGACACTGG - Intronic
1139555371 16:67705648-67705670 CACCACACCCAGCCTATTACAGG - Intronic
1139941557 16:70609365-70609387 CACCACGCTTGGCCTGAAAGTGG + Intronic
1141059691 16:80854368-80854390 CACCACACTTGGCCTGGCCATGG - Intergenic
1141081600 16:81057741-81057763 CACCACACCCGGCCTGTTTCAGG - Intronic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1141582942 16:85012613-85012635 CACCACACCTGGCCTTATTCTGG - Intergenic
1203107552 16_KI270728v1_random:1423548-1423570 TACCACACCTGGCCTATTCCTGG + Intergenic
1143822051 17:9572694-9572716 CACCACACCTGGCCTTTTATAGG + Intronic
1144067320 17:11636290-11636312 CACCGCGCCTGGCCTGTTCCAGG + Intronic
1144608164 17:16686184-16686206 CACCACACCTGGCCTGTGATTGG + Intergenic
1144700947 17:17339013-17339035 CACCGCACCTGGCCTGTCATTGG + Intronic
1145127875 17:20316786-20316808 CACCACACCTGGCCTGTGATTGG + Intronic
1145196673 17:20900036-20900058 CACCACACCTGGCCTGTGATTGG - Intergenic
1146174463 17:30656320-30656342 CACCTGACTTGGCCTGAGACAGG - Intergenic
1146347919 17:32072351-32072373 CACCTGACTTGGCCTGAGACAGG - Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1147685129 17:42282626-42282648 CACCGCACCGGGCCTGTGACTGG + Intergenic
1147814854 17:43201889-43201911 CACCACGCCTGGCCTGTGAAGGG - Intronic
1148068546 17:44892046-44892068 CACCACGCCTGGCCTATTACTGG + Intronic
1148119731 17:45201405-45201427 CACCACACCCGGCCTGGTCCTGG + Intergenic
1148920770 17:51031200-51031222 CACCACACCTGGCCTGTAGTAGG + Intronic
1149468505 17:56897946-56897968 TACCACACTCTGCCTGCTACAGG + Intronic
1150013465 17:61528981-61529003 CACCACGCCTGGCCTGAAACTGG + Intergenic
1151912348 17:77092095-77092117 CACTACACCTGGCCTGTTTATGG + Intronic
1152098156 17:78284875-78284897 CACCACACCTAGCCTTTTTCTGG - Intergenic
1152711935 17:81875716-81875738 CACCGCACTTGGCCTTTTTTTGG - Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1153850188 18:9086641-9086663 CACCACACCTGGCCTATAAAGGG + Intergenic
1154046777 18:10913363-10913385 CTCCACACTTGGCCTGTGCTTGG - Intronic
1154174883 18:12079645-12079667 CTCCACACTTGGCCTGTGCTTGG + Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156328833 18:36100493-36100515 CACCACACTCAGGCTGTAACTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1158177926 18:54678631-54678653 CACCACACCTGGCCAATTCCTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160530692 18:79560646-79560668 CCCCACACGTGGCCTGTCAGGGG - Intergenic
1160944043 19:1633002-1633024 CTCCACACTGGGCTTGTTCCTGG - Intronic
1161417025 19:4153081-4153103 CACCGCACCCGGCCAGTTACAGG - Intergenic
1162215576 19:9131122-9131144 CACCACATCTGGCCTGTTTTGGG + Intergenic
1162251567 19:9448521-9448543 CACCTCACTTGGCCCCTTAACGG + Intergenic
1162353083 19:10163253-10163275 CACCACACCTGGCCTAGAACAGG + Intronic
1163308690 19:16498956-16498978 CACCACGCCTAGTCTGTTACTGG + Intronic
1163486019 19:17586563-17586585 CACCATACCTGGCCGGGTACAGG - Intergenic
1163909144 19:20173540-20173562 CACCACACCTGGCCTTTTTTTGG - Intronic
1164097085 19:22021336-22021358 GACAACTCTTGGCCTATTACTGG - Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1165690578 19:37859963-37859985 CACCACACCTGGCCTGCTTTTGG - Intergenic
1166200183 19:41232331-41232353 CACCACACCTGGCCTGGTTTTGG - Intronic
1166325588 19:42048748-42048770 CACCACACTTGGCCCTTTATTGG - Intronic
1167087201 19:47318580-47318602 CACCACACCTGGCCTGAAATGGG + Intronic
1167301893 19:48682690-48682712 CACCACACCTGGCCAGCTTCGGG - Intergenic
1167661273 19:50797377-50797399 CACCATGCCTGGCCTGTCACGGG - Intergenic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925878631 2:8332516-8332538 CACCACACCTGGCAGGTAACAGG + Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
927796601 2:26054476-26054498 CACCACACGTGGCCGGATAGGGG + Intronic
928394515 2:30933251-30933273 CATCCCACTGGGCCTGTCACTGG + Intronic
929104824 2:38354599-38354621 CACCACACCTGGCCCCTTATTGG - Intronic
929169845 2:38920694-38920716 CACCACACCTGGCCTGTGAATGG + Intronic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
929851798 2:45598324-45598346 CACCACGCCTGGCCTGTCACTGG - Intronic
932184931 2:69686456-69686478 CACCGCACCTGGCCTGAGACAGG + Intronic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933270838 2:80231273-80231295 CACCACACCCGGCCTGTTCCTGG + Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935535243 2:104285838-104285860 CTCCACCCTTTGCCTGTGACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935977335 2:108591746-108591768 CACCATGCTTGGCCTTTTAAGGG + Intronic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937499507 2:122462756-122462778 CACCTCACTCGTCTTGTTACTGG - Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937844936 2:126569476-126569498 CACTGCACTTGGCCTGTTTTGGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
941636205 2:167937327-167937349 CATCACACATAGCTTGTTACTGG - Intergenic
941977972 2:171425868-171425890 CACCACACCTGGCCTCTTTCAGG - Intronic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
943641032 2:190358504-190358526 CACCATACCTGGCCTATTAAGGG + Intronic
944506719 2:200419862-200419884 CACCACACTTAGCCAGTCAGAGG + Intronic
944590783 2:201215933-201215955 CACTGCACTTGGCTTGTCACTGG + Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
947040201 2:225910015-225910037 CACCACGCCTGGCCGGTCACTGG - Intergenic
947154206 2:227145157-227145179 CACCGCACTTGGCCTTTTAGTGG - Intronic
947512956 2:230775520-230775542 CACCACACCTGGCCTCTTTGAGG + Intronic
1170040531 20:12035224-12035246 CACCACACCTGGCCCCTTGCTGG - Intergenic
1170277462 20:14607962-14607984 CACCACACCTGGCCTTTTCCTGG - Intronic
1170608363 20:17890996-17891018 CACCACACCTGACCTGTTGATGG - Intergenic
1172071808 20:32262889-32262911 CACCACGCCTGGCCTGTTCGTGG - Intergenic
1172525156 20:35596369-35596391 CACCACACCTGGCCAGATTCTGG - Intergenic
1173809751 20:45948608-45948630 CACAAGACCTGGCCTGGTACAGG + Intergenic
1174401728 20:50279454-50279476 CACCACACATGGCCAGAGACAGG - Intergenic
1174716605 20:52765756-52765778 CACCATACTTGGCCTCTCGCTGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177037332 21:16060374-16060396 CCCCTCACTTGCCATGTTACAGG - Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178781716 21:35609610-35609632 CAACACACTTGTCATGTTAAAGG - Intronic
1180218910 21:46345503-46345525 CACCATGCCTGGCCTGTTTCTGG + Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1180625020 22:17188589-17188611 CACCACGCCTGGCCTGCTCCTGG - Intronic
1180925727 22:19553240-19553262 CACCACACCCTGCCTGTTAAAGG + Intergenic
1181100139 22:20533452-20533474 AACCACACAGGGTCTGTTACTGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
1185054933 22:48574756-48574778 CACCACACTGGTCTTGGTACTGG + Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
950311780 3:11965173-11965195 CACCACGCCTGGCCTTTTCCAGG + Intergenic
950434638 3:12971775-12971797 CACCACACCTGGCCCATAACTGG - Intronic
950739289 3:15036831-15036853 CACCACACCCAGCCTGTTATAGG - Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951816967 3:26764700-26764722 CACATCACTTGGCCAGTTACTGG + Intergenic
951880305 3:27474831-27474853 CACCGCGCCTGGCCTGATACTGG - Intronic
952380325 3:32799468-32799490 CACCACACCTGGCCTGTTTGTGG - Intergenic
953178976 3:40579139-40579161 CACCACACCTGGGCTGTAGCAGG + Intergenic
953315476 3:41922881-41922903 CACCGCACCTGGCCTGGTTCAGG - Intronic
953752886 3:45622954-45622976 CACCGCACCTGGCCTTTTAAAGG + Intronic
955418753 3:58716559-58716581 GACCACTTTTGGCCTGCTACTGG - Intergenic
956896465 3:73665868-73665890 CACCACGCCTGGCCAGTTCCTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959439510 3:106359190-106359212 GACAACGCTTGGCCTTTTACTGG + Intergenic
960178740 3:114548805-114548827 CACCACACTTGGCCTATGACTGG + Intronic
960729884 3:120715248-120715270 CACCACACCTGGCCTGTATTGGG - Intronic
960817721 3:121689832-121689854 CACCACTCTTGGCTTGTTAGGGG - Intronic
960931164 3:122852278-122852300 CACCACACCTGGCCTGTCTTTGG + Intronic
961473429 3:127132600-127132622 CACCACACTTTCCCAGCTACAGG + Intergenic
961541328 3:127601652-127601674 CACCACACCCGGCCCGTTACAGG + Intronic
962683297 3:137822398-137822420 CACCACAGCTGGCCTCTAACTGG - Intergenic
962773919 3:138640758-138640780 CACCACACTTGGCTAGTTTCAGG + Intergenic
963071590 3:141309433-141309455 CACCACACCTGGCCACCTACTGG + Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
964114939 3:153126356-153126378 CACCACACCCAGCTTGTTACTGG + Intergenic
964237274 3:154546052-154546074 CACCACTCCTGGCCTGTGATAGG + Intergenic
965084394 3:164075649-164075671 CACCACACCTGGCCTATTTTAGG + Intergenic
965269583 3:166596984-166597006 TCACACACTGGGCCTGTTACAGG + Intergenic
965833928 3:172830245-172830267 CACCACACCTGGCCAGTTTCAGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966762144 3:183428166-183428188 CGCCAGACTTGGTCTGTCACGGG - Exonic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968162298 3:196436549-196436571 CACCACACCTGGCCTGTCAAAGG - Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969877497 4:10146649-10146671 CACCACACTTGGCTAGTTTTTGG - Intergenic
970109994 4:12627169-12627191 CACCACACCTGGCCTCTTCTAGG + Intergenic
970838317 4:20437622-20437644 CACCACGCTCGGCCTGTTTTGGG - Intronic
970978528 4:22070224-22070246 CACCATGCCTGGCCTATTACTGG + Intergenic
971266733 4:25102554-25102576 CACCACACCCGGCCTCTTTCCGG - Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
974006226 4:56559853-56559875 CACCACACCTGGCCTTTATCAGG + Intronic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
975784870 4:77877186-77877208 CACCACACCTGGCCTGACAATGG + Intronic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976562516 4:86518309-86518331 CACCACACCTGGCCTCTTTCTGG + Intronic
976627285 4:87199855-87199877 CACCACACCTGGCATGTTTTTGG - Intronic
976734295 4:88295060-88295082 CACCACACCCGGCCTGCAACTGG - Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978486534 4:109260782-109260804 CACCACACCTGGCCATATACTGG + Intronic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979320795 4:119323011-119323033 CCCCAAGCTTGGCCTGTTCCTGG - Intergenic
979351775 4:119651671-119651693 CACCGCACCTGGCCTGTTGAGGG + Intergenic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979794334 4:124827938-124827960 CACCACACTTGGCCAGCTACTGG - Intergenic
980163525 4:129196692-129196714 CATCACACTTGGCCTGGAAATGG + Intergenic
980387946 4:132111173-132111195 GACAACACTTGGCCTGTTACTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983121989 4:163897766-163897788 CACCACACCTGGCCTCTTCAAGG - Intronic
984951694 4:185012581-185012603 CACCACGCCTGGCCTGTTTTTGG - Intergenic
985511718 5:317517-317539 CACCACACTGGGCCTGCGCCAGG - Intronic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986577566 5:9228459-9228481 GGGCACACTTGGCCTGTTTCAGG - Intronic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988960445 5:36365521-36365543 CACCACACCTGGCCTGCTTTAGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989231640 5:39094136-39094158 CACCGCACCTGGCCAATTACAGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991600450 5:68347086-68347108 CAACACTATTGGCCTGTTGCTGG - Intergenic
992502559 5:77356876-77356898 CACCTCACTTGCCCTTTTGCAGG + Intronic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993848409 5:92974293-92974315 CACCACACCTGGCCAATTAGAGG + Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995427732 5:112043717-112043739 CAAAGCTCTTGGCCTGTTACTGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996564384 5:124864004-124864026 CACCACACCCGGCCTGAAACTGG - Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
997360837 5:133293775-133293797 CACCAGCCTTGAGCTGTTACAGG + Intronic
998084982 5:139312938-139312960 CACCGCACCTGGCCTTTCACAGG + Intronic
998099188 5:139417860-139417882 CACCACACCTGGCCACTCACTGG + Intronic
998453881 5:142255539-142255561 CACCACACCTGGCCTGAGAATGG - Intergenic
998616351 5:143744728-143744750 CACCACCCCTGGCCTGTGAAGGG - Intergenic
999700669 5:154225068-154225090 CACCACACCTGGCCTTTTTGGGG + Intronic
1000223244 5:159234239-159234261 CACAGCTCTTGGCTTGTTACTGG - Intergenic
1001024501 5:168212681-168212703 CCCCAAAATTGGCCTGTTATAGG + Intronic
1001038987 5:168318846-168318868 CACCATGCCTGGCCTGTGACTGG + Intronic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1002121830 5:177010902-177010924 CACCACACTTGGCCCAGTAGTGG - Intronic
1002296034 5:178232018-178232040 CAGCACACTTGACCTGTGAGGGG - Intronic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1004941073 6:20556747-20556769 CACCACACCTGGCCTATGTCAGG - Intronic
1005957493 6:30674421-30674443 CACCGCACTGGGCCTGAGACAGG + Intergenic
1006298708 6:33181772-33181794 CACCACACCTGGCCCCTTTCAGG + Intronic
1006514357 6:34537876-34537898 CACCACACCTGGCATGGTGCAGG - Exonic
1006809909 6:36813240-36813262 CACCACACCTGGCCTATTTAAGG - Intronic
1007538912 6:42622690-42622712 CACCGCACCTGGCCTGTTTTTGG + Intronic
1007543720 6:42674473-42674495 CACCACACCTGACCCGTTGCTGG - Intronic
1007670117 6:43545416-43545438 CACCACACCTGGCCTCTCACAGG - Intronic
1007743493 6:44027475-44027497 CACCACACTTGGCCAGATTATGG + Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009520463 6:64675714-64675736 CACCACACCTGGCCTGTGATTGG + Intronic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1010110483 6:72223657-72223679 CACCGCACCTGGCCTGCAACTGG - Intronic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011451082 6:87492836-87492858 CACCACACCTGGCCTAATCCTGG + Intronic
1011726868 6:90218584-90218606 CTCCAGACTTGGCCTGCTTCAGG - Intronic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013131079 6:107233521-107233543 CACCACTCCTGGCCTCTCACTGG - Intronic
1013403780 6:109824150-109824172 CACCCCACTTGGGCTGCCACAGG - Intronic
1014837105 6:126172005-126172027 CACCACACCTGGCCTTTAAAGGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1017184684 6:151588963-151588985 CACCACATCTGGCCTGTTTTTGG - Intronic
1017341620 6:153330771-153330793 ATCCACACTTGACCTGTTCCAGG - Intergenic
1017726686 6:157281156-157281178 ACCCACACTGGGCCTGTTCCTGG - Intergenic
1017881142 6:158563430-158563452 CACCACGCTTGGCCAGGAACTGG + Intronic
1018235203 6:161717132-161717154 CATCTCAGTTAGCCTGTTACAGG - Intronic
1018535030 6:164810484-164810506 GACCACTCTTGGCCTGTTACTGG - Intergenic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020186484 7:5962915-5962937 CACCGCACTGGGCCAGTTTCTGG - Intronic
1020296430 7:6761859-6761881 CACCGCACTGGGCCAGTTTCTGG + Intronic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021331653 7:19345898-19345920 CACCACACCTGGCCTTTGATGGG - Intergenic
1021480834 7:21114633-21114655 GACCACACTTGAAGTGTTACTGG - Intergenic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1022043795 7:26606744-26606766 CAACACACTGGGCCTGTTGGAGG + Intergenic
1022078886 7:27000338-27000360 CACAGCTATTGGCCTGTTACTGG + Intergenic
1023634880 7:42199765-42199787 CACCACACCTGGCCAGGTATAGG - Intronic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1025223456 7:57136093-57136115 CACCATGCCTGGCCTGTTTCAGG - Intronic
1025634264 7:63307719-63307741 CACCATGCCTGGCCTGTTTCAGG - Intergenic
1025648434 7:63440447-63440469 CACCATGCCTGGCCTGTTTCAGG + Intergenic
1025743340 7:64220800-64220822 CACCACACCTGGCCTGCCAGTGG + Intronic
1025834067 7:65079450-65079472 CACCACACCTGGCCTATAAGGGG - Intergenic
1025903838 7:65768967-65768989 CACCACACCTGGCCTATAAGGGG - Intergenic
1026173358 7:67973831-67973853 CACCACACCTGGCCTATAAGTGG + Intergenic
1027240339 7:76323520-76323542 CACCACACCTGGCCTAGTATCGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028132063 7:87187243-87187265 CACCACACCTGGCCTATACCTGG - Intronic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030030819 7:105367549-105367571 GACCACACCTGGCCAGTTACAGG + Intronic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1030747404 7:113183915-113183937 CACTATACTTGGCCTATTAAAGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031595966 7:123649525-123649547 CACCACACCTGGCCTACTATAGG - Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1031825433 7:126559459-126559481 CACCACACTGAGCCAGCTACTGG + Intronic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1033993438 7:147315765-147315787 CACCACACCTGGCCTTATTCTGG + Intronic
1034626791 7:152499607-152499629 CACCACACCTGGCCTGATTGTGG + Intergenic
1035569672 8:663596-663618 CACCACACTCGTCCTGTTTGTGG - Intronic
1036601028 8:10260292-10260314 CACCACGCCTGGCCAGTGACAGG + Intronic
1037781175 8:21870160-21870182 CACCACACCTGGCCAGTTTAAGG - Intergenic
1038311836 8:26450652-26450674 CACCGCACCTGGCCTGTAAGGGG - Intronic
1038541122 8:28390869-28390891 CACCACACCTGGCCTGTAGTAGG + Intronic
1038643366 8:29344759-29344781 CACCATAATAGGACTGTTACTGG + Intronic
1040592537 8:48806703-48806725 CACCACACCTGGCCTATTCCTGG + Intergenic
1041923888 8:63215597-63215619 CACCACACCTGGCCTTATCCTGG + Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1045518154 8:102879268-102879290 CACCACCCCTGGCCTGAAACTGG - Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046994370 8:120500766-120500788 CACCACGCCTGGCCTGTTAAAGG - Intronic
1047452709 8:124980068-124980090 CACCACACCTGGCCCATTATTGG + Intergenic
1049631318 8:143659651-143659673 CACCATACCTGGCCTGAAACTGG + Intergenic
1050452704 9:5800384-5800406 CACCACACCTGGCCAGTTTGAGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056171369 9:83988170-83988192 CACCACACCTGGCCACATACAGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056630226 9:88287427-88287449 CACCACACCTGGCCAGATAAAGG - Intergenic
1057264055 9:93602539-93602561 CACCACACCTGGCCTCCTAGAGG + Intronic
1057531398 9:95849801-95849823 CACCGCACCTGGCCTGTTGGTGG - Intergenic
1057620568 9:96630880-96630902 CACCACGCCTGGCCGGTCACAGG + Intergenic
1057901520 9:98952673-98952695 CACCACACTTGGCCAGATTAGGG + Intronic
1060181587 9:121538119-121538141 CACCACACCTGGCCTGATACTGG + Intergenic
1060589677 9:124808865-124808887 CACCACGCCCGGCCTGTTCCAGG - Intronic
1061082250 9:128378664-128378686 CTCCACACCTGGCCTGGGACTGG - Intronic
1061966439 9:134016589-134016611 CACCACGCCTGGCCTGTAAATGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1186480518 X:9893415-9893437 CACCAAACCTGGTCTGTAACAGG + Intronic
1186505469 X:10088156-10088178 AACTTCACTTTGCCTGTTACTGG + Intronic
1187317870 X:18214129-18214151 CACCACACCTGGCTTGTGTCTGG - Intronic
1187361971 X:18636967-18636989 CACCACACCTGGCCTGATCCTGG - Intronic
1187432316 X:19236386-19236408 AACCACACTTGACATTTTACTGG + Intergenic
1187484752 X:19692975-19692997 CACCATGCCTGGCCTGCTACTGG + Intronic
1187487298 X:19716691-19716713 AACCACGCTTGGCATGTAACTGG + Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1188124658 X:26352489-26352511 CACCACACCTGGCTTGAGACTGG + Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191169737 X:57431101-57431123 CAATACATTTGGCCTGTTTCAGG + Intronic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191832729 X:65432316-65432338 GATCACTCTTGGCCTGCTACTGG - Intronic
1192873562 X:75206950-75206972 CACCACACTTGGCCAATGATGGG + Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193800489 X:85929811-85929833 CACCACACCTGGCCTGGTTATGG - Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1195650341 X:107276893-107276915 CACCACACCTGGCCTAGTAATGG + Intergenic
1195680085 X:107538945-107538967 CACCACACCTGGCCTGGTAATGG + Intronic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196318854 X:114264756-114264778 CACCACGCCAGGCCTATTACTGG - Intergenic
1196632554 X:117960087-117960109 CACCACACTTGGCCTTCTGATGG - Intronic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199290176 X:146096322-146096344 CACCGCACTTGGCCTATAATTGG - Intergenic
1200292925 X:154888681-154888703 CACCACGCCTGGCCTGTAATAGG + Intronic
1200339773 X:155384413-155384435 CACCACGCCTGGCCTGTAATAGG + Intergenic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200346697 X:155456275-155456297 CACCACGCCTGGCCTGTAATAGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201576186 Y:15464071-15464093 CACCACACCTGGCCTATTTGTGG - Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic